Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP032761 Pseudomonas aeruginosa strain 268 chromosome, complete genome 4 crisprs NA 1 1 0 0

Results visualization

1. CP032761
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032761_1 60228-60375 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032761_2 426984-427097 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032761_3 3329859-3330101 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032761_4 5308811-5308918 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP032761_3 3.2|3330023|61|CP032761|PILER-CR 3330023-3330083 61 CP032761.1 3330102-3330162 1 0.984

1. spacer 3.2|3330023|61|CP032761|PILER-CR matches to position: 3330102-3330162, mismatch: 1, identity: 0.984 

accccggaaacgccggacaacgtcccaactccgtagggcgaataaccgctcgcggttatc	CRISPR spacer
accccggaaacgccggacaacgtcccaactccgtagggcgaataaccgctcgcggttatc	Protospacer
************************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP032761_4 4.1|5308835|60|CP032761|CRISPRCasFinder 5308835-5308894 60 MK510989 Pseudomonas phage BR322, partial genome 31234-31293 0 1.0
CP032761_4 4.1|5308835|60|CP032761|CRISPRCasFinder 5308835-5308894 60 MK510966 Pseudomonas phage CF53, partial genome 31235-31294 0 1.0
CP032761_4 4.1|5308835|60|CP032761|CRISPRCasFinder 5308835-5308894 60 KY707339 Pseudomonas phage JBD68, complete genome 33757-33816 0 1.0
CP032761_4 4.1|5308835|60|CP032761|CRISPRCasFinder 5308835-5308894 60 MK510981 Pseudomonas phage BR143, partial genome 31255-31314 0 1.0
CP032761_4 4.1|5308835|60|CP032761|CRISPRCasFinder 5308835-5308894 60 MK510967 Pseudomonas phage CF54, partial genome 4952-5011 0 1.0
CP032761_4 4.1|5308835|60|CP032761|CRISPRCasFinder 5308835-5308894 60 MK510991 Pseudomonas phage BR141, partial genome 31216-31275 0 1.0
CP032761_4 4.1|5308835|60|CP032761|CRISPRCasFinder 5308835-5308894 60 MK510980 Pseudomonas phage BR123, partial genome 31234-31293 0 1.0
CP032761_4 4.1|5308835|60|CP032761|CRISPRCasFinder 5308835-5308894 60 MK510983 Pseudomonas phage BR178, partial genome 31235-31294 0 1.0

1. spacer 4.1|5308835|60|CP032761|CRISPRCasFinder matches to MK510989 (Pseudomonas phage BR322, partial genome) position: , mismatch: 0, identity: 1.0 

gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	CRISPR spacer
gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	Protospacer
************************************************************

2. spacer 4.1|5308835|60|CP032761|CRISPRCasFinder matches to MK510966 (Pseudomonas phage CF53, partial genome) position: , mismatch: 0, identity: 1.0 

gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	CRISPR spacer
gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	Protospacer
************************************************************

3. spacer 4.1|5308835|60|CP032761|CRISPRCasFinder matches to KY707339 (Pseudomonas phage JBD68, complete genome) position: , mismatch: 0, identity: 1.0 

gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	CRISPR spacer
gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	Protospacer
************************************************************

4. spacer 4.1|5308835|60|CP032761|CRISPRCasFinder matches to MK510981 (Pseudomonas phage BR143, partial genome) position: , mismatch: 0, identity: 1.0 

gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	CRISPR spacer
gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	Protospacer
************************************************************

5. spacer 4.1|5308835|60|CP032761|CRISPRCasFinder matches to MK510967 (Pseudomonas phage CF54, partial genome) position: , mismatch: 0, identity: 1.0 

gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	CRISPR spacer
gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	Protospacer
************************************************************

6. spacer 4.1|5308835|60|CP032761|CRISPRCasFinder matches to MK510991 (Pseudomonas phage BR141, partial genome) position: , mismatch: 0, identity: 1.0 

gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	CRISPR spacer
gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	Protospacer
************************************************************

7. spacer 4.1|5308835|60|CP032761|CRISPRCasFinder matches to MK510980 (Pseudomonas phage BR123, partial genome) position: , mismatch: 0, identity: 1.0 

gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	CRISPR spacer
gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	Protospacer
************************************************************

8. spacer 4.1|5308835|60|CP032761|CRISPRCasFinder matches to MK510983 (Pseudomonas phage BR178, partial genome) position: , mismatch: 0, identity: 1.0 

gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	CRISPR spacer
gtgtcgtcagttgcaccccgttacgtcgtggtttgcaccccgttacgtcgtcatttgcac	Protospacer
************************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage