| Contig_ID | Contig_def | CRISPR array number | Contig Signature genes | Self targeting spacer number | Target MGE spacer number | Prophage number | Anti-CRISPR protein number |
|---|---|---|---|---|---|---|---|
| CP032846 | Enterobacter hormaechei strain C15117 plasmid unnamed4, complete sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| CP032844 | Enterobacter hormaechei strain C15117 plasmid unnamed2 | 0 crisprs | 0 | 0 | 0 | 0 | |
| CP032845 | Enterobacter hormaechei strain C15117 plasmid unnamed3 | 0 crisprs | 0 | 0 | 0 | 0 | |
| CP032843 | Enterobacter hormaechei strain C15117 plasmid unnamed1, complete sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| CP032841 | Enterobacter hormaechei strain C15117 chromosome, complete genome | 3 crisprs | 0 | 1 | 0 | 0 | |
| CP032842 | Enterobacter hormaechei strain C15117 plasmid pSPRC-Echo1, complete sequence | 0 crisprs | 0 | 0 | 0 | 0 | |
| CP032847 | Enterobacter hormaechei strain C15117 plasmid unnamed5 | 0 crisprs | 0 | 0 | 0 | 0 |
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| CP032841_1 | 447426-447509 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| CP032841_2 | 2503344-2503426 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | CRISPR_location | CRISPR_type | Repeat_type | Spacer_info | Cas_protein_info | CRISPR-Cas_info |
|---|---|---|---|---|---|---|
| CP032841_3 | 3067399-3067495 | Orphan |
NA
|
1 spacers
|
|
You can click texts colored in the table to view more detailed information
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_ID | Protospacer_location | Mismatch | Identity |
|---|
| CRISPR_ID | Spacer_Info | Spacer_region | Spacer_length | Hit_phage_ID | Hit_phage_def | Protospacer_location | Mismatch | Identity |
|---|---|---|---|---|---|---|---|---|
| CP032841_2 | 2503372-2503398 | 27 | NZ_LR134256 | Klebsiella aerogenes strain NCTC9644 plasmid 3, complete sequence | 1565-1591 | 3 | 0.889 | |
| CP032841_2 | 2503372-2503398 | 27 | NZ_CP045329 | Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence | 351352-351378 | 4 | 0.852 | |
| CP032841_2 | 2503372-2503398 | 27 | NZ_CP045345 | Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence | 54243-54269 | 4 | 0.852 | |
| CP032841_2 | 2503372-2503398 | 27 | NZ_CP045335 | Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence | 103532-103558 | 4 | 0.852 | |
| CP032841_2 | 2503372-2503398 | 27 | MN013086 | Klebsiella phage vB_Kpn_Chronis, complete genome | 33543-33569 | 4 | 0.852 |
ctccacctccgcaggcattgatataac CRISPR spacer ctccacctccgcaggcattggtactac Protospacer ********************.**. **
ctccacctccgcaggcattgatataac CRISPR spacer ccgcaccgccgcaggcatcgatataac Protospacer *. **** **********.********
ctccacctccgcaggcattgatataac CRISPR spacer ccgcaccgccgcaggcatcgatataac Protospacer *. **** **********.********
ctccacctccgcaggcattgatataac CRISPR spacer ccgcaccgccgcaggcatcgatataac Protospacer *. **** **********.********
ctccacctccgcaggcattgatataac CRISPR spacer atccacctccgcaggcattggtacgac Protospacer *******************.**..**
| Region | Region Position | Protein_number | Hit_taxonomy | Key_proteins | Att_site | Prophage annotation |
|---|
| Acr ID | Acr position | Acr size |
|---|