1. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to MK291445 (Paracoccus phage vB_PyeM_Pyei1, complete genome) position: , mismatch: 0, identity: 1.0
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
cctctcgacctcggcccgcaggtcggcctctg Protospacer
********************************
2. spacer 2.7|1251940|36|CP031078|CRISPRCasFinder matches to MK291445 (Paracoccus phage vB_PyeM_Pyei1, complete genome) position: , mismatch: 2, identity: 0.944
cccgcctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
tcagcctctcgacctcggcccgcaggtcggcctctg Protospacer
.* *********************************
3. spacer 1.8|344168|26|CP031078|CRT matches to MG252615 (Escherichia phage vB_EcoS_HSE2, complete genome) position: , mismatch: 5, identity: 0.808
ccccgcggtattctgtcggcggcttc CRISPR spacer
ccgcgcggtattctttcggcggcggg Protospacer
** *********** ********
4. spacer 3.24|2183036|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_008826 (Methylibium petroleiphilum PM1 plasmid RPME01, complete sequence) position: , mismatch: 5, identity: 0.844
caaggcgcggccacggtcggcagcgcgaccgc- CRISPR spacer
gaagccgcggccacggtcggcatcgcg-ctgca Protospacer
*** ***************** **** *.**
5. spacer 3.33|2183585|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.844
---gcccagatcgacgcgcaagcggagcaggtcgg CRISPR spacer
tgcgccc---tcgacgcgcaagccgagcaggtggg Protospacer
**** ************* ******** **
6. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to MN234216 (Streptomyces phage Gilgamesh, complete genome) position: , mismatch: 6, identity: 0.812
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ctcctcgacgtcggcccgcaggtcgacccccg Protospacer
*..****** ***************.**.*.*
7. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP044073 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
cttcgtgatctcggcccgcaggtaggcctcag Protospacer
*.** .**.************** ****** *
8. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
9. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
10. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
11. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
12. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
13. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
14. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
15. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
16. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
17. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
18. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
19. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
20. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
21. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
22. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
23. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
24. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
25. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
26. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
27. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
28. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
29. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
30. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
31. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
32. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
33. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
34. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
35. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
36. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
37. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
38. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
39. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
40. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
41. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
42. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
43. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
44. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
45. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
46. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
47. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
48. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
49. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
50. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
51. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
52. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
53. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
54. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
55. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
56. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
57. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
58. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
59. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
60. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
61. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
62. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
63. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
64. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
65. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
66. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
67. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
68. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
69. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
70. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
71. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
72. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
73. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
74. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
75. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
76. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
77. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
78. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
79. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
gcagaaaccgccgtcgccctgcgggagcccac-- CRISPR spacer
gccgaaacggccgtcgccctgc--gagccgatcg Protospacer
** ***** ************* ***** *.
80. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 6, identity: 0.812
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
cccggtgcggcgatggcggccagcgccaccac Protospacer
* ** ******** ************** *
81. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 6, identity: 0.812
caaggct-ccgccacggtcggcgatgccacggc CRISPR spacer
-attgctgcggccgcggtcggcgatgccatggc Protospacer
* *** * ***.***************.***
82. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812
caaggct-ccgccacggtcggcgatgccacggc CRISPR spacer
-gtggctgcggccaccggcggcgatgccacggc Protospacer
. **** * ***** * ***************
83. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to MT939492 (Xanthomonas phage Xoo-sp14, complete genome) position: , mismatch: 6, identity: 0.812
cgcccagcgcctgcgacagcgtcttggcccga CRISPR spacer
tgtccagcgcttgcgacatcgtcttggccggg Protospacer
.*.*******.******* ********** *.
84. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
cgcccagcgcctgcgacagcgtcttggcccga-- CRISPR spacer
cgcgcagcgcctgcgccagcgtct--gttcgagc Protospacer
*** *********** ******** *..***
85. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 6, identity: 0.812
cgcccagcgcctgcgacagcgtcttggcccga-- CRISPR spacer
cgcgcagcgcctgcgccagcgtct--gttcgagc Protospacer
*** *********** ******** *..***
86. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
cgcccagcgcctgcgacagcgtcttggcccga-- CRISPR spacer
cgcgcagcgcctgcgccagcgtct--gttcgagc Protospacer
*** *********** ******** *..***
87. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
cgcccagcgcctgcgacagcgtcttggcccga-- CRISPR spacer
cgcgcagcgcctgcgccagcgtct--gttcgagc Protospacer
*** *********** ******** *..***
88. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 6, identity: 0.812
cgcccagcgcctgcgacagcgtcttggcccga-- CRISPR spacer
cgcgcagcgcctgcgccagcgtct--gttcgagc Protospacer
*** *********** ******** *..***
89. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
cgcccagcgcctgcgacagcgtcttggcccga-- CRISPR spacer
cgcgcagcgcctgcgccagcgtct--gttcgagc Protospacer
*** *********** ******** *..***
90. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
cgcccagcgcctgcgacagcgtcttggcccga-- CRISPR spacer
cgcgcagcgcctgcgccagcgtct--gttcgagc Protospacer
*** *********** ******** *..***
91. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
cgcccagcgcctgcgacagcgtcttggcccga-- CRISPR spacer
cgcgcagcgcctgcgccagcgtct--gttcgagc Protospacer
*** *********** ******** *..***
92. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
cgcccagcgcctgcgacagcgtcttggcccga-- CRISPR spacer
cgcgcagcgcctgcgccagcgtct--gttcgagc Protospacer
*** *********** ******** *..***
93. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
cgcccagcgcctgcgacagcgtcttggcccga-- CRISPR spacer
cgcgcagcgcctgcgccagcgtct--gttcgagc Protospacer
*** *********** ******** *..***
94. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
cgcccagcgcctgcgacagcgtcttggcccga-- CRISPR spacer
cgcgcagcgcctgcgccagcgtct--gttcgagc Protospacer
*** *********** ******** *..***
95. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
cgcccagcgcctgcgacagcgtcttggcccga-- CRISPR spacer
cgcgcagcgcctgcgccagcgtct--gttcgagc Protospacer
*** *********** ******** *..***
96. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
cgcccagcgcctgcgacagcgtcttggcccga-- CRISPR spacer
cgcgcagcgcctgcgccagcgtct--gttcgagc Protospacer
*** *********** ******** *..***
97. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NC_010507 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD08, complete sequence) position: , mismatch: 7, identity: 0.781
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
gcgcacgacctcggcgcgcatgtcggcctcga Protospacer
* * ********** **** ********* .
98. spacer 3.3|2181755|32|CP031078|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.781
gccgaccatgccggaaaccgccggcgccagga CRISPR spacer
gaccaccttgccggcaaccgccggcgccggcc Protospacer
* * *** ****** *************.*
99. spacer 3.3|2181755|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gccgaccatgccggaaaccgccggcgccagga CRISPR spacer
gaccaccttgccggcaaccgccggcgccggcc Protospacer
* * *** ****** *************.*
100. spacer 3.3|2181755|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 7, identity: 0.781
gccgaccatgccggaaaccgccg-gcgccagga CRISPR spacer
gccgaccatcccggaaatcgccgcgcaatatg- Protospacer
********* *******.***** **. .* *
101. spacer 3.3|2181755|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 7, identity: 0.781
gccgaccatgccggaaaccgccg-gcgccagga CRISPR spacer
gccgaccatcccggaaatcgccgcgcaatatg- Protospacer
********* *******.***** **. .* *
102. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
gagcacttcattgactccagcggcgtggtgtc Protospacer
*.*.****..*******************
103. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 7, identity: 0.781
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
gagcacttcattgactccagcggcgtggtgtc Protospacer
*.*.****..*******************
104. spacer 3.15|2182487|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 7, identity: 0.781
gatgat--cgggcgcgtcgtgcgggccgtgctgg CRISPR spacer
--tgaccacgggcgcggcgtgcggtccgtgccga Protospacer
***. ******** ******* ******.*.
105. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 7, identity: 0.781
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
cggccggcggcgattgcggccacggccaccgc Protospacer
*. ****************** ***** *
106. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
accgcgccggcgattccggccagcgccgccgc Protospacer
**** ******** ***********.* *
107. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
accgcgccggcgattccggccagcgccgccgc Protospacer
**** ******** ***********.* *
108. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
accgcgccggcgattccggccagcgccgccgc Protospacer
**** ******** ***********.* *
109. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031193 (Humibacter sp. BT305 plasmid unnamed1) position: , mismatch: 7, identity: 0.781
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
cgcgcagcggcgattgcgggcagcgcagcggc Protospacer
*.***.************* ****** .*. *
110. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
cagacggcggccactgcggccagcgccagcac Protospacer
** .******* *.************** *
111. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 7, identity: 0.781
-cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttacgt-gcggcgattgcggccatcggcaccgc Protospacer
.***. **************** ** *** *
112. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 7, identity: 0.781
-cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttacgt-gcggcgattgcggccatcggcaccgc Protospacer
.***. **************** ** *** *
113. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 7, identity: 0.781
-cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttacgt-gcggcgattgcggccatcggcaccgc Protospacer
.***. **************** ** *** *
114. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 7, identity: 0.781
-cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttacgt-gcggcgattgcggccatcggcaccgc Protospacer
.***. **************** ** *** *
115. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 7, identity: 0.781
-cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttacgt-gcggcgattgcggccatcggcaccgc Protospacer
.***. **************** ** *** *
116. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 7, identity: 0.781
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
aaggcgctggtgccctcggccgcgatctcgct Protospacer
******************.* ***** *
117. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024424 (Paracoccus yeei strain TT13 plasmid pTT13-2, complete sequence) position: , mismatch: 7, identity: 0.781
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
caggcgctggtgccctcggccgcgatctcgct Protospacer
. ******************.* ***** *
118. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044082 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
caggcgctggtgccctcggccgcgatctcgct Protospacer
. ******************.* ***** *
119. spacer 3.19|2182731|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
--aagcagcagtccgatgcgctggccctgctgat CRISPR spacer
gtgagca--agtccgatgcgcgggcccggctgcc Protospacer
.**** ************ ***** **** .
120. spacer 3.19|2182731|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
aagcagcagtccgatgcgctggccctgctgat CRISPR spacer
aacgcgcagtccgatgcgctgtacctgcagct Protospacer
** **************** ***** * *
121. spacer 3.19|2182731|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 7, identity: 0.781
aagcagcagtccgatgcgctggccctgctgat CRISPR spacer
aacgcgcagtccgatgcgctgtacctgcagct Protospacer
** **************** ***** * *
122. spacer 3.19|2182731|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
aagcagcagtccgatgcgctggccctgctgat CRISPR spacer
aacgcgcagtccgatgcgctgtacctgcagct Protospacer
** **************** ***** * *
123. spacer 3.19|2182731|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
aagcagcagtccgatgcgctggccctgctgat CRISPR spacer
aacgcgcagtccgatgcgctgtacctgcagct Protospacer
** **************** ***** * *
124. spacer 3.24|2183036|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022849 (Bosea sp. ANAM02 plasmid pANAM02, complete sequence) position: , mismatch: 7, identity: 0.781
caaggcgcggccacggtcggcagcgcgaccgc- CRISPR spacer
ggctgcgcgaccacggtcggcagcgcg-ctgcg Protospacer
. *****.***************** *.**
125. spacer 3.24|2183036|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 7, identity: 0.781
caaggcg----cggccacggtcggcagcgcgaccgc CRISPR spacer
----gcgacgatggcgacggtcggcagcgcgcccgc Protospacer
*** .*** *************** ****
126. spacer 3.26|2183158|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035514 (Haematobacter massiliensis strain OT1 plasmid pOT1-4, complete sequence) position: , mismatch: 7, identity: 0.781
cgcagaggtgaagcgccagcgcg-aatggcgcg CRISPR spacer
cgcagaggagcagcgccagcgcgcggctgcgc- Protospacer
******** * ************ ... ****
127. spacer 3.32|2183524|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to MN694616 (Marine virus AFVG_250M59, complete genome) position: , mismatch: 7, identity: 0.781
gccctgcgcgccaaaatggacgagatggagca CRISPR spacer
gctcagaaagccaaaatggccgatatggagca Protospacer
**.* * . ********** *** ********
128. spacer 3.33|2183585|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040760 (Paracoccus sp. 2251 plasmid unnamed6, complete sequence) position: , mismatch: 7, identity: 0.781
gcccag--atcgacgcgcaagcggagcaggtcgg CRISPR spacer
--ccggttgtcgacgcgccagcagagcaggtcga Protospacer
**.* .********* ***.**********.
129. spacer 3.33|2183585|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
gcccagatcgacgcgcaagcggagcaggtcgg-- CRISPR spacer
gcgctgatcgacgcgcaagcgga--cggctggac Protospacer
** * ****************** **..**
130. spacer 3.33|2183585|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 7, identity: 0.781
gcccagatcgacgcgcaagcggagcaggtcgg-- CRISPR spacer
gcgctgatcgacgcgcaagcgga--cggctggac Protospacer
** * ****************** **..**
131. spacer 3.36|2183768|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
---atgcttggcaaggtgcttgaggatccgctggc CRISPR spacer
tagaagct---caaggtgcttgaccatccgctggg Protospacer
* *** ************ *********
132. spacer 3.37|2183829|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_009427 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence) position: , mismatch: 7, identity: 0.781
ctctgccggatgtagctgggcgagaactccat CRISPR spacer
gtctgccggatggagatgggcgaggccgccct Protospacer
*********** ** ********. * ** *
133. spacer 3.38|2183890|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_014258 (Pantoea vagans C9-1 plasmid pPag3, complete sequence) position: , mismatch: 7, identity: 0.781
cagccagctatcccgcctct----ctctcatgactc CRISPR spacer
cagccagctgtcccgcctctttcgctcttgtg---- Protospacer
*********.********** ****..**
134. spacer 2.1|1251883|32|CP031078|PILER-CR,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgggcggctctctgacgcagacgctgcaaca CRISPR spacer
ctgggcggctggctgacgcagacgctgtcatg Protospacer
..******** ***************. *..
135. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP040761 (Paracoccus sp. 2251 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ccgctcggcctcggcccgcaggtcggggatgc Protospacer
** ****.****************** .
136. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 8, identity: 0.75
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
gtcgccgagctcggcccgcaggtcggccaccg Protospacer
.. .*** ******************* *.*
137. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.75
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ctgcacgacctcggcccgcaggccggcccgac Protospacer
*. * *****************.*****.
138. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP025432 (Paracoccus zhejiangensis strain J6 plasmid pPZ02, complete sequence) position: , mismatch: 8, identity: 0.75
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ctgctcgacctcggtcagcaggtcggccatgc Protospacer
*. ***********.* *********** .
139. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.75
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ctgcacgacctcggcccgcaggccggcccgac Protospacer
*. * *****************.*****.
140. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ctgctcgacctcggtcagcaggtcggccatgc Protospacer
*. ***********.* *********** .
141. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 8, identity: 0.75
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ctgctcgacctcggtcagcaggtcggccatgc Protospacer
*. ***********.* *********** .
142. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
accgtcgaactcggcgcgcaggtcggcctgat Protospacer
*. **** ****** *************
143. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ctcgccgacctcggcaagcaggtcggcctgtc Protospacer
*.. .********** ************ *
144. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 8, identity: 0.75
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ctcgccgacctcggcaagcaggtcggcctgtc Protospacer
*.. .********** ************ *
145. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 8, identity: 0.75
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ctcgccgacctcggcaagcaggtcggcctgtc Protospacer
*.. .********** ************ *
146. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.75
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ctcgccgacctcggcaagcaggtcggcctgtc Protospacer
*.. .********** ************ *
147. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to KF493881 (Mycobacterium phage JAMaL, complete genome) position: , mismatch: 8, identity: 0.75
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
cgcgtcgacctcggccagcagctcggccacct Protospacer
* . ************ **** ****** *.
148. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 8, identity: 0.75
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ccgcgtcacctcggcccgcagttccgcctcaa Protospacer
** * . ************** ** ***** .
149. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP034813 (Paracoccus sp. Arc7-R13 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
cagcacgccctcgggccgcaggtcggccgcat Protospacer
* * ** ****** ************* *
150. spacer 2.3|1252005|31|CP031078|PILER-CR,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742
-----tgggtgccgcatgtggagcagcgcggtgaca CRISPR spacer
gaccacgg-----gcttgtggagcagcgcggtgcca Protospacer
.** ** ***************** **
151. spacer 2.3|1252005|31|CP031078|PILER-CR,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 8, identity: 0.742
-----tgggtgccgcatgtggagcagcgcggtgaca CRISPR spacer
gaccacgg-----gcttgtggagcagcgcggtgcca Protospacer
.** ** ***************** **
152. spacer 2.3|1252005|31|CP031078|PILER-CR,CRT matches to MK864266 (Gordonia phage Arri, complete genome) position: , mismatch: 8, identity: 0.742
tgggtgccgcatgtggagcagcgcggtgaca CRISPR spacer
gtcgggccgcatgtcgagcggcgcggtgtcg Protospacer
* ********* ****.******** *.
153. spacer 3.2|2181694|32|CP031078|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75
catgctgtcggcacggactgggtggcgcaatg CRISPR spacer
cgcggcgccggcccggacggggtggcgcaata Protospacer
*..* .*.**** ***** ************.
154. spacer 3.3|2181755|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP035513 (Haematobacter massiliensis strain OT1 plasmid pOT1-3, complete sequence) position: , mismatch: 8, identity: 0.75
gccgaccatgccggaaaccgccggcgccagga CRISPR spacer
ggggtccataccggaaaccgcccgcgccaccg Protospacer
* * ****.************ ****** .
155. spacer 3.3|2181755|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75
gccgaccatgccggaaaccgccggcgccagga CRISPR spacer
gctgaccatgccggaaaccaccgccatcctgc Protospacer
**.****************.*** *..* *
156. spacer 3.3|2181755|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 8, identity: 0.75
gccgaccatgccggaaaccgccggcgccagga CRISPR spacer
gctgaccatgccggaaaccaccgccatcctgc Protospacer
**.****************.*** *..* *
157. spacer 3.3|2181755|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.75
gccgaccatgccggaaaccgccggcgccagga CRISPR spacer
gctgaccatgccggaaaccaccgccatcctgc Protospacer
**.****************.*** *..* *
158. spacer 3.3|2181755|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 8, identity: 0.75
gccgaccatgccggaaaccgccggcgccagga CRISPR spacer
gctgaccatgccggaaaccaccgccatcctgc Protospacer
**.****************.*** *..* *
159. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NC_005793 (Achromobacter denitrificans plasmid pEST4011, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
accatcctcatcaactccaccggcctggtggt Protospacer
*. ************** **** ***** .
160. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NC_005793 (Achromobacter denitrificans plasmid pEST4011, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
accatcctcatcaactccaccggcctggtggt Protospacer
*. ************** **** ***** .
161. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to JN106170 (Uncultured bacterium plasmid pAKD25, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
accatcctcatcaactccaccggcctggtggt Protospacer
*. ************** **** ***** .
162. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NC_019378 (Burkholderia cepacia plasmid pIJB1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
accatcctcatcaactccaccggcctggtggt Protospacer
*. ************** **** ***** .
163. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
164. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
165. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
166. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
167. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
168. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
169. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
170. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
171. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
172. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
173. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
174. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
175. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
176. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
177. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
178. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
179. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
180. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
181. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
182. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
183. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
184. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
185. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
186. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
187. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
188. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
189. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
190. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
191. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
192. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
193. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
194. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
195. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
196. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
197. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
198. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
199. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
200. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
201. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
202. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
203. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
204. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
205. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
206. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
207. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
208. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
209. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
210. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
211. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
212. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
213. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
214. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
215. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
216. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
217. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
218. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
219. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
220. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
221. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
222. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
223. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
224. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
225. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
226. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
acggtcctcaacaactccggcggcgtggtcac Protospacer
* ***** *******.********** *
227. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
tcggacgtcatcaactccggcggcgtgatgat Protospacer
** .* ***********.********.** .
228. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
tgggccttcatcaaatccagcagcgtggtgcc Protospacer
* *.******* ******.********.*
229. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 8, identity: 0.75
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
gagcactttatcgattccagcggcgtggtgtc Protospacer
*.*.*.***.*.*****************
230. spacer 3.8|2182060|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP024924 (Sphingomonas sp. Cra20 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcggaactgctgggactgcccgcgtacttt CRISPR spacer
ccgcggctctgctgggactgcccgcactcggt Protospacer
.***** *****************.. * *
231. spacer 3.8|2182060|32|CP031078|CRISPRCasFinder,CRT matches to KU204984 (Pseudomonas phage AAT-1, complete genome) position: , mismatch: 8, identity: 0.75
tcgcggaactgctgggactgcccgcgtacttt CRISPR spacer
tcctggaactccttggactgcccgcgtagcca Protospacer
** .****** ** ************** ..
232. spacer 3.11|2182243|32|CP031078|CRISPRCasFinder,CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 8, identity: 0.75
tatttgc-gcgaaagccgcgagatggcgacggc CRISPR spacer
-atcaatggcgaatggcgcgagatggcgacggt Protospacer
**. .. ***** * ****************.
233. spacer 3.11|2182243|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP047174 (Rathayibacter sp. VKM Ac-2760 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tatttgcgc-----gaaagccgcgagatggcgacggc CRISPR spacer
-----acgccggaggaacgccgcgagctggcgacggc Protospacer
.*** *** ******** **********
234. spacer 3.15|2182487|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.75
gatgatcgggcgcgtcgtgcgggccgtgctgg CRISPR spacer
gccaaccgggcgggtcgtgcgggacgtgcccg Protospacer
* ..*.****** ********** *****. *
235. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021029 (Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence) position: , mismatch: 8, identity: 0.75
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
tccgcggcggcgattgcgaccagctcctttcg Protospacer
. ****************.***** ** . *
236. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 8, identity: 0.75
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
tccgcggcggcgattgcgaccagctcctttcg Protospacer
. ****************.***** ** . *
237. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN868946 (Salmonella enterica subsp. enterica serovar Senftenberg strain NCTC10384 plasmid 4, complete sequence) position: , mismatch: 8, identity: 0.75
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttcgcggcggcgatttccgccagcgcctggca Protospacer
. ************* * ********* .*
238. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 8, identity: 0.75
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
tccgcggcggcgattgcgaccagctcctttcg Protospacer
. ****************.***** ** . *
239. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 8, identity: 0.75
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
tccgcggcggcgattgcgaccagctcctttcg Protospacer
. ****************.***** ** . *
240. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 8, identity: 0.75
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
tccgcggcggcgattgcgaccagctcctttcg Protospacer
. ****************.***** ** . *
241. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 8, identity: 0.75
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
tccgcggcggcgattgcgaccagctcctttcg Protospacer
. ****************.***** ** . *
242. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013515 (Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence) position: , mismatch: 8, identity: 0.75
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
tccgcggcggcgattgcgaccagctcctttcg Protospacer
. ****************.***** ** . *
243. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 8, identity: 0.75
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
tccgcggcggcgattgcgaccagctcctttcg Protospacer
. ****************.***** ** . *
244. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013605 (Rhizobium sp. N731 plasmid pRspN731d, complete sequence) position: , mismatch: 8, identity: 0.75
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
tccgcggcggcgattgcgaccagctcctttcg Protospacer
. ****************.***** ** . *
245. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023738 (Methylosinus trichosporium OB3b plasmid pOB3b1, complete sequence) position: , mismatch: 8, identity: 0.75
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ccggcggcggcgattgcggcctccgccagcgt Protospacer
* ****************** ***** .
246. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
cggccggcggcgatggcgtccagcgccagggc Protospacer
*. ********** *** ********* . *
247. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN832560 (Paracoccus aminovorans isolate JCM7685 plasmid II, complete sequence) position: , mismatch: 8, identity: 0.75
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
cggccggcggcgatggcgtccagcgccaggtc Protospacer
*. ********** *** ********* ..*
248. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
agcgtggcggcgatggcggccagcgcgccaga Protospacer
.**.********* *********** **
249. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 8, identity: 0.75
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
agcgtggcggcgatggcggccagcgcgccaga Protospacer
.**.********* *********** **
250. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
tcggcggcggcggtcgcggccagcgcctcggc Protospacer
. *********.*.************ *. *
251. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044330 (Methylocystis rosea strain BRCS1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
gtcgcggcggcgatcgcggccagagcgccaaa Protospacer
************.******** ** **
252. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 8, identity: 0.75
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
gacgcggcagcgattgcggcgagcgaaaagcg Protospacer
*******.*********** **** * .*
253. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034087 (Methylocystis rosea strain GW6 plasmid pGW6_1, complete sequence) position: , mismatch: 8, identity: 0.75
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
gtcgcggcggcgatcgcggccagagcggcaag Protospacer
************.******** ** .**
254. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034088 (Methylocystis rosea strain GW6 plasmid pGW6_2, complete sequence) position: , mismatch: 8, identity: 0.75
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
gtcgcggcggcgatcgcggccagagcgccaaa Protospacer
************.******** ** **
255. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 8, identity: 0.75
-cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttgcgt-gcggcgattgccgccagcggcaccgc Protospacer
..**. *********** ******* *** *
256. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_007763 (Rhizobium etli CFN 42 plasmid p42b, complete sequence) position: , mismatch: 8, identity: 0.75
-cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttgcgt-gcggcgattgccgccagcggcaccgc Protospacer
..**. *********** ******* *** *
257. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 8, identity: 0.75
cacg-cggcggcgattgcggccagcgccacacc CRISPR spacer
-atgccggcggcgatggcggccaccgcctcctg Protospacer
*.* ********** ******* **** * .
258. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 8, identity: 0.75
-cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttgcgt-gcggcgattgccgccagcggcaccgc Protospacer
..**. *********** ******* *** *
259. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 8, identity: 0.75
-cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttgcgt-gcggcgattgccgccagcggcaccgc Protospacer
..**. *********** ******* *** *
260. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020907 (Rhizobium etli strain NXC12 plasmid pRetNXC12a, complete sequence) position: , mismatch: 8, identity: 0.75
-cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttgcgt-gcggcgattgccgccagcggcaccgc Protospacer
..**. *********** ******* *** *
261. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 8, identity: 0.75
-cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttgcgt-gcggcgattgccgccagcggcaccgc Protospacer
..**. *********** ******* *** *
262. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 8, identity: 0.75
-cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttgcgt-gcggcgattgccgccagcggcaccgc Protospacer
..**. *********** ******* *** *
263. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 8, identity: 0.75
-cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttgcgt-gcggcgattgccgccagcggcaccgc Protospacer
..**. *********** ******* *** *
264. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 8, identity: 0.75
-cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttgcgt-gcggcgattgccgccagcggcaccgc Protospacer
..**. *********** ******* *** *
265. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 8, identity: 0.75
-cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttgcgt-gcggcgattgccgccagcggcactgc Protospacer
..**. *********** ******* *** *
266. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 8, identity: 0.75
-cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttgcgt-gcggcgattgccgccagcggcaccgc Protospacer
..**. *********** ******* *** *
267. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 8, identity: 0.75
-cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttgcgt-gcggcgattgccgccagcggcaccgc Protospacer
..**. *********** ******* *** *
268. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 8, identity: 0.75
-cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttgcgt-gcggcgattgccgccagcggcaccgc Protospacer
..**. *********** ******* *** *
269. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_021906 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1a, complete sequence) position: , mismatch: 8, identity: 0.75
-cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttgcgt-gcggcgattgccgccagcggcaccgc Protospacer
..**. *********** ******* *** *
270. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015322 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123d, complete sequence) position: , mismatch: 8, identity: 0.75
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
cagccggcggcgaccgcggccagcgccgttcg Protospacer
** *********..************.. *
271. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 8, identity: 0.75
-cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttgcgt-gcggcgattgccgccagcggcaccgc Protospacer
..**. *********** ******* *** *
272. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 8, identity: 0.75
-cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttgcgt-gcggcgattgccgccagcggcaccgc Protospacer
..**. *********** ******* *** *
273. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 8, identity: 0.75
-cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttgcgt-gcggcgattgccgccagcggcaccgc Protospacer
..**. *********** ******* *** *
274. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ttcccgctggtgctctccgccgtgctgatcct Protospacer
*.***********.*** ******** . *
275. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ttcccgctggtgctctccgccgtgctgatcct Protospacer
*.***********.*** ******** . *
276. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ttcccgctggtgctctccgccgtgctgatcct Protospacer
*.***********.*** ******** . *
277. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ttcccgctggtgctctccgccgtgctgatcct Protospacer
*.***********.*** ******** . *
278. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ccggcgctggtgccctcggccgtccgcttcac Protospacer
.* ******************* * **. *.
279. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ttcccgctggtgctctccgccgtgctgatcct Protospacer
*.***********.*** ******** . *
280. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ttcccgctggtgctctccgccgtgctgatcct Protospacer
*.***********.*** ******** . *
281. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ttcccgctggtgctctccgccgtgctgatcct Protospacer
*.***********.*** ******** . *
282. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ttcccgctggtgctctccgccgtgctgatcct Protospacer
*.***********.*** ******** . *
283. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ccggcgctggtgccctcggccgtccgcttcac Protospacer
.* ******************* * **. *.
284. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ttcccgctggtgctctccgccgtgctgatcct Protospacer
*.***********.*** ******** . *
285. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ttcccgctggtgctctccgccgtgctgatcct Protospacer
*.***********.*** ******** . *
286. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ttcccgctggtgctctccgccgtgctgatcct Protospacer
*.***********.*** ******** . *
287. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ttcccgctggtgctctccgccgtgctgatcct Protospacer
*.***********.*** ******** . *
288. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ttcccgctggtgctctccgccgtgctgatcct Protospacer
*.***********.*** ******** . *
289. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ttcccgctggtgctctccgccgtgctgatcct Protospacer
*.***********.*** ******** . *
290. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ttcccgctggtgctctccgccgtgctgatcct Protospacer
*.***********.*** ******** . *
291. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ttcccgctggtgctctccgccgtgctgatcct Protospacer
*.***********.*** ******** . *
292. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ttcccgctggtgctctccgccgtgctgatcct Protospacer
*.***********.*** ******** . *
293. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ttcccgctggtgctctccgccgtgctgatcct Protospacer
*.***********.*** ******** . *
294. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ttcccgctggtgctctccgccgtgctgatcct Protospacer
*.***********.*** ******** . *
295. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ttcccgctggtgctctccgccgtgctgatcct Protospacer
*.***********.*** ******** . *
296. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 8, identity: 0.75
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ttcccgctggtgctctccgccgtgctgatcct Protospacer
*.***********.*** ******** . *
297. spacer 3.19|2182731|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
aagcagcagtccgatgcgctggccctgctgat CRISPR spacer
caggcgcagcccgatgcgcaggccctgccggc Protospacer
** ****.********* ********.*..
298. spacer 3.19|2182731|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 8, identity: 0.75
aagcagcagtccgatgcgctggccctgctgat CRISPR spacer
atcctgcagtccgtggcgctggccctgctctc Protospacer
* * ******** ************** .
299. spacer 3.19|2182731|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.75
aagcagcagtccgatgcgctggccctgctgat----- CRISPR spacer
aagcggctgtccgatgcgctggcc-----gacggcga Protospacer
****.** **************** **.
300. spacer 3.19|2182731|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
aagcagcagtccgatgcgctggccctgctgat----- CRISPR spacer
aagcggctgtccgatgcgctggcc-----gacggcga Protospacer
****.** **************** **.
301. spacer 3.22|2182914|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to MH910036 (Arthrobacter phage Hestia, complete genome) position: , mismatch: 8, identity: 0.75
caccgggtggccggatcaccactgaaaagact CRISPR spacer
agccgggcggcctgatcaccactgaaggcacc Protospacer
.*****.**** *************.. **.
302. spacer 3.24|2183036|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
caaggcgcggccacggtcggcagcgcgaccgc CRISPR spacer
acgcccgcggccacggccggcagcgcgccctc Protospacer
. ***********.********** ** *
303. spacer 3.24|2183036|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_012725 (Burkholderia glumae BGR1 plasmid bglu_4p, complete sequence) position: , mismatch: 8, identity: 0.75
caaggcgcggccacggtcggcagcgcgaccgc CRISPR spacer
gtgggcgcggccacgggcggcaccgcggtcga Protospacer
.************* ***** ****..**
304. spacer 3.24|2183036|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 8, identity: 0.75
caaggcgcggccacggtcggcagcgcgaccgc CRISPR spacer
gtaggcgcggccacgctcggcatcgtgccttc Protospacer
************* ****** **.* *. *
305. spacer 3.24|2183036|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_014819 (Asticcacaulis excentricus CB 48 plasmid pASTEX02, complete sequence) position: , mismatch: 8, identity: 0.75
caaggcgcggccacggtcggcagcgcgaccgc CRISPR spacer
ctcgccgcggccacggttggcatcgcgatggg Protospacer
* * ************.**** *****. *
306. spacer 3.24|2183036|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 8, identity: 0.75
caaggcgcggccacggtcggcagcgcgaccgc CRISPR spacer
ctgaccgcggccacggtgggcagcgggagggc Protospacer
* .. ************ ******* ** **
307. spacer 3.24|2183036|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.75
caaggcgcggccacggtcggcagcgcgaccgc CRISPR spacer
ggcggcgcgacgacggtcggcagcgccgtcgc Protospacer
. ******.* ************** ..***
308. spacer 3.24|2183036|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.75
caaggcgcggccacggtcggcagcgcgaccgc CRISPR spacer
gccggtccggccacggtcggcatcccgacctc Protospacer
**. *************** * ***** *
309. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_019959 (Mycobacterium sp. JS623 plasmid pMYCSM03, complete sequence) position: , mismatch: 8, identity: 0.75
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
actcgacccgccgcggtgggcgatgccacggc Protospacer
* .*****.**** **************
310. spacer 3.26|2183158|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cgcagaggtgaagcgccagcgcgaatggcgcg CRISPR spacer
cgatgccctgaagcggcagcgggaatggcgcc Protospacer
** * ******* ***** *********
311. spacer 3.27|2183219|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134454 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence) position: , mismatch: 8, identity: 0.75
gggcggtggtgccgggccgacgatggctggca CRISPR spacer
cggcggtggtgccggggcgacggtgctcgtcg Protospacer
*************** *****.** ..* *.
312. spacer 3.33|2183585|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 8, identity: 0.75
--gcccagatcgacgcgcaagcggagcaggtcgg CRISPR spacer
ttgttcaa--cgacgcgcagccggagcaggtcgc Protospacer
*..**. *********. ************
313. spacer 3.37|2183829|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015419 (Rhodovulum sulfidophilum DSM 1374 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ctctgccggatgtagctgggcgagaactccat CRISPR spacer
atcagggtgatgtagctgggcgagatccccag Protospacer
** * ***************** *.***
314. spacer 3.37|2183829|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015422 (Rhodovulum sulfidophilum strain SNK001 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
ctctgccggatgtagctgggcgagaactccat CRISPR spacer
atcagggtgatgtagctgggcgagatccccag Protospacer
** * ***************** *.***
315. spacer 3.37|2183829|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014802 (Rhodovulum sulfidophilum plasmid Plasmid2 DNA, complete genome, strain: DSM 2351) position: , mismatch: 8, identity: 0.75
ctctgccggatgtagctgggcgagaactccat CRISPR spacer
atcagggtgatgtagctgggcgagatccccag Protospacer
** * ***************** *.***
316. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.75
cgcccagcgcctgcgacagcgtcttggcccga CRISPR spacer
agaccatcgcctgcgacagcgtcttgttcatc Protospacer
* *** ******************* .*
317. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcccagcgcctgcgacagcgtcttggcccga CRISPR spacer
ccgccagcgccttcgacagcggcttgagcagc Protospacer
* ********* ******** ****. * *
318. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 8, identity: 0.75
cgcccagcgcctgcgacagcgtcttggcccga CRISPR spacer
ccgccagcgcctgctccagcgtcttgcggcgc Protospacer
* *********** ********** **
319. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcccagcgcctgcgacagcgtcttggcccga CRISPR spacer
ccgccagcgcctgctccagcgtcttgcggcgc Protospacer
* *********** ********** **
320. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcccagcgcctgcgacagcgtcttggcccga CRISPR spacer
ccgccagcgcctgctccagcgtcttgcggcgc Protospacer
* *********** ********** **
321. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcccagcgcctgcgacagcgtcttggcccga CRISPR spacer
ccgccagcgccttcgacagcggcttgagcagc Protospacer
* ********* ******** ****. * *
322. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
cgcccagcgcctgcgacagcgtcttggcccga CRISPR spacer
ccgccagcgcctgctccagcgtcttgcggcgc Protospacer
* *********** ********** **
323. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcccagcgcctgcgacagcgtcttggcccga CRISPR spacer
ccgccagcgcctgctccagcgtcttgcggcgc Protospacer
* *********** ********** **
324. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcccagcgcctgcgacagcgtcttggcccga CRISPR spacer
ccgccagcgcctgctccagcgtcttgcggcgc Protospacer
* *********** ********** **
325. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
cgcccagcgcctgcgacagcgtcttggcccga CRISPR spacer
ccgccagcgcctgctccagcgtcttgcggcgc Protospacer
* *********** ********** **
326. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcccagcgcctgcgacagcgtcttggcccga CRISPR spacer
ccgccagcgccttcgacagcggcttgagcagc Protospacer
* ********* ******** ****. * *
327. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP029211 (Aquabacterium olei strain NBRC 110486 plasmid pTB101, complete sequence) position: , mismatch: 8, identity: 0.75
cgcccagcgcctgcgacagcgtcttggcccga CRISPR spacer
cgcgcatcgcctgcgacagcgtctgcccttgc Protospacer
*** ** ***************** *..*
328. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcccagcgcctgcgacagcgtcttggcccga CRISPR spacer
ccgccagcgccttcgacagcggcttgagcagc Protospacer
* ********* ******** ****. * *
329. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgcccagcgcctgcgacagcgtcttggcccga CRISPR spacer
ccgccagcgccttcgacagcggcttgagcagc Protospacer
* ********* ******** ****. * *
330. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 8, identity: 0.75
cgcccagcgcctgcgacagcgtcttggcccga CRISPR spacer
ccgccagcgcctgctccagcgtcttgcggcgc Protospacer
* *********** ********** **
331. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 8, identity: 0.75
cgcccagcgcctgcgacagcgtcttggcccga CRISPR spacer
cggccagcgcctgcggcagcgtcgtcaaacgg Protospacer
** ************.******* * . **.
332. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP022368 (Azospirillum sp. TSH58 plasmid TSH58_p07, complete sequence) position: , mismatch: 9, identity: 0.719
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
gtgagcgatctcggcccgccggtcggcctcct Protospacer
. ***.********** **********.
333. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to KR072689 (Paracoccus phage Shpa, complete genome) position: , mismatch: 9, identity: 0.719
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
gtcctcgaactcggcgcgcaggtcggcccagc Protospacer
..***** ****** ************.
334. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to KT221034 (Streptomyces phage SF3, complete genome) position: , mismatch: 9, identity: 0.719
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ggtgtcgaccagggcccgcaggtcggcccagt Protospacer
* ****** ****************.
335. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NC_011044 (Mycobacterium phage Nigel, complete genome) position: , mismatch: 9, identity: 0.719
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
tgcgtcgacctcggccagcagctcggccacct Protospacer
. . ************ **** ****** *.
336. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_LR134444 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
cttctcgaactcggccagcaggtcgtcgaact Protospacer
*.****** ******* ******** * .
337. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to CP000663 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence) position: , mismatch: 9, identity: 0.719
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
gcgcgcgatctcggcccgccggtcggccagca Protospacer
* * ***.********** ******** ..
338. spacer 2.4|1252065|32|CP031078|PILER-CR,CRT matches to NZ_LR134403 (Listeria monocytogenes strain NCTC7974 plasmid 6, complete sequence) position: , mismatch: 9, identity: 0.719
gtatgggatggagcaaactgggtgacagcgga- CRISPR spacer
agatgggatggagaaaaatgggtga-gtcaaac Protospacer
. *********** *** ******* . *..*
339. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to MK388689 (Pantoea phage vB_PagM_LIET2, complete genome) position: , mismatch: 9, identity: 0.719
gcagaaaccgccgtcgccctgcgggagcccac CRISPR spacer
gcaggaaccgccgtcaccctgcggccagtgaa Protospacer
****.**********.******** . . *
340. spacer 2.5|1252126|32|CP031078|PILER-CR,CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 9, identity: 0.719
gcagaaaccgccgtcgccctgcgggagcccac CRISPR spacer
ggcgcgcccgccgtggccctgccggagccccg Protospacer
* * . ******* ******* *******
341. spacer 3.2|2181694|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP049142 (Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence) position: , mismatch: 9, identity: 0.719
catgctgtcggcacggactgggtggcgcaatg CRISPR spacer
cagcacgtccgcacggactggctggcgcagga Protospacer
** .*** *********** *******. .
342. spacer 3.3|2181755|32|CP031078|CRISPRCasFinder,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 9, identity: 0.719
gccgaccatgccggaaaccgccggcgccagga CRISPR spacer
cgggaccaagccggaaaccgcgggcgacgaca Protospacer
***** ************ **** *.. *
343. spacer 3.3|2181755|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
gccgaccatgccggaaaccgccggcgccagga CRISPR spacer
cgggaccaagccggaaaccgcgggcgacgaca Protospacer
***** ************ **** *.. *
344. spacer 3.3|2181755|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
gccgaccatgccggaaaccgccggcgccagga CRISPR spacer
cgggaccaagccggaaaccgcgggcgacgaca Protospacer
***** ************ **** *.. *
345. spacer 3.3|2181755|32|CP031078|CRISPRCasFinder,CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 9, identity: 0.719
gccgaccatgccggaaaccgccggcgccagga CRISPR spacer
gccggccatgccggagaccgccgtgttcgtca Protospacer
****.**********.******* .*. *
346. spacer 3.3|2181755|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.719
gccgaccatgccggaaaccgccggcgccagga CRISPR spacer
cgggaccaagccggaaaccgcgggcgacgaca Protospacer
***** ************ **** *.. *
347. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to KU682439 (Stenotrophomonas phage vB_SmaS-DLP_6, complete genome) position: , mismatch: 9, identity: 0.719
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
aaggtcgtcatcatctccatcggcgtggtgtt Protospacer
* ****** ***** ***********.
348. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to CP054928 (Streptomyces fulvissimus strain NA06532 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
gactgcagcatgaacttcagcggcgtggtgtt Protospacer
..** *** ****.**************.
349. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP018784 (Curtobacterium pusillum strain AA3 plasmid pCPAA3, complete sequence) position: , mismatch: 9, identity: 0.719
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
ttccgcctcatcaacgccggcggcgtcgaaca Protospacer
*..************ **.******* * ..
350. spacer 3.8|2182060|32|CP031078|CRISPRCasFinder,CRT matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcggaactgctgggactgcccgcgtacttt CRISPR spacer
aggcggaactgctggggttgcccgcggatgcg Protospacer
**************..******** *. .
351. spacer 3.11|2182243|32|CP031078|CRISPRCasFinder,CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 9, identity: 0.719
tatttgcgcgaaagccgcgagatggcgacggc CRISPR spacer
gcattgcgcgaaagccgggcgatggcggtgtg Protospacer
************** * *******..*
352. spacer 3.11|2182243|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 9, identity: 0.719
tatttgcgcgaaagccgcgagatggcgacggc CRISPR spacer
gtcgtggccgaaagccgcgagcaggcgacgga Protospacer
. ** ************* ********
353. spacer 3.11|2182243|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 9, identity: 0.719
tatttgcgcgaaagccgcgagatggcgacggc CRISPR spacer
gtcgtggccgaaagccgcgagcaggcgacgga Protospacer
. ** ************* ********
354. spacer 3.13|2182365|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to MK510999 (Pseudomonas phage BR58, partial genome) position: , mismatch: 9, identity: 0.719
acaggttccggcttgtccatttgttcgcacat CRISPR spacer
tcagggtccggcttgtccagttgtgggtctag Protospacer
**** ************* **** *. .*
355. spacer 3.15|2182487|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013105 (Paraburkholderia caribensis strain MWAP64 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
gatgatcgggcgcgtcgtgcgggccgtgctgg CRISPR spacer
catgctctggcgcgtcgtgcgggcttgtatgt Protospacer
*** ** ****************. **
356. spacer 3.15|2182487|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028920 (Gemmobacter sp. HYN0069 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gatgatcgggcgcgtcgtgcgggccgtgctgg CRISPR spacer
tctgatcgggcgcggcgtgcggcccacggacg Protospacer
************ ******* **..* *
357. spacer 3.15|2182487|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028920 (Gemmobacter sp. HYN0069 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gatgatcgggcgcgtcgtgcgggccgtgctgg CRISPR spacer
tctgatcgggcgcggcgtgcggcccacggacg Protospacer
************ ******* **..* *
358. spacer 3.15|2182487|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027930 (Microbacterium sp. SGAir0570 plasmid pSGAir0570_2, complete sequence) position: , mismatch: 9, identity: 0.719
gatgatcgggcgcgtcgtgcgggccgtgctgg CRISPR spacer
cgcgatcgggcgcgtcgtgcgtgtcggagtcg Protospacer
..****************** *.** . * *
359. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134449 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 7, complete sequence) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ttgtcggcggcgatcgcggccagcgccatctg Protospacer
. **********.*************. .
360. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
gctgcggcggcgattgcggcccgcgccttctt Protospacer
.****************** ***** . ..
361. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035421 (Leisingera sp. NJS204 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
gccgcggcgccgatcgcggccagcgaccaggc Protospacer
******* ****.********** * . *
362. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ggacccttggcgatggcggccagcggcacacc Protospacer
. * .****** ********** ******
363. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038238 (Leisingera sp. NJS201 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
gccgcggcgccgatcgcggccagcgaccaggc Protospacer
******* ****.********** * . *
364. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
gggcccttggcgatggcggccagcggcacacc Protospacer
. * .****** ********** ******
365. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049813 (Monaibacterium sp. ALG8 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
gccacggcggcgatttcggccagcaccagcgg Protospacer
*.*********** ********.***
366. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
agggcggcggctattgcgtccagcgcccggtc Protospacer
. ******** ****** ******** ..*
367. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032688 (Rhizobium sp. CCGE531 plasmid pRCCGE531a, complete sequence) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
gttccagcggcgattactgccagcgccacctc Protospacer
. *.*********.* *********** .*
368. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025885 (Escherichia coli strain 503440 plasmid p503440_68, complete sequence) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ccggcggctgcgactgcggccagcgcagagac Protospacer
* ***** ****.************ . . *
369. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041158 (Leisingera aquaemixtae strain R2C4 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
aacgcggcggcggttgcgggcagccaggcgcg Protospacer
***********.****** **** .*.*
370. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009975 (Pseudomonas putida S12 plasmid pTTS12, complete sequence) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
tgaccaggcgcgattgccgcgagcgccacacc Protospacer
.. *.* ******** ** ***********
371. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032693 (Rhizobium sp. CCGE532 plasmid pRCCGE532a, complete sequence) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
gttccagcggcgattactgccagcgccacctc Protospacer
. *.*********.* *********** .*
372. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_012521 (Rhodococcus opacus B4 plasmid pROB02, complete sequence) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
gcccccagagcgattgcggccagcccctcacc Protospacer
* * . .*************** ** ****
373. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041420 (Escherichia coli strain STEC711 plasmid pSTEC711_4, complete sequence) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ccggcggctgcgactgcggccagcgcagagac Protospacer
* ***** ****.************ . . *
374. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024977 (Escherichia coli strain CV839-15 plasmid pCV839-15-p3, complete sequence) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ccggcggctgcgactgcggccagcgcagagac Protospacer
* ***** ****.************ . . *
375. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
gaggacgcggcgagagcggccagcgccaccgg Protospacer
* * ******* **************
376. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
atcccggcggcgatggcggccaccgcctcctg Protospacer
* ********** ******* **** * .
377. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
cgggcggcgtcgatggcggccagcgcggtttc Protospacer
*. ****** **** *********** .. .*
378. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022035 (Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ccggcggctgcgactgcggccagcgcagagac Protospacer
* ***** ****.************ . . *
379. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
cgggcggcggcgagttcggccagcgcgaactg Protospacer
*. ********** * ********** * .
380. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to CP049614 (Escherichia coli O157:H7 strain K1516 plasmid pK1516-2) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ccggcggctgcgactgcggccagcgcagagac Protospacer
* ***** ****.************ . . *
381. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_019342 (Salmonella sp. 14 plasmid p14-120, complete sequence) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ccggcggctgcgactgcggccagcgcagagac Protospacer
* ***** ****.************ . . *
382. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to MH638294 (Ralstonia phage GP4, complete genome) position: , mismatch: 9, identity: 0.719
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
cgggcggcggcgatggcggccagggcggcgaa Protospacer
*. *********** ******** ** .*.
383. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 9, identity: 0.719
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
attgcgctggtgcagtcggccgtgctcgaaat Protospacer
.. ********* ************ .**
384. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 9, identity: 0.719
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
gtggcgctggtgcaatcggccgtgctcgaaat Protospacer
. ********* ************ .**
385. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 9, identity: 0.719
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
gtggcgctggtgcaatcggccgtgctcgaaat Protospacer
. ********* ************ .**
386. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 9, identity: 0.719
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
gtggcgctggtgcagtcggccgtgctcgaaat Protospacer
. ********* ************ .**
387. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 9, identity: 0.719
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
attgcgctggtgcagtcggccgtgctcgaaat Protospacer
.. ********* ************ .**
388. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 9, identity: 0.719
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
gtggcgctggtgcaatcggccgtgctcgaaat Protospacer
. ********* ************ .**
389. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 9, identity: 0.719
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
agggcgctggtgcaatcggccgtgctcgaaat Protospacer
********* ************ .**
390. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
gtggcgctggtgcagtcggccgtgctcgaaat Protospacer
. ********* ************ .**
391. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 9, identity: 0.719
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
gtggcgctggtgcaatcggccgtgctcgaaat Protospacer
. ********* ************ .**
392. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
gtggcgctggtgcaatcggccgtgctcgaaat Protospacer
. ********* ************ .**
393. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 9, identity: 0.719
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
gtggcgctggtgcagtcggccgtgctcgaaat Protospacer
. ********* ************ .**
394. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 9, identity: 0.719
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
gtggcgctggtgcaatcggccgtgctcgaaat Protospacer
. ********* ************ .**
395. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 9, identity: 0.719
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
gtggcgctggtgcagtcggccgtgctcgaaat Protospacer
. ********* ************ .**
396. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
gtggcgctggtgcagtcggccgtgctcgaaat Protospacer
. ********* ************ .**
397. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 9, identity: 0.719
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
gtggcgctggtgcaatcggccgtgctcgaaat Protospacer
. ********* ************ .**
398. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 9, identity: 0.719
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
gtggcgctggtgcaatcggccgtgctcgaaat Protospacer
. ********* ************ .**
399. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 9, identity: 0.719
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
gtggcgctggtgcagtcggccgtgctcgaaat Protospacer
. ********* ************ .**
400. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 9, identity: 0.719
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
gtggcgctggtgcagtcggccgtgctcgaaat Protospacer
. ********* ************ .**
401. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 9, identity: 0.719
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
gtggcgctggtgcaatcggccgtgctcgaaat Protospacer
. ********* ************ .**
402. spacer 3.19|2182731|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054620 (Azospirillum oryzae strain KACC 14407 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719
aagcagcagtccgatgcgctggccctgctgat CRISPR spacer
ccctggctgcccgatgcgctggccctgcggct Protospacer
..** *.****************** * *
403. spacer 3.22|2182914|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_020910 (Octadecabacter arcticus 238 plasmid pOA238_160, complete sequence) position: , mismatch: 9, identity: 0.719
caccgggtggccggatcaccactgaaaagact CRISPR spacer
gtacgggtggccggatcaccccggaatacgca Protospacer
***************** * *** * .*
404. spacer 3.22|2182914|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to MH834598 (Arthrobacter phage Auxilium, complete genome) position: , mismatch: 9, identity: 0.719
caccgggtggccggatcaccactgaaaagact CRISPR spacer
agccgggcggcctgatcaccactgagggcacc Protospacer
.*****.**** ************... **.
405. spacer 3.22|2182914|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to MH834625 (Arthrobacter phage Richie, complete genome) position: , mismatch: 9, identity: 0.719
caccgggtggccggatcaccactgaaaagact CRISPR spacer
agccgggcggcctgatcaccactgagggcacc Protospacer
.*****.**** ************... **.
406. spacer 3.24|2183036|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 9, identity: 0.719
caaggcgcggccacggtcggcagcgcgaccgc CRISPR spacer
gtgtgcgcggccagggtcagcagcgcgacgag Protospacer
. ********* ****.********** .
407. spacer 3.24|2183036|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP036456 (Streptomonospora sp. M2 plasmid phiM2, complete sequence) position: , mismatch: 9, identity: 0.719
caaggcgcggccacggtcggcagcgcgaccgc CRISPR spacer
gccaccgcggccacggtcgacagggcgatctc Protospacer
. **************.*** ****.* *
408. spacer 3.24|2183036|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033894 (Serratia liquefaciens strain FG3 plasmid p1-159, complete sequence) position: , mismatch: 9, identity: 0.719
caaggcgcggccacggtcggcagcgcgaccgc CRISPR spacer
tgccgcgtggccacggtcgccagcgcggcgtc Protospacer
.. ***.*********** *******.* *
409. spacer 3.24|2183036|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 9, identity: 0.719
caaggcgcggccacggtcggcagcgcgaccgc CRISPR spacer
gccagtcctgccacggccggaagcgcgaccgc Protospacer
.*. * *******.*** ***********
410. spacer 3.24|2183036|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 9, identity: 0.719
caaggcgcggccacggtcggcagcgcgaccgc CRISPR spacer
gccagtcctgccacggccggaagcgcgaccgc Protospacer
.*. * *******.*** ***********
411. spacer 3.24|2183036|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
caaggcgcggccacggtcggcagcgcgaccgc CRISPR spacer
agcggcgcgacgacggtcggcagcgccgttgc Protospacer
. ******.* ************** ...**
412. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
cgctcctccgccaaggtcggagatgccaggtg Protospacer
*. ******** ****** ******* *
413. spacer 3.26|2183158|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to MK448234 (Klebsiella phage ST11-VIM1phi8.2, complete genome) position: , mismatch: 9, identity: 0.719
cgcagaggtgaagcgccagcgcgaatggcgcg CRISPR spacer
cagagcggtgaagcgccagcgcgaattcgaga Protospacer
*. ** ******************** . .
414. spacer 3.26|2183158|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029174 (Methylobacterium sp. DM1 plasmid pLVM1, complete sequence) position: , mismatch: 9, identity: 0.719
cgcagaggtgaagcgccagcgcgaatggcgcg CRISPR spacer
gtcgtcggtgaagcgccagccggaatggcagg Protospacer
*. ************** *******. *
415. spacer 3.28|2183280|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to MN694104 (Marine virus AFVG_250M598, complete genome) position: , mismatch: 9, identity: 0.719
gtggggtcatcacagtccactacctcggcgat CRISPR spacer
ggttactcatcaccctccactacctcggcggc Protospacer
* . ******* ***************..
416. spacer 3.28|2183280|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016179 (Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gtggggtcatcacagtccactacctcggcgat CRISPR spacer
catgcgcaatcactgtcgactacctcggcgac Protospacer
* *. ***** *** *************.
417. spacer 3.30|2183402|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022418 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-3, complete sequence) position: , mismatch: 9, identity: 0.719
aaagcctgcaatcgcggcttggttcggctgaa CRISPR spacer
aaagcctgcaagcgcggcgtggtcaccatcat Protospacer
*********** ****** ****. * *
418. spacer 3.32|2183524|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024583 (Roseomonas sp. FDAARGOS_362 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gccctgcgcgccaaaatggacgagatggagca CRISPR spacer
gaaatgcgcgccaaaatcgccgagatgacccg Protospacer
* ************* * *******. *.
419. spacer 3.35|2183707|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031957 (Phaeobacter sp. LSS9 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcattgcaggggtgccatccggggcgggaa CRISPR spacer
atcgtttgcaggggtcccgtccggggcggtcc Protospacer
* ********** **.**********
420. spacer 3.35|2183707|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010682 (Phaeobacter piscinae strain P14 plasmid pP14_a, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcattgcaggggtgccatccggggcgggaa CRISPR spacer
atcgtttgcaggggtcccgtccggggcggtcc Protospacer
* ********** **.**********
421. spacer 3.35|2183707|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010717 (Phaeobacter piscinae strain P18 plasmid pP18_b, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcattgcaggggtgccatccggggcgggaa CRISPR spacer
atcgtttgcaggggtcccgtccggggcggtcc Protospacer
* ********** **.**********
422. spacer 3.35|2183707|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010657 (Phaeobacter piscinae strain P71 plasmid pP71_a, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcattgcaggggtgccatccggggcgggaa CRISPR spacer
atcgtttgcaggggtcccgtccggggcggtcc Protospacer
* ********** **.**********
423. spacer 3.35|2183707|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010768 (Phaeobacter piscinae strain P13 plasmid pP13_a, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcattgcaggggtgccatccggggcgggaa CRISPR spacer
atcgtttgcaggggtcccgtccggggcggtcc Protospacer
* ********** **.**********
424. spacer 3.36|2183768|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014277 (Martelella sp. AD-3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atgcttggcaaggtgcttgaggatccgctggc CRISPR spacer
atgcttcgcaaggtgcttgatgagaatccaga Protospacer
****** ************* ** *..*
425. spacer 3.37|2183829|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 9, identity: 0.719
ctctgccggatgtagctgggcgagaactccat CRISPR spacer
agctgccagacgtagctgggcgagatcgcgta Protospacer
*****.**.************** * *
426. spacer 3.40|2184012|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015032 (Burkholderia cenocepacia strain 842 plasmid pBcn842-1, complete sequence) position: , mismatch: 9, identity: 0.719
gggctcacgcctgtggcctcgaccggcggtga CRISPR spacer
gccatcacgcctgcggcctcgaccagcgacag Protospacer
* *********.**********.***....
427. spacer 3.40|2184012|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 9, identity: 0.719
gggctcacgcctgtggcctcgaccggcggtga CRISPR spacer
gtgatcacgcgtgcggcctcgaccggcctgtc Protospacer
* * ****** **.*************
428. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cgcccagcgcctgcgacagcgtcttggcccga CRISPR spacer
tgcccagcgcctgcgccagcggctgcaccacc Protospacer
.************** ***** ** .**
429. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP009294 (Novosphingobium pentaromativorans US6-1 plasmid pLA1, complete sequence) position: , mismatch: 9, identity: 0.719
cgcccagcgcctgcgacagcgtcttggcccga CRISPR spacer
ggctgcccgcgtgcgagagcgtcttggcccat Protospacer
**. *** ***** *************.
430. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.719
cgcccagcgcctgcgacagcgtcttggcccga CRISPR spacer
aggccatcgcctgcgacaacgtcttgttcatc Protospacer
* *** ***********.******* .*
431. spacer 3.41|2184073|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP011771 (Croceicoccus naphthovorans strain PQ-2 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
cgcccagcgcctgcgacagcgtcttggcccga CRISPR spacer
ggctgcccgcgtgcgagagcgtcttggcccat Protospacer
**. *** ***** *************.
432. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to MH020248 (Mycobacterium phage Panamaxus, complete genome) position: , mismatch: 10, identity: 0.688
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ggaatcgacctcggcacgccggtcggccggct Protospacer
*********** *** ******** .
433. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to MN062712 (Mycobacterium phage Pocahontas, complete genome) position: , mismatch: 10, identity: 0.688
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ggaatcgacctcggcacgccggtcggccggct Protospacer
*********** *** ******** .
434. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to KX640831 (Mycobacterium phage Margo, complete genome) position: , mismatch: 10, identity: 0.688
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ggaatcgacctcggcacgccggtcggccggct Protospacer
*********** *** ******** .
435. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to MG812492 (Mycobacterium phage Lambert1, complete genome) position: , mismatch: 10, identity: 0.688
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ggaatcgacctcggcacgccggtcggccggct Protospacer
*********** *** ******** .
436. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to MK284519 (Mycobacterium phage Norbert, complete genome) position: , mismatch: 10, identity: 0.688
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ggaatcgacctcggcacgccggtcggccggct Protospacer
*********** *** ******** .
437. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to MK524496 (Mycobacterium phage Veracruz, complete genome) position: , mismatch: 10, identity: 0.688
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ggaatcgacctcggcacgccggtcggccggct Protospacer
*********** *** ******** .
438. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to MH976517 (Mycobacterium phage Popcicle, complete genome) position: , mismatch: 10, identity: 0.688
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ggaatcgacctcggcacgccggtcggccggct Protospacer
*********** *** ******** .
439. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to KT326767 (Mycobacterium phage Texage, complete genome) position: , mismatch: 10, identity: 0.688
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ggaatcgacctcggcacgccggtcggccggct Protospacer
*********** *** ******** .
440. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to KM592966 (Mycobacterium phage QuinnKiro, complete genome) position: , mismatch: 10, identity: 0.688
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ggaatcgacctcggcacgccggtcggccggct Protospacer
*********** *** ******** .
441. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to MH316563 (Mycobacterium phage Hookmount, complete genome) position: , mismatch: 10, identity: 0.688
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ggaatcgacctcggcacgccggtcggccggct Protospacer
*********** *** ******** .
442. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to KX670828 (Mycobacterium phage Todacoro, complete genome) position: , mismatch: 10, identity: 0.688
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ggaatcgacctcggcacgccggtcggccggct Protospacer
*********** *** ******** .
443. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to MK494127 (Mycobacterium phage Noella, complete genome) position: , mismatch: 10, identity: 0.688
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ggaatcgacctcggcacgccggtcggccggct Protospacer
*********** *** ******** .
444. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NC_014159 (Tsukamurella paurometabola DSM 20162 plasmid pTpau01, complete sequence) position: , mismatch: 10, identity: 0.688
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
ggcgagtacctcggcgcgccggtcggcctcgg Protospacer
. ******** *** ********** *
445. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 10, identity: 0.688
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
tgcctcggcctcggcccgctggtcggggctgg Protospacer
. .****.*********** ****** .. *
446. spacer 3.3|2181755|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 10, identity: 0.688
gccgaccatgccggaaaccgccggcgccagga CRISPR spacer
gccgaccaagccggaagccgccgatccggctg Protospacer
******** *******.******.. * . .
447. spacer 3.3|2181755|32|CP031078|CRISPRCasFinder,CRT matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 10, identity: 0.688
gccgaccatgccggaaaccgccggcgccagga CRISPR spacer
gccgaccaagccggaagccgccgatccggctg Protospacer
******** *******.******.. * . .
448. spacer 3.3|2181755|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
gccgaccatgccggaaaccgccggcgccagga CRISPR spacer
gccgaccaagccggaagccgccgatccggctg Protospacer
******** *******.******.. * . .
449. spacer 3.3|2181755|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
gccgaccatgccggaaaccgccggcgccagga CRISPR spacer
gccgaccaagccggaagccgccgatccggctg Protospacer
******** *******.******.. * . .
450. spacer 3.3|2181755|32|CP031078|CRISPRCasFinder,CRT matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 10, identity: 0.688
gccgaccatgccggaaaccgccggcgccagga CRISPR spacer
gccgaccaagccggaagccgccgatccggctg Protospacer
******** *******.******.. * . .
451. spacer 3.3|2181755|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 10, identity: 0.688
gccgaccatgccggaaaccgccggcgccagga CRISPR spacer
gccgaccaagccggaagccgccgatccggctg Protospacer
******** *******.******.. * . .
452. spacer 3.3|2181755|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 10, identity: 0.688
gccgaccatgccggaaaccgccggcgccagga CRISPR spacer
gccgaccaagccggaagccgccgatccggctg Protospacer
******** *******.******.. * . .
453. spacer 3.3|2181755|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 10, identity: 0.688
gccgaccatgccggaaaccgccggcgccagga CRISPR spacer
gccgaccaagccggaagccgccgatccggctg Protospacer
******** *******.******.. * . .
454. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NC_021056 (Streptomyces sp. PAMC 26508 plasmid pSP01, complete sequence) position: , mismatch: 10, identity: 0.688
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
attcgcctcatcgactccaacggcgaccccgc Protospacer
.**********.******.***** . *
455. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
aaggacgtcatcaacaccggcggcgtggtggt Protospacer
.* ******** **.*********** .
456. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to JQ680376 (Unidentified phage clone 2209_scaffold1451 genomic sequence) position: , mismatch: 10, identity: 0.688
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
aagtacgagatcagctcctgcggcgtggtgtc Protospacer
..* ****.**** *************
457. spacer 3.4|2181816|32|CP031078|CRISPRCasFinder,CRT matches to MG711460 (Faecalibacterium phage FP_Mushu, complete genome) position: , mismatch: 10, identity: 0.688
tctcgcctcatcaactccagcggcgtggtgtc CRISPR spacer
aagtacgagatcagctcctgcggcgtggtgtc Protospacer
..* ****.**** *************
458. spacer 3.8|2182060|32|CP031078|CRISPRCasFinder,CRT matches to MG518519 (Streptomyces phage Manuel, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggaactgctgggactgcccgcgtacttt CRISPR spacer
cagcggaactgcggggagtgcccgcgctggac Protospacer
. ********** **** ********. .
459. spacer 3.15|2182487|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 10, identity: 0.688
gatgatcgggcgcgtcgtgcgggccgtgctgg CRISPR spacer
tgccgtgctgcgcgacgcgcgggccgtgctgg Protospacer
.. .* ***** **.**************
460. spacer 3.15|2182487|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 10, identity: 0.688
gatgatcgggcgcgtcgtgcgggccgtgctgg CRISPR spacer
cgccgtgctgcgcgacgcgcgggccgtgctgg Protospacer
.. .* ***** **.**************
461. spacer 3.15|2182487|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016293 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.688
gatgatcgggcgcgtcgtgcgggccgtgctgg CRISPR spacer
agaaatcaggcgcgccgtgcgggccgtaaacg Protospacer
.. .***.******.************. *
462. spacer 3.15|2182487|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007050 (Rhizobium leguminosarum bv. trifolii WSM1689 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gatgatcgggcgcgtcgtgcgggccgtgctgg CRISPR spacer
agaaatctggcgcgccgtgcgggccgtagacg Protospacer
.. .*** ******.************. *
463. spacer 3.15|2182487|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_012852 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132504, complete sequence) position: , mismatch: 10, identity: 0.688
gatgatcgggcgcgtcgtgcgggccgtgctgg CRISPR spacer
agaaatctggcgcgccgtgcgggccgtagacg Protospacer
.. .*** ******.************. *
464. spacer 3.15|2182487|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688
gatgatcgggcgcgtcgtgcgggccgtgctgg CRISPR spacer
cgccgtgctgcgcgacgcgcgggccgtgctgg Protospacer
.. .* ***** **.**************
465. spacer 3.15|2182487|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022569 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK05, complete sequence) position: , mismatch: 10, identity: 0.688
gatgatcgggcgcgtcgtgcgggccgtgctgg CRISPR spacer
agaaatctggcgcgccgtgcgggccgtagacg Protospacer
.. .*** ******.************. *
466. spacer 3.15|2182487|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 10, identity: 0.688
gatgatcgggcgcgtcgtgcgggccgtgctgg CRISPR spacer
cgccgtgctgcgcgacgcgcgggccgtgctgg Protospacer
.. .* ***** **.**************
467. spacer 3.15|2182487|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 10, identity: 0.688
gatgatcgggcgcgtcgtgcgggccgtgctgg CRISPR spacer
cgccgtgctgcgcgacgcgcgggccgtgctgg Protospacer
.. .* ***** **.**************
468. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
tcgacggcggcgatcgcggccaccgcccggtc Protospacer
. .**********.******* **** ..*
469. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 10, identity: 0.688
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ggttcggcggcgacggcggccagcgccttggc Protospacer
.. *********. ************ .. *
470. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ggttcggcggcgacggcggccagcgccttggc Protospacer
.. *********. ************ .. *
471. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 10, identity: 0.688
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
ggttcggcggcgacggcggccagcgccttggc Protospacer
.. *********. ************ .. *
472. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_009339 (Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence) position: , mismatch: 10, identity: 0.688
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
gtcgcggcggcgatcgcgaccagcgatggtgc Protospacer
************.***.****** .. *
473. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020471 (Rhodobacter blasticus strain 28/5 plasmid pRsa, complete sequence) position: , mismatch: 10, identity: 0.688
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
agcgcggcggcaatttcggccagcgtgcccag Protospacer
.*********.*** *********. *
474. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR027519 (Thermus thermophilus isolate TTHNAR1 plasmid 3, complete sequence) position: , mismatch: 10, identity: 0.688
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
gcggcggcggcgattgcggcctgggcgtagac Protospacer
****************** * ** . *
475. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 10, identity: 0.688
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
agcaaggcggcgacagcggccagcgccagggt Protospacer
.*. ********. ************* . .
476. spacer 3.17|2182609|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053565 (Pseudonocardia sp. Gen01 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
cacgcggcggcgattgcggccagcgccacacc CRISPR spacer
gtggcggccgcgatcgcggccagcgcggccgg Protospacer
***** *****.*********** .*
477. spacer 3.18|2182670|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_004984 (Microcystis aeruginosa strain UV025 plasmid pMa025, complete sequence) position: , mismatch: 10, identity: 0.688
tccccgctggtgccctcggccgtgctctcgat CRISPR spacer
ctgctgctggtgccctcgcccgtgccctgcgc Protospacer
.. *.************* ******.** ..
478. spacer 3.24|2183036|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026305 (Streptomyces lunaelactis strain MM109 plasmid pSLUN1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggcgcggccacggtcggcagcgcgaccgc CRISPR spacer
tcccacgcggcctcggccggcagcgcgaaggt Protospacer
. .******* ***.*********** *.
479. spacer 3.24|2183036|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018222 (Tardibacter chloracetimidivorans strain JJ-A5 plasmid pHSL1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggcgcggccacggtcggcagcgcgaccgc CRISPR spacer
gaagtcgcggccacggtccgcagccttggcat Protospacer
*** ************* ***** . . *..
480. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
481. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
482. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
483. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
484. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
485. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
486. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011248 (Agrobacterium tumefaciens strain Ach5 plasmid pAt, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
acgagctccgcctcgctcggcgatgccagcag Protospacer
..******** ** ************ .
487. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
488. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
489. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
490. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
491. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
492. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
493. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
494. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
495. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
496. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
497. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
498. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
499. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
500. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
501. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
502. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
503. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
504. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
505. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032919 (Agrobacterium tumefaciens strain 15955 plasmid pAt15955, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
acgagctccgcctcgctcggcgatgccagcag Protospacer
..******** ** ************ .
506. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
507. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
508. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033029 (Agrobacterium tumefaciens strain A6 plasmid pAtA6, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
acgagctccgcctcgctcggcgatgccagcag Protospacer
..******** ** ************ .
509. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
510. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
511. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
512. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
513. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
514. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
515. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
516. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
517. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
518. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
519. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
520. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
521. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
522. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
523. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
524. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
525. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
526. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
527. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
528. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
529. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
530. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
531. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
532. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
533. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
534. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
535. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
536. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
537. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
538. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
539. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
540. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
541. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
542. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
543. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
544. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
ctgattggcgccacggtcgccgatgcctcggg Protospacer
* .. . *********** ******* ***
545. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY349138 (Mycolicibacterium sp. CBMA 213 plasmid pCBMA213_2, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
gacagcgccgccacggccggcgatgccgtcaa Protospacer
* .** *********.**********.. .
546. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
gtctggcgcgccacgatcggcgatgccagggg Protospacer
* . *******.************ **
547. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 10, identity: 0.688
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
gccggctccgccacgtgcggcgatgcggatac Protospacer
************ ********* . .*
548. spacer 3.26|2183158|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 10, identity: 0.688
cgcagaggtgaagcgccagcgcgaatggcgcg CRISPR spacer
cagagcggttaagcgccagcgcgaatccgaga Protospacer
*. ** *** **************** . .
549. spacer 3.26|2183158|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 10, identity: 0.688
cgcagaggtgaagcgccagcgcgaatggcgcg CRISPR spacer
cagagcggttaagcgccagcgcgaatccgaga Protospacer
*. ** *** **************** . .
550. spacer 3.31|2183463|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012477 (Arthrobacter sp. ERGS1:01 isolate water plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
tacgaacgccagctacgggaaatccaagacga CRISPR spacer
gacgaacgcccgctgcgggaaatctacctgcg Protospacer
********* ***.*********.* .
551. spacer 3.35|2183707|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010630 (Phaeobacter inhibens strain P78 plasmid pP78_a, complete sequence) position: , mismatch: 10, identity: 0.688
ctgcattgcaggggtgccatccggggcgggaa CRISPR spacer
atcgtttgcaggggtcccgtccggggcgctgc Protospacer
* ********** **.********* .
552. spacer 3.35|2183707|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010600 (Phaeobacter inhibens strain P83 plasmid pP83_a, complete sequence) position: , mismatch: 10, identity: 0.688
ctgcattgcaggggtgccatccggggcgggaa CRISPR spacer
atcgtttgcaggggtcccgtccggggcgctgc Protospacer
* ********** **.********* .
553. spacer 3.35|2183707|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010726 (Phaeobacter inhibens strain P88 plasmid pP88_a, complete sequence) position: , mismatch: 10, identity: 0.688
ctgcattgcaggggtgccatccggggcgggaa CRISPR spacer
atcgtttgcaggggtcccgtccggggcgctgc Protospacer
* ********** **.********* .
554. spacer 3.35|2183707|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010651 (Phaeobacter inhibens strain P54 plasmid pP54_a, complete sequence) position: , mismatch: 10, identity: 0.688
ctgcattgcaggggtgccatccggggcgggaa CRISPR spacer
atcgtttgcaggggtcccgtccggggcgctgc Protospacer
* ********** **.********* .
555. spacer 3.35|2183707|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010706 (Phaeobacter inhibens strain P66 plasmid pP66_a, complete sequence) position: , mismatch: 10, identity: 0.688
ctgcattgcaggggtgccatccggggcgggaa CRISPR spacer
atcgtttgcaggggtcccgtccggggcgctgc Protospacer
* ********** **.********* .
556. spacer 3.35|2183707|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019308 (Phaeobacter inhibens strain DOK1-1 plasmid pDOK1-1-1, complete sequence) position: , mismatch: 10, identity: 0.688
ctgcattgcaggggtgccatccggggcgggaa CRISPR spacer
atcgtttgcaggggtcccgtccggggcgctgc Protospacer
* ********** **.********* .
557. spacer 3.35|2183707|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010736 (Phaeobacter inhibens strain P72 plasmid pP72_a, complete sequence) position: , mismatch: 10, identity: 0.688
ctgcattgcaggggtgccatccggggcgggaa CRISPR spacer
atcgtttgcaggggtcccgtccggggcgctgc Protospacer
* ********** **.********* .
558. spacer 3.36|2183768|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047177 (Rathayibacter sp. VKM Ac-2759 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
atgcttggcaaggtgcttgaggatccgctggc CRISPR spacer
tctcagaagaaggggcttgaggatccggtggc Protospacer
. * .. **** ************* ****
559. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
gaatacgacctcggcctgcgggtcggcccgga Protospacer
. ***********.**.********. .
560. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
gtgttcgagcgcggcccgcaggtcggcgggct Protospacer
. .**** * **************** .
561. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP020568 (Kitasatospora aureofaciens strain DM-1 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
gaactcgacctcggcgcgcagctcggggcgga Protospacer
************ ***** **** . .
562. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 11, identity: 0.656
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
gtgttcgagcgcggcccgcaggtcggcgggct Protospacer
. .**** * **************** .
563. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 11, identity: 0.656
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
gtgttcgagcgcggcccgcaggtcggcgggct Protospacer
. .**** * **************** .
564. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
gtgttcgagcgcggcccgcaggtcggcgggct Protospacer
. .**** * **************** .
565. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
gtgttcgagcgcggcccgcaggtcggcgggct Protospacer
. .**** * **************** .
566. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
gtgttcgagcgcggcccgcaggtcggcgggct Protospacer
. .**** * **************** .
567. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.656
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
gtgttcgagcgcggcccgcaggtcggcgggct Protospacer
. .**** * **************** .
568. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.656
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
gtgttcgagcgcggcccgcaggtcggcgggct Protospacer
. .**** * **************** .
569. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.656
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
gtgttcgagcgcggcccgcaggtcggcgggct Protospacer
. .**** * **************** .
570. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.656
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
gtgttcgagcgcggcccgcaggtcggcgggct Protospacer
. .**** * **************** .
571. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.656
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
gtgttcgagcgcggcccgcaggtcggcgggct Protospacer
. .**** * **************** .
572. spacer 2.2|1251944|32|CP031078|PILER-CR,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 11, identity: 0.656
cctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
gtgttcgagcgcggcccgcaggtcggcgggct Protospacer
. .**** * **************** .
573. spacer 2.7|1251940|36|CP031078|CRISPRCasFinder matches to NZ_CP040761 (Paracoccus sp. 2251 plasmid unnamed5, complete sequence) position: , mismatch: 11, identity: 0.694
cccgcctctcgacctcggcccgcaggtcggcctctg CRISPR spacer
cgatccgctcggcctcggcccgcaggtcggggatgc Protospacer
* ** ****.****************** .
574. spacer 3.15|2182487|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 11, identity: 0.656
gatgatcgggcgcgtcgtgcgggccgtgctgg CRISPR spacer
agaaatctggcgcgccgtgcgggccgtagacc Protospacer
.. .*** ******.************.
575. spacer 3.15|2182487|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 11, identity: 0.656
gatgatcgggcgcgtcgtgcgggccgtgctgg CRISPR spacer
agaaatctggcgcgccgtgcgggccgtagacc Protospacer
.. .*** ******.************.
576. spacer 3.15|2182487|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 11, identity: 0.656
gatgatcgggcgcgtcgtgcgggccgtgctgg CRISPR spacer
agaaatctggcgcgccgtgcgggccgtagacc Protospacer
.. .*** ******.************.
577. spacer 3.19|2182731|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
aagcagcagtccgatgcgctggccctgctgat CRISPR spacer
cgccagcagtgcgatgcgcttgccctcgacgc Protospacer
. ******* ********* ***** ..
578. spacer 3.19|2182731|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
aagcagcagtccgatgcgctggccctgctgat CRISPR spacer
cgccagcagtgcgatgcgcttgccctcgacgc Protospacer
. ******* ********* ***** ..
579. spacer 3.19|2182731|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 11, identity: 0.656
aagcagcagtccgatgcgctggccctgctgat CRISPR spacer
cgccagcagtgcgatgcgcttgccctcgacgc Protospacer
. ******* ********* ***** ..
580. spacer 3.19|2182731|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
aagcagcagtccgatgcgctggccctgctgat CRISPR spacer
cgccagcagtgcgatgcgcttgccctcgacgc Protospacer
. ******* ********* ***** ..
581. spacer 3.19|2182731|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
aagcagcagtccgatgcgctggccctgctgat CRISPR spacer
cgccagcagtgcgatgcgcttgccctcgacgc Protospacer
. ******* ********* ***** ..
582. spacer 3.19|2182731|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
aagcagcagtccgatgcgctggccctgctgat CRISPR spacer
cgccagcagtgcgatgcgcttgccctcgacgc Protospacer
. ******* ********* ***** ..
583. spacer 3.19|2182731|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
aagcagcagtccgatgcgctggccctgctgat CRISPR spacer
cgccagcagtgcgatgcgcttgccctcgacgc Protospacer
. ******* ********* ***** ..
584. spacer 3.19|2182731|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
aagcagcagtccgatgcgctggccctgctgat CRISPR spacer
cgccagcagtgcgatgcgcttgccctcgacgc Protospacer
. ******* ********* ***** ..
585. spacer 3.19|2182731|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
aagcagcagtccgatgcgctggccctgctgat CRISPR spacer
cgccagcagtgcgatgcgcttgccctcgacgc Protospacer
. ******* ********* ***** ..
586. spacer 3.23|2182975|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 11, identity: 0.656
gataccgtctgggctggtgacggcgacgattt CRISPR spacer
atcgtcgtccaggctggtgacggcgacgccgc Protospacer
. ...****..***************** . .
587. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 11, identity: 0.656
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
gcgcatctggccacggtcggcgacgacacggc Protospacer
. .... **************.* ******
588. spacer 3.25|2183097|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 11, identity: 0.656
caaggctccgccacggtcggcgatgccacggc CRISPR spacer
gcgcatctggccacggtcggcgacgacacggc Protospacer
. .... **************.* ******
589. spacer 3.33|2183585|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020444 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed4, complete sequence) position: , mismatch: 11, identity: 0.656
gcccagatcgacgcgcaagcggagcaggtcgg CRISPR spacer
atggctgtcgacgcgccagcagagcaggtcca Protospacer
.. .********* ***.********* .
590. spacer 3.33|2183585|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031083 (Paracoccus yeei strain CCUG 32053 plasmid pYEE5, complete sequence) position: , mismatch: 11, identity: 0.656
gcccagatcgacgcgcaagcggagcaggtcgg CRISPR spacer
atggctgtcgacgcgccagcagagcaggtcca Protospacer
.. .********* ***.********* .
591. spacer 3.36|2183768|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to CP006583 (Mesorhizobium huakuii 7653R plasmid pMHb, complete sequence) position: , mismatch: 11, identity: 0.656
atgcttggcaaggtgcttgaggatccgctggc CRISPR spacer
ggttttggcgagttgcttgaggatccggccat Protospacer
. .*****.** ************** . ..
592. spacer 3.36|2183768|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to CP006583 (Mesorhizobium huakuii 7653R plasmid pMHb, complete sequence) position: , mismatch: 11, identity: 0.656
atgcttggcaaggtgcttgaggatccgctggc CRISPR spacer
ggttttggcgagttgcttgaggatccggccat Protospacer
. .*****.** ************** . ..
593. spacer 3.36|2183768|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to CP006583 (Mesorhizobium huakuii 7653R plasmid pMHb, complete sequence) position: , mismatch: 11, identity: 0.656
atgcttggcaaggtgcttgaggatccgctggc CRISPR spacer
ggttttggcgagttgcttgaggatccggccat Protospacer
. .*****.** ************** . ..
594. spacer 3.36|2183768|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to CP006582 (Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence) position: , mismatch: 11, identity: 0.656
atgcttggcaaggtgcttgaggatccgctggc CRISPR spacer
ggttttggcgagttgcttgaggatccggccat Protospacer
. .*****.** ************** . ..
595. spacer 3.36|2183768|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to CP006582 (Mesorhizobium huakuii 7653R plasmid pMHa, complete sequence) position: , mismatch: 11, identity: 0.656
atgcttggcaaggtgcttgaggatccgctggc CRISPR spacer
ggttttggcgagttgcttgaggatccggccat Protospacer
. .*****.** ************** . ..
596. spacer 3.15|2182487|32|CP031078|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026517 (Deinococcus sp. NW-56 plasmid unnamed1, complete sequence) position: , mismatch: 13, identity: 0.594
gatgatcgggcgcgtcgtgcgggccgtgctgg--------- CRISPR spacer
---------gcgcctcgggcggggcgtgcgggccgtggacc Protospacer
**** *** ***** ***** **
