1. spacer 2.20|1017592|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_017508 (Marinobacter adhaerens HP15 plasmid pHP-42, complete sequence) position: , mismatch: 0, identity: 1.0
tcccgccgaccactaccgaagaagaaaggtca CRISPR spacer
tcccgccgaccactaccgaagaagaaaggtca Protospacer
********************************
2. spacer 2.20|1017592|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044223 (Nitrincola sp. KXZD1103 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0
tcccgccgaccactaccgaagaagaaaggtca CRISPR spacer
tcccgccgaccactaccgaagaagaaaggtca Protospacer
********************************
3. spacer 2.19|1017531|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_017508 (Marinobacter adhaerens HP15 plasmid pHP-42, complete sequence) position: , mismatch: 1, identity: 0.969
acaattttcaatttcataaaatggcttccttt CRISPR spacer
acaaatttcaatttcataaaatggcttccttt Protospacer
**** ***************************
4. spacer 2.19|1017531|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044223 (Nitrincola sp. KXZD1103 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
acaattttcaatttcataaaatggcttccttt CRISPR spacer
acaaatttcaatttcataaaatggcttccttt Protospacer
**** ***************************
5. spacer 2.47|1019239|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812
gcggcagcgcagcaacacgccagtctcggggt CRISPR spacer
gccgtcgggcagcacctcgccagtctcggggt Protospacer
** *. * ****** * ***************
6. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049906 (Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
acaccgcgcattcccggcgcggtcagcattcc Protospacer
* .*********.****************.
7. spacer 2.4|1016616|32|CP024811|CRISPRCasFinder,CRT matches to NC_049432 (Ralstonia phage RsoM1USA, complete genome) position: , mismatch: 7, identity: 0.781
ttgcaggtgaagcgcaatatcctgctgaaaac CRISPR spacer
gtgtacgtgaagcgcaatatcctggtcagcac Protospacer
**.* ****************** * *. **
8. spacer 2.9|1016921|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018516 (Acetobacter orientalis strain FAN1 plasmid pAOF1, complete sequence) position: , mismatch: 7, identity: 0.781
ctaacagt--cgctatcggtgctgacataagcga CRISPR spacer
--gacggtcgcgccttcggtgctgacataagcgc Protospacer
.**.** ***. ******************
9. spacer 2.15|1017287|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to HQ316580 (Vibrio phage douglas 12A4 genomic sequence) position: , mismatch: 7, identity: 0.781
aagcggtcaacaacacgctcacctagccacgc CRISPR spacer
atacggtcaaatacacgctcacctagcacctc Protospacer
* .******* *************** * *
10. spacer 2.17|1017409|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to HQ316580 (Vibrio phage douglas 12A4 genomic sequence) position: , mismatch: 7, identity: 0.781
aagcggtcaacaacacgctcacctagccacgc CRISPR spacer
atacggtcaaatacacgctcacctagcacctc Protospacer
* .******* *************** * *
11. spacer 2.22|1017714|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033074 (Buttiauxella sp. 3AFRM03 plasmid pBTX_120, complete sequence) position: , mismatch: 7, identity: 0.781
agctgccg-tttgataaagcgctggtagagcag CRISPR spacer
-tcgaccgatttgataaagctctggttgagcat Protospacer
* .*** *********** ***** *****
12. spacer 2.22|1017714|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030922 (Escherichia coli strain KL53 plasmid pKL53-S, complete sequence) position: , mismatch: 7, identity: 0.781
agctgccg-tttgataaagcgctggtagagcag CRISPR spacer
-tcgaccgatttgataaagctctggttgagcat Protospacer
* .*** *********** ***** *****
13. spacer 2.22|1017714|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042584 (Escherichia coli strain LD91-1 plasmid pLD91-1-76kb, complete sequence) position: , mismatch: 7, identity: 0.781
agctgccg-tttgataaagcgctggtagagcag CRISPR spacer
-tcgaccgatttgataaagctctggttgagcat Protospacer
* .*** *********** ***** *****
14. spacer 2.23|1017775|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 7, identity: 0.781
tccgcctcgtactcctcccagctctcgtcaat-- CRISPR spacer
tgtgcctcgaactgctcccagctctcg--aactg Protospacer
* .****** *** ************* **.
15. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MN692973 (Marine virus AFVG_117M33, complete genome) position: , mismatch: 7, identity: 0.781
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
ctagccgcaccaccataaccaacaatagtccc Protospacer
*.*********.**********.**** .. *
16. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MN582103 (Podoviridae sp. cty5g4, complete genome) position: , mismatch: 7, identity: 0.781
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
tcatcgtcaccaccataaccgataatatctcc Protospacer
.** * ****.********.********* *
17. spacer 2.48|1019300|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to AF165214 (Bacteriophage D3, complete genome) position: , mismatch: 7, identity: 0.781
-cgggctttggctagggcggcgtctgcgcgctg CRISPR spacer
gccagc-ttggccagggcggcgtcggcgcggtc Protospacer
* .** *****.*********** ***** *
18. spacer 2.53|1019605|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MN369756 (Gordonia phage Anon, complete genome) position: , mismatch: 7, identity: 0.781
tcctgcgtgatgccaaacacgttgagcagttc-- CRISPR spacer
agcttcgtgatgccaaacccgttga--agtccag Protospacer
** ************* ****** ***.*
19. spacer 2.54|1019666|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 7, identity: 0.781
aatatc-cgtttgcaggtcgcccgcccggcgcg CRISPR spacer
-gtgccatgtttgcagttcgcccgccccgcgcg Protospacer
.*..* .******** ********** *****
20. spacer 2.54|1019666|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 7, identity: 0.781
aatatc-cgtttgcaggtcgcccgcccggcgcg CRISPR spacer
-gtgccatgtttgcagttcgcccgccccgcgcg Protospacer
.*..* .******** ********** *****
21. spacer 2.54|1019666|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016080 (Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence) position: , mismatch: 7, identity: 0.781
aatatc-cgtttgcaggtcgcccgcccggcgcg CRISPR spacer
-gtgccatgtttgcagttcgcccgccccgcgcg Protospacer
.*..* .******** ********** *****
22. spacer 2.54|1019666|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
aatatccgtttgcaggtcgcccgcccgg-cgcg CRISPR spacer
cgcgtccggttgcaggtcgcccgccaggacgc- Protospacer
...**** **************** ** ***
23. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028550 (Klebsiella variicola strain WCHKP19 plasmid p2_020019, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
24. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021940 (Klebsiella pneumoniae strain AR_0145 plasmid tig00000209, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
25. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026134 (Klebsiella pneumoniae strain F5 plasmid pF5_2, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
26. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022128 (Klebsiella pneumoniae strain DHQP1605752_NV plasmid p1605752FIB_2, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
27. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017387 (Klebsiella pneumoniae strain KP36 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
28. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044034 (Klebsiella pneumoniae strain FDAARGOS_631 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
29. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP052409 (Klebsiella pneumoniae strain C17KP0008 plasmid pC17KP0008-2, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
30. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP052311 (Klebsiella pneumoniae strain E16KP0102 plasmid pE16KP0102-2, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
31. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041929 (Klebsiella pneumoniae strain 18-2374 plasmid pSECR18-2374B, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
32. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025467 (Klebsiella pneumoniae strain JS187 plasmid p187-1, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
33. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP023149 (Klebsiella pneumoniae strain SMKP03 plasmid pSMKP03L, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
34. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP044030 (Klebsiella pneumoniae strain RJY9645 plasmid pY9645-105, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
35. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019050 (Klebsiella pneumoniae subsp. pneumoniae strain RJA166 plasmid pRJA166c, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
36. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP052220 (Klebsiella pneumoniae strain E17KP0053 plasmid pE17KP0053-3, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
37. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP052416 (Klebsiella pneumoniae strain C16KP0189 plasmid pC16KP0189-2, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
38. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024877 (Klebsiella pneumoniae strain NH25 plasmid pNH25.3, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
39. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021962 (Klebsiella pneumoniae strain AR_0139 plasmid tig00000008, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
40. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012570 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-4.X, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
41. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031791 (Klebsiella pneumoniae strain KSB1_1I-sc-2280289 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
42. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP052552 (Klebsiella pneumoniae strain A17KP0038 plasmid pA17KP0038-1, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
43. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031803 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
44. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP036194 (Klebsiella pneumoniae strain BA34918 plasmid pIncFIB, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
45. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040026 (Klebsiella pneumoniae strain KPC160132 plasmid pIncFI-L132, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
46. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028997 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
47. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040729 (Klebsiella pneumoniae strain KpvST147B_SE1_1_NDM plasmid pKpvST147B_5, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
48. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027045 (Klebsiella pneumoniae strain 1_GR_13 plasmid IncFIB, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
49. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP052527 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-3, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
50. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046951 (Klebsiella pneumoniae strain BD_DM_914 plasmid punnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
51. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046941 (Klebsiella pneumoniae strain BD_DM_697 plasmid punnamed2) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
52. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP008931 (Klebsiella pneumoniae strain PMK1 plasmid pPMK1-B, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
53. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP052281 (Klebsiella pneumoniae strain E16KP0224 plasmid pE16KP0224-1, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
54. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020063 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_2, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
55. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012565 (Klebsiella pneumoniae strain UCLAOXA232KP plasmid pUCLAOXA232-4, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
56. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035909 (Klebsiella pneumoniae strain BA4656 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
57. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP052423 (Klebsiella pneumoniae strain C16KP0164 plasmid pC16KP0164-1, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
58. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046383 (Klebsiella pneumoniae strain BD_DM_782 plasmid punnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
59. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024460 (Klebsiella pneumoniae strain QS17-0161 plasmid pMRSN480738_112.7, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
60. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050365 (Klebsiella pneumoniae strain 47733 plasmid p47733_IncFIB, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
61. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021714 (Klebsiella pneumoniae strain AR_0129 plasmid tig00000001, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctgccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
62. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026146 (Klebsiella pneumoniae strain F132 plasmid pF132_1, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
63. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026150 (Klebsiella pneumoniae strain F138 plasmid pF138_1, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
64. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045677 (Klebsiella pneumoniae strain WSD411 plasmid pWSD411_4, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
65. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026138 (Klebsiella pneumoniae strain F77 plasmid pF77_2, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
66. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015755 (Klebsiella pneumoniae strain W14 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctgccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
67. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016924 (Klebsiella pneumoniae isolate 23 plasmid pIncFIB_DHQP1400954, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
68. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032187 (Klebsiella pneumoniae strain AR_0075 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
69. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027149 (Klebsiella pneumoniae strain AR_0363 plasmid unnamed8) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
70. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014756 (Klebsiella pneumoniae strain AATZP plasmid pKPN-04f, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
71. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021945 (Klebsiella pneumoniae strain AR_0152 plasmid tig00000194, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
72. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP052390 (Klebsiella pneumoniae strain C17KP0052 plasmid pC17KP0052-2, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
73. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP052352 (Klebsiella pneumoniae strain D16KP0146 plasmid pD17KP0032-1, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
74. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_016838 (Klebsiella pneumoniae subsp. pneumoniae HS11286 plasmid pKPHS1, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
75. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028544 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020143 plasmid p2_020143, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
76. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034055 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
77. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP052393 (Klebsiella pneumoniae strain C17KP0040 plasmid pC17KP0040-1, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
78. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044370 (Klebsiella pneumoniae strain 2018C01-046 plasmid p2018C01-046-2, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
79. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034047 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
80. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016161 (Klebsiella pneumoniae strain TH1 isolate TH1 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctgccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
81. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP050276 (Klebsiella pneumoniae strain 10553 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
82. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP052470 (Klebsiella pneumoniae strain C16KP0053 plasmid pC16KP0053-2, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
83. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023984 (Klebsiella variicola strain X39 plasmid pX39-7, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
84. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047636 (Klebsiella pneumoniae strain K2606 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctgccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
85. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP050287 (Klebsiella pneumoniae strain 9630 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
86. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032225 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
87. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY354306 (Klebsiella pneumoniae strain 301 plasmid pKP301b, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
88. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF144193 (Klebsiella pneumoniae strain 205880 plasmid p205880-NR1, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
89. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to LR134218 (Klebsiella aerogenes strain NCTC10317 genome assembly, plasmid: 2) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
90. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MK422451 (Klebsiella phage ST13-OXA48phi12.3, complete genome) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
91. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP058330 (Klebsiella phage vB_Kpn_1825-KPC53 chromosome phage_vB_Kpn_1825-KPC53, complete sequence) position: , mismatch: 7, identity: 0.781
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgag Protospacer
*. .******************.*.**** *
92. spacer 2.73|1020826|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 7, identity: 0.781
gggaacccccgaccgcggacgagatccgggag CRISPR spacer
cgccgcccctgaccgccgacgagatccgggaa Protospacer
* .****.****** **************.
93. spacer 2.13|1017165|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_017184 (Zymomonas mobilis subsp. mobilis ATCC 10988 plasmid pZMOB04, complete sequence) position: , mismatch: 8, identity: 0.75
cgacctc-----cccgaaaagatcaagctgatcctcg CRISPR spacer
-----tctaaaacccgaaaagatcaaactgatccttt Protospacer
** **************.********.
94. spacer 2.15|1017287|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 8, identity: 0.75
aagcggtcaacaacacgctcacctagccacgc- CRISPR spacer
cggcgggcaacaacacgttcaccta-ttacacc Protospacer
.**** **********.******* ..**.*
95. spacer 2.16|1017348|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to KT001912 (Bacillus phage Silence, complete genome) position: , mismatch: 8, identity: 0.75
ccacggcgcatagattccaggcggctaaccgt CRISPR spacer
gaagggcgtatagattctaggcggctaaaaat Protospacer
* ****.********.********** .*
96. spacer 2.17|1017409|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039697 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK22, complete sequence) position: , mismatch: 8, identity: 0.75
aagcggtcaacaacacgctcacctagccacgc- CRISPR spacer
cggcgggcaacaacacgttcaccta-ttacacc Protospacer
.**** **********.******* ..**.*
97. spacer 2.18|1017470|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MT104122 (Sporosarcina phage Lietuvens, complete genome) position: , mismatch: 8, identity: 0.75
acggattgatcaaggcgaaggatgacgatgag CRISPR spacer
aattattgttcaaggcgaaggacgacggagat Protospacer
* **** *************.****. **
98. spacer 2.21|1017653|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ttcgatcaaaccggcttcctcgctttccaccg CRISPR spacer
ccggatctaaccggcttcctcgccttcggcag Protospacer
.. **** ***************.*** .* *
99. spacer 2.28|1018080|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015595 (Acinetobacter sp. NCu2D-2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgctcgactagattatgatcagcacaggatgg CRISPR spacer
taccgtacaagattatgatcaggacaggatct Protospacer
*.*. ** ************* *******
100. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to AP019515 (Halomonas sulfidaeris ATCC BAA-803 plasmid pBAA-803-A DNA, complete genome) position: , mismatch: 8, identity: 0.75
ctgcttggccagcaggccattattgatcagca CRISPR spacer
aaacgcagccagcaagccattatcgatcagca Protospacer
.* ..*******.********.********
101. spacer 2.36|1018568|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 8, identity: 0.75
actcgccgcgctcatggagcgccattagctcc CRISPR spacer
catcgccgcgatcatggagagccatttccgct Protospacer
******** ******** ****** * *.
102. spacer 2.53|1019605|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 8, identity: 0.75
tcctgcgtgatgccaaacacgttg-agcagttc CRISPR spacer
gccagcgtgatgccaaagacgttgctgccata- Protospacer
** ************* ****** ** .*
103. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP036373 (Klebsiella pneumoniae strain WCHKP020037 plasmid p1_020037, complete sequence) position: , mismatch: 8, identity: 0.75
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctaccgcgcattctcggcgcggccggcatgat Protospacer
*. .******************.*.****
104. spacer 2.73|1020826|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014580 (Burkholderia sp. OLGA172 plasmid pOLGA1, complete sequence) position: , mismatch: 8, identity: 0.75
gggaacccccgaccgcggacgagatccgggag CRISPR spacer
ttgaaccaccgacagcggacgagatgcagcgg Protospacer
***** ***** *********** *.* .*
105. spacer 2.74|1020887|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to JX486088 (Lactobacillus phage ATCC 8014-B2, complete genome) position: , mismatch: 8, identity: 0.75
aatatcaattccgatctctccaacccatgtat CRISPR spacer
aatatcaattccgttctctgcaaactttctga Protospacer
************* ***** *** *. * *.
106. spacer 2.1|1016433|32|CP024811|CRISPRCasFinder,CRT matches to NC_019330 (Arthrobacter sp. J3-40 plasmid pJ340-69, complete sequence) position: , mismatch: 9, identity: 0.719
atacagcggcgagtaggccgactgtatgacca CRISPR spacer
ccacagcggcgagcaggccggctgtaacaaag Protospacer
.***********.******.***** * .
107. spacer 2.1|1016433|32|CP024811|CRISPRCasFinder,CRT matches to NC_017805 (Deinococcus gobiensis I-0 plasmid P1, complete sequence) position: , mismatch: 9, identity: 0.719
atacagcggcgagtaggccgactgtatgacca CRISPR spacer
gtacagcgtccagtaggccgactgcggcacgc Protospacer
.******* * *************.. **
108. spacer 2.2|1016494|32|CP024811|CRISPRCasFinder,CRT matches to NZ_CP049358 (Deinococcus wulumuqiensis R12 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
aagaccggcacgctgggcagcgtaatcccagg CRISPR spacer
acccccggcacgccgggcagcgtcatcacgtt Protospacer
* *********.********* *** *.
109. spacer 2.2|1016494|32|CP024811|CRISPRCasFinder,CRT matches to NZ_CP031159 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdA, complete sequence) position: , mismatch: 9, identity: 0.719
aagaccggcacgctgggcagcgtaatcccagg CRISPR spacer
acccccggcacgccgggcagcgtcatcacgtt Protospacer
* *********.********* *** *.
110. spacer 2.19|1017531|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013981 (Staphylococcus equorum strain KM1031 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acaattttcaatttcataaaatggcttccttt CRISPR spacer
acaatttttaatttcagaaaatgtacaattgt Protospacer
********.******* ****** . .* *
111. spacer 2.19|1017531|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013981 (Staphylococcus equorum strain KM1031 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acaattttcaatttcataaaatggcttccttt CRISPR spacer
acaatttttaatttcagaaaatgtacaattgt Protospacer
********.******* ****** . .* *
112. spacer 2.21|1017653|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028965 (Burkholderia sp. IDO3 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
ttcgatcaaaccggcttcctcgctttccaccg CRISPR spacer
cggtttcaaaccggcttccgcgctgtcccacg Protospacer
. ************** **** *** **
113. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016500 (Agrobacterium sp. RAC06 plasmid pBSY240_1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
gaccttggccagcaggccattcttgacgccga Protospacer
****************** ****. *
114. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045856 (Agrobacterium sp. MA01 plasmid punanmed2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
gaccttggccagcaggccattcttgacgccga Protospacer
****************** ****. *
115. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025949 (Escherichia coli strain SCEC020023 plasmid pCTXM55_020023, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
116. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KU987452 (Citrobacter freundii strain AC2901 plasmid AC2901, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
117. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX608544 (Escherichia coli strain FA27 plasmid pFA27_2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
118. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY751926 (Klebsiella pneumoniae strain HK02-026 plasmid pHK02-026, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
119. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY288024 (Klebsiella pneumoniae strain ST709 plasmid pCC1410-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
120. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
121. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KU664810 (Escherichia coli strain 11.3-R3 plasmid pCERC5, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
122. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KT988018 (Escherichia coli strain V282 plasmid pEcoV282, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
123. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KU288634 (Escherichia coli strain FAM22321 plasmid pFAM22321, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
124. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY007017 (Escherichia coli strain 14.3-R4 plasmid pCERC9, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
125. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KU321583 (Escherichia coli strain E80 plasmid pE80, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
126. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KT879914 (Escherichia coli strain HNEC55 plasmid pHNEC55, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
127. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX839209 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
128. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KU254579 (Escherichia coli strain YD786 plasmid pYD786-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
129. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX503323 (Escherichia coli strain HNEC46 plasmid PHNEC46, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
130. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032991 (Escherichia coli strain W2-5 plasmid p2_W2-5, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
131. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015072 (Escherichia coli strain Ecol_743 plasmid pEC743_3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
132. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
133. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KT185451 (Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
134. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KT818627 (Klebsiella pneumoniae strain U25 plasmid U25P002, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
135. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KT725788 (Klebsiella pneumoniae strain ST147 plasmid pCC1410-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
136. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KT725789 (Klebsiella pneumoniae strain ST147 plasmid pCC1409-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
137. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
138. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KT002541 (Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
139. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KT990220 (Escherichia coli strain 42-2 plasmid p42-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
140. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KP398867 (Escherichia coli strain DB04277 plasmid pDB4277, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
141. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KP789020 (Escherichia coli strain WCHEC13-8 plasmid pCTXM15, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
142. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KR078259 (Escherichia coli strain YD472 plasmid pYHCC, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
143. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042629 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
144. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041338 (Escherichia coli strain CCUG 73778 plasmid pSUH-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
145. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041339 (Escherichia coli strain CCUG 73778 plasmid pSUH-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
146. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040995 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
147. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042337 (Escherichia coli strain GZ04-0086 plasmid pCTXM-GZ04, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
148. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042338 (Escherichia coli strain GZ04-0086 plasmid pNDM5-GZ04_B, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
149. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_014232 (Escherichia coli ETEC 1392/75 plasmid p1081, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcagggacatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
150. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP022460 (Shigella sonnei strain 2015C-3807 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
151. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032799 (Escherichia coli strain ERL06-2497 plasmid pERL06-2497-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
152. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019561 (Escherichia coli strain KSC1031 plasmid pMRGN1031, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
153. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040124 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
154. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035479 (Escherichia coli strain U13A plasmid pU13A_B, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
155. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX646543 (Shigella boydii strain 2246 plasmid p2246-CTXM, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
156. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP054336 (Escherichia coli strain SCU-120 plasmid pSCU-120-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
157. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_020278 (Escherichia coli strain 3A11 plasmid pHN3A11, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
158. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043219 (Escherichia coli O80:H26 strain EC-107 plasmid pET6.2-IncFII, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
159. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010209 (Escherichia coli strain M11 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
160. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028587 (Escherichia coli strain WCHEC4533 plasmid pCTXM15_000533, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
161. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042601 (Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
162. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
163. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049351 (Escherichia coli strain 3R plasmid p3R-3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
164. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to KY130431 (Klebsiella pneumoniae plasmid pABC143C-NDM, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
165. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019272 (Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
166. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011135 (Escherichia coli VR50 plasmid pVR50A, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
167. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010174 (Escherichia coli strain H8 plasmid B, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
168. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LS992188 (Escherichia coli isolate Escherichia coli str. 3426 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
169. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LS992188 (Escherichia coli isolate Escherichia coli str. 3426 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
170. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053732 (Escherichia coli strain CP55_Sichuan plasmid pCP55-IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
171. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053734 (Escherichia coli strain CP55_Sichuan plasmid pCP55-IncFII, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
172. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK878892 (Escherichia coli strain J53 plasmid pMG333, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
173. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_025106 (Escherichia coli strain NMI5428/11 plasmid pMC-NDM, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
174. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to LN850163 (Escherichia coli plasmid pI1-34TF, strain I1-34) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
175. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014199 (Escherichia coli strain MRE600 plasmid pMRE600-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
176. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029575 (Escherichia coli strain DA33133 plasmid pDA33133-157, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
177. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029734 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
178. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033394 (Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
179. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033395 (Klebsiella pneumoniae strain WCHKP015625 plasmid pKPC12_015625, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
180. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053737 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFII, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
181. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KJ020575 (Escherichia coli strain FP460 plasmid pHNFP460-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
182. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044404 (Escherichia coli strain NMBU-W10C18 plasmid pNMBU-W10C18_01, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
183. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN824138 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_E_Kpneumoniae_MS6671) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
184. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047091 (Salmonella sp. S13 plasmid pS13-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
185. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012626 (Escherichia coli strain SF-468 plasmid pSF-468-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
186. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028431 (Escherichia coli strain RM9131 plasmid pRM9131-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
187. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MT077881 (Escherichia coli plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
188. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MT077885 (Escherichia coli plasmid p37, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
189. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MT077887 (Escherichia coli plasmid p62, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
190. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MT077889 (Escherichia coli plasmid p77, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
191. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LS992182 (Escherichia coli isolate Escherichia coli str. TO124 plasmid 3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
192. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to KX023260 (Escherichia coli plasmid pSCE516-3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
193. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026826 (Shigella dysenteriae strain ATCC 12021 plasmid unnamed) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
194. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT838198 (Escherichia coli isolate WI1 isolate plasmid pWI1-incFII, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
195. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR130558 (Escherichia coli strain MS14385 isolate MS14385 plasmid 4) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
196. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048296 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
197. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010372 (Escherichia coli strain 6409 plasmid p6409-151.583kb, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
198. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP046677 (Escherichia coli strain 152661 plasmid p152661_pINV, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
199. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020517 (Escherichia coli strain 222 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
200. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019276 (Escherichia coli strain 13P477T plasmid p13P477T-3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
201. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033629 (Klebsiella pneumoniae strain 4743 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
202. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
203. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP036362 (Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
204. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049078 (Escherichia coli strain p11A plasmid p11A_p1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
205. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049079 (Escherichia coli strain p11A plasmid p11A_p2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
206. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MT077880 (Escherichia coli plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
207. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MN158990 (Escherichia coli strain TREC4 plasmid pTREC4, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
208. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054942 (Escherichia coli strain MS6192 plasmid pMS6192B, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
209. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024284 (Escherichia albertii strain 2014C-4356 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
210. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
211. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028118 (Escherichia coli O111 str. RM9322 plasmid pRM9322-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
212. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020515 (Escherichia coli strain 219 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
213. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
214. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012139 (Shigella flexneri 2a strain 981 plasmid 981p2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
215. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_018998 (Escherichia coli F18+ plasmid pTC1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
216. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021341 (Escherichia coli strain 95NR1 plasmid p95NR1B, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
217. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021337 (Escherichia coli strain 95JB1 plasmid p95JB1B, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
218. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029691 (Escherichia coli strain SD134209 plasmid pSD134209-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
219. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023845 (Escherichia coli strain 4/1-1 plasmid p4_1_1.1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
220. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MN061455 (Escherichia coli strain EC-15-3 plasmid pEC-15-3-NDM-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
221. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MN891682 (Klebsiella pneumoniae strain 116753 plasmid p116753-KPC, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
222. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038393 (Escherichia coli O157:H7 strain DEC5B plasmid pDEC5B-5, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
223. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041957 (Escherichia coli strain EC2 plasmid pEC2_2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
224. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041948 (Klebsiella pneumoniae strain KP2 plasmid pKP2_2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
225. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027384 (Escherichia coli strain 2013C-3250 plasmid unnamed4) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
226. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027385 (Escherichia coli strain 2013C-3250 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
227. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041414 (Escherichia coli strain STEC719 plasmid pSTEC719_3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
228. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012632 (Escherichia coli strain SF-173 plasmid pSF-173-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
229. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027130 (Escherichia coli strain AR_0372 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
230. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MN641485 (Escherichia coli strain SDCRK18-7 plasmid pNDM-SDCRK18-7, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
231. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP045525 (Shigella sonnei strain 6904.27 plasmid p6904-27) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
232. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032877 (Escherichia coli strain WCHEC000837 plasmid pCTXM15_000837, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
233. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015503 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
234. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013834 (Escherichia coli strain JJ2434 plasmid pJJ2434_2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
235. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039562 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014847 plasmid p08-5333.1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
236. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024652 (Escherichia coli strain BH100 substr. MG2014 plasmid pBH100-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
237. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049937 (Escherichia coli strain JL05 plasmid pARG01, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
238. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016389 (Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid pESBL931, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
239. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018994 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
240. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP037912 (Escherichia coli strain YSP8-1 plasmid pYSP8-1-CTX-M-14, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
241. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009231 (Escherichia coli strain CA14 plasmid pCA14, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
242. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011019 (Escherichia coli strain CI5 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
243. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034324 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
244. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to KU318420 (Klebsiella pneumoniae strain KP04 plasmid pKP04CTXM, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
245. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040547 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
246. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to AP014876 (Escherichia coli plasmid pV021-b DNA, complete sequence, strain: V021) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
247. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to AP014877 (Escherichia coli plasmid pV085-c DNA, complete sequence, strain: V085) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
248. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010223 (Escherichia coli strain M19 plasmid B, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
249. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046261 (Escherichia coli strain ECO2947 plasmid p2947-NDM5, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
250. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024831 (Escherichia coli strain CREC-532 plasmid pCREC-532_1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
251. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027439 (Escherichia coli strain 2012C-4221 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
252. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032242 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
253. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
254. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034254 (Escherichia coli strain IVRI Kol CP4 plasmid p1ESCUMpO83_CORR) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
255. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018805 (Escherichia coli strain E2863 plasmid pE2863-3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
256. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035314 (Escherichia coli strain D72 plasmid pD72-F33, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
257. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to KY463220 (Escherichia coli plasmid pNDM5-IBAC, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
258. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034932 (Shigella flexneri strain 2013C-3749 plasmid p2013C-3749-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
259. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041177 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
260. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051655 (Escherichia coli strain RM13745 plasmid pRM13745-2) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
261. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051653 (Escherichia coli strain RM13752 plasmid pRM13752) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
262. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051656 (Escherichia coli strain RM11911 plasmid pRM11911) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
263. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039513 (Salmonella enterica subsp. enterica serovar Worthington strain 7102.58 plasmid p7102_58-6, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
264. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010181 (Escherichia coli strain M1 plasmid A, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
265. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP043748 (Escherichia coli strain CVM N16EC0140 plasmid pN16EC0140-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
266. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021684 (Escherichia coli strain AR_0162 plasmid tig00008015, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
267. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024852 (Escherichia coli strain AR_0006 plasmid tig00000164, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
268. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024836 (Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
269. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026201 (Escherichia coli strain ECONIH6 plasmid pNDM-d2e9, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
270. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027311 (Escherichia coli strain 2014C-4135 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
271. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
272. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012636 (Escherichia coli strain SF-088 plasmid pSF-088-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
273. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050707 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
274. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009233 (Escherichia coli strain CA08 plasmid pCA08, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
275. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009232 (Escherichia coli strain CA28 plasmid pCA28, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
276. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021203 (Escherichia coli strain Z1002 plasmid p1002-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
277. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021204 (Escherichia coli strain Z1002 plasmid p1002-4, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
278. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021210 (Escherichia coli strain strain Z247 plasmid p2474-NDM1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
279. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027576 (Escherichia coli strain 2013C-4081 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
280. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022731 (Escherichia coli strain SA186 plasmid pSA186_2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
281. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
282. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035470 (Escherichia coli strain U12A plasmid pU12A_C, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
283. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022227 (Escherichia coli strain WCHEC96200 plasmid pCTXM15_000200, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
284. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027448 (Escherichia coli strain 2014C-3075 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
285. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018147 (Escherichia coli strain M217 isolate M217 plasmid pM217_FII, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
286. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048372 (Escherichia coli strain 164 plasmid pC-F-163_A, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
287. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051689 (Escherichia coli strain SCU-387 plasmid pSCU-387-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
288. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018785 (Escherichia coli strain SK1144 plasmid pSK1144) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
289. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_010862 (Escherichia coli plasmid pMAR7, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
290. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_019071 (Escherichia coli plasmid pHK09, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
291. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_019072 (Escherichia coli plasmid pHK08, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
292. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_019089 (Escherichia coli plasmid pGUE-NDM, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
293. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_019095 (Escherichia coli plasmid pXZ, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
294. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040807 (Escherichia fergusonii strain EFCF056 plasmid pEF02, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
295. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046117 (Enterobacter cloacae strain CBG15936 plasmid pTEM-CBG, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
296. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023389 (Escherichia coli strain 1105 plasmid p74, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
297. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023372 (Escherichia coli strain 1283 plasmid p109, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
298. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024860 (Escherichia coli strain AR_0014 plasmid unitig_1_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
299. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024816 (Escherichia coli strain CREC-629 plasmid pCREC-629_1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
300. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024823 (Escherichia coli strain CREC-591 plasmid pCREC-591_2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
301. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024856 (Escherichia coli strain AR_0011 plasmid tig00001011_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
302. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027222 (Escherichia coli strain 2015C-3101 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
303. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021536 (Escherichia coli strain AR_0119 plasmid unitig_2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
304. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP036180 (Escherichia coli strain WCHEC025970 plasmid p1_025970, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
305. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to KU932024 (Escherichia coli plasmid pEC13, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
306. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_025177 (Escherichia coli plasmid pH1519-76, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
307. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to LO017736 (Escherichia coli str. 473 plasmid pRCS52, complete genome) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
308. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to LO017737 (Escherichia coli str. 3249 plasmid RCS105_pI, complete genome) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
309. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to LO017738 (Escherichia coli str. 690 plasmid pRCS57, complete genome) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
310. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019444 (Salmonella enterica subsp. enterica serovar Typhimurium strain 81741 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
311. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024151 (Escherichia coli strain 14EC033 plasmid p14EC033d, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
312. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023733 (Escherichia coli strain FORC 064 plasmid pFORC64.2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
313. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_025141 (Escherichia coli plasmid pH1038-142, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
314. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024840 (Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
315. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026403 (Escherichia coli strain ECONIH4 plasmid pECO-816c, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
316. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027308 (Escherichia coli strain 2015C-3108 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
317. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP043745 (Escherichia coli strain CVM N16EC0879 plasmid pN16EC0879-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
318. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP050997 (Escherichia coli O39:NM str. F8704-2 plasmid pF8704-2_1) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
319. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP054458 (Escherichia coli strain SCU-103 plasmid pSCU-103-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
320. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047194 (Klebsiella pneumoniae strain Kp36 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
321. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015388 (Klebsiella pneumoniae strain NY9 plasmid pNY9_3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
322. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KJ201887 (Shigella flexneri 4c strain 072 plasmid pSF07201, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
323. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX008967 (Shigella sonnei strain 183660 plasmid p183660, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
324. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_019037 (Escherichia coli plasmid pChi7122-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
325. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to LC163971 (Escherichia coli O145:NM str. 12E70 plasmid pSTEC-O145-12E70-1 DNA, complete sequence, strain: 12E70) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
326. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042943 (Escherichia fergusonii strain ATCC 35471 plasmid pATCC-35471_1) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
327. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010215 (Escherichia coli strain M15 plasmid B, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
328. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013657 (Escherichia coli strain uk_P46212 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
329. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048311 (Escherichia coli strain 32-4 plasmid p32-4_A, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
330. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023895 (Escherichia coli strain FDAARGOS_433 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
331. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017633 (Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
332. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP054455 (Escherichia coli strain SCU-487 plasmid pSCU-487-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
333. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_014382 (Escherichia coli plasmid pEC_B24, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
334. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032810 (Escherichia coli strain ERL04-3476 plasmid pERL04-3476-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
335. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024129 (Escherichia coli strain 14EC001 plasmid p14EC001b, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
336. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027348 (Escherichia coli strain 2013C-4361 plasmid unnamed) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
337. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024238 (Escherichia coli O15:H11 strain 90-9272 plasmid unnamed) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcagggacatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
338. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to KX246267 (Escherichia coli plasmid pHNHN21, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
339. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR130554 (Escherichia coli strain MS14386 isolate MS14386 plasmid 3) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
340. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024430 (Klebsiella pneumoniae strain DA48896 plasmid p48896_1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
341. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_019424 (Escherichia coli plasmid pFOS-HK151325, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
342. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024237 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcagggacatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
343. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050372 (Klebsiella pneumoniae strain 50595 plasmid p50595_ERM, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
344. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050367 (Klebsiella pneumoniae strain 47733 plasmid p47733_NDM_5, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
345. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to KU578032 (Escherichia coli plasmid pCERC4, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
346. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP048300 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
347. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_019057 (Escherichia coli plasmid pHK01, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
348. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_019073 (Escherichia coli plasmid pHN7A8, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
349. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029381 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
350. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041363 (Citrobacter amalonaticus strain 133355-SW-C4-Cam plasmid p133355_SW_C4_Cam-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
351. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023363 (Escherichia coli strain 144 plasmid 134q, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
352. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026141 (Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
353. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026158 (Klebsiella pneumoniae strain F93-2 plasmid pF93-2_1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
354. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LS992193 (Escherichia coli isolate Escherichia coli str. TO217 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
355. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LS992194 (Escherichia coli isolate Escherichia coli str. TO217 plasmid 3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
356. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP049174 (Shigella sonnei strain 19.0820.1561 plasmid p19-0820-1561, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
357. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019028 (Escherichia coli strain Ecol_881 plasmid pEC881_1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
358. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042887 (Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_03, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
359. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043408 (Escherichia coli strain NMBU-W13E19 plasmid pNMBU-W13E19_02, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
360. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012928 (Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_62, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
361. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019001 (Escherichia coli strain Ecol_AZ155 plasmid pECAZ155_KPC, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
362. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023725 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
363. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047407 (Escherichia coli strain MS6193 plasmid pMS6193B, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
364. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040541 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
365. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_002134 (Shigella flexneri 2b plasmid R100 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
366. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026584 (Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
367. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023378 (Escherichia coli strain 127 plasmid p123, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
368. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011417 (Escherichia coli strain CFSAN029787 plasmid pCFSAN029787_01, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
369. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032205 (Escherichia coli strain AR_0013 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
370. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035722 (Escherichia coli strain U15A plasmid pU15A_B, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
371. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024268 (Escherichia coli O6:H16 strain F6699 plasmid unnamed2) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcagggacatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
372. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP049186 (Shigella sonnei strain 19.0821.3486 plasmid p19-0821-3486, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
373. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LS992191 (Escherichia coli isolate Escherichia coli str. TO148 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
374. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021880 (Escherichia coli strain AR_0137 plasmid tig00001069_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
375. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028434 (Escherichia coli strain RM9975 plasmid pRM9975-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
376. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030283 (Escherichia coli strain E308 plasmid pLKSZ02, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
377. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032836 (Klebsiella pneumoniae strain INF237 plasmid pINF237_03, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
378. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MN822125 (Escherichia coli strain 14E509 plasmid p14E509-2FII, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
379. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP048302 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
380. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053282 (Escherichia coli strain SCU-308 plasmid pSCU-308-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
381. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_HG941719 (Escherichia coli O25b:H4-ST131 strain EC958 plasmid pEC958, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
382. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_009133 (Escherichia coli plasmid NR1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
383. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028582 (Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
384. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025708 (Escherichia coli strain YDC107 plasmid pYDC107_184, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
385. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026576 (Escherichia coli strain WCHEC005237 plasmid pCTX-M-55_005237, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
386. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010239 (Escherichia coli strain S50 plasmid A, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
387. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP036366 (Klebsiella pneumoniae strain WCHKP115068 plasmid pCTXM65_115068, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
388. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP036367 (Klebsiella pneumoniae strain WCHKP115068 plasmid pKPC12_115068, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
389. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MN865122 (Escherichia coli strain SCNJ06 plasmid prmtB_SCNJ06, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
390. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MN842295 (Klebsiella pneumoniae strain 08291 plasmid pW08291-KPC, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
391. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027345 (Escherichia coli strain 2014C-3946 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
392. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP049172 (Shigella sonnei strain 0401930105 plasmid p0401930105) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
393. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP025574 (Escherichia coli strain E-1246 plasmid pE1246_1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
394. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021711 (Klebsiella pneumoniae strain AR_0143 plasmid tig00000856, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
395. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047660 (Escherichia coli strain LD39-1 plasmid pLD39-1-134kb, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
396. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MF353155 (Escherichia coli plasmid pLZ135-CTX, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
397. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MF353156 (Escherichia coli plasmid pLZ135-NDM, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
398. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP049170 (Shigella sonnei strain 19.1125.3493 plasmid p19-1125-3493, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
399. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043949 (Escherichia coli strain AR202.2 plasmid pMPCMY-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
400. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050710 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
401. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012197 (Escherichia coli strain ECwhn14 plasmid pECwhn14, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
402. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025139 (Escherichia coli strain BH100L substr. MG2017 plasmid pBH100alpha, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
403. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP049168 (Shigella sonnei strain 09163633 plasmid p09163633, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
404. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP019763 (Escherichia coli O111:H- strain 110512 plasmid pO111-110512_2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
405. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to AP023220 (Escherichia coli M505 plasmid pM505-NDM5 DNA, complete genome) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
406. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to AP023228 (Escherichia coli YJ3 plasmid pYJ3-a DNA, complete genome) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
407. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to AP023231 (Escherichia coli YJ4 plasmid pYJ4-NDM5 DNA, complete genome) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
408. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to AP023236 (Escherichia coli YJ6 plasmid pYJ6-NDM5 DNA, complete genome) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
409. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_013727 (Shigella sonnei plasmid pEG356 complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
410. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_019090 (Escherichia coli plasmid pHK23a, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
411. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014112 (Escherichia coli strain FDAARGOS_144 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
412. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021938 (Escherichia coli strain AR_0055 plasmid unitig_4, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
413. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050724 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
414. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP049166 (Shigella sonnei strain 0401952027 plasmid p0401952027, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
415. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_011603 (Escherichia coli O127:H6 str. E2348/69 plasmid pMAR2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
416. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047613 (Escherichia coli strain NMBU_ W06E18 plasmid pNMBU_W06E18_Str1_4, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
417. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010184 (Escherichia coli strain M3 plasmid A, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
418. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027703 (Escherichia coli strain 675SK2 plasmid p675SK2_B, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
419. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to AP022353 (Escherichia coli E308 plasmid pE308_IMP6 DNA, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
420. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029974 (Escherichia coli strain 51008369SK1 plasmid p51008369SK1_A, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
421. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049202 (Escherichia coli strain PapRG-04-4 plasmid pIncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
422. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050751 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST46 plasmid pST46-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
423. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050735 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
424. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028322 (Escherichia coli O18:H1 strain CFSAN067215 plasmid p0.1229_2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
425. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018800 (Escherichia coli strain E2855 plasmid pE2855-4, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
426. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_013366 (Escherichia coli O111:H- str. 11128 plasmid pO111_3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
427. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034056 (Klebsiella pneumoniae strain KP_NORM_BLD_2015_112126 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
428. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
429. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014489 (Escherichia coli strain G749 plasmid pG749_1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
430. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050732 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST101 plasmid pST101-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
431. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050754 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST45 plasmid pST45-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
432. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043229 (Escherichia coli strain Ec-050 plasmid pEc-050-CMY-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
433. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_011812 (Escherichia coli plasmid pO26-L, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
434. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_010558 (Escherichia coli plasmid pIP1206, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
435. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040885 (Escherichia coli strain K71-77 plasmid pK71-77-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
436. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043945 (Escherichia coli strain AR216.2b plasmid pMPCMY-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
437. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034048 (Klebsiella pneumoniae strain KP_NORM_BLD_2014_104014 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
438. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050770 (Salmonella enterica subsp. enterica serovar Indiana strain SI108 plasmid pSI108-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
439. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020340 (Shigella flexneri 4c strain 0702 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
440. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_014615 (Escherichia coli plasmid pETN48, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
441. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP027485 (Escherichia coli strain 2013C-4390 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
442. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033847 (Escherichia coli strain FDAARGOS_497 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
443. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025253 (Escherichia coli strain BH100 substr. MG2017 plasmid pBH100-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
444. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018136 (Escherichia coli strain M105 isolate M105 plasmid pM105_FII, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
445. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018138 (Escherichia coli strain M107 isolate M107 plasmid pM107_FII, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
446. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018144 (Escherichia coli strain M214 isolate M214 plasmid pM214_FII, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
447. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018139 (Escherichia coli strain M109 isolate M109 plasmid pM109_FII, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
448. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP052261 (Klebsiella pneumoniae strain E16KP0290 plasmid pE16KP0290-3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
449. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023942 (Klebsiella pneumoniae strain FDAARGOS_444 plasmid unnamed2) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
450. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021733 (Escherichia coli strain AR_0114 plasmid unitig_1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
451. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019910 (Escherichia coli strain MDR_56 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
452. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MK295834 (Escherichia coli O25b:H4-ST131 strain 56 plasmid p56, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
453. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026940 (Escherichia coli strain CFS3313 plasmid pCFS3313-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
454. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026930 (Escherichia coli strain CFS3246 plasmid pCFS3246-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
455. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050713 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
456. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050727 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST113 plasmid pST-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
457. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018990 (Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
458. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042245 (Escherichia coli strain PU-1 plasmid pColV-PU1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
459. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041439 (Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
460. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045953 (Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00008979 plasmid pAUSMDU00008979_01, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
461. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018643 (Salmonella enterica subsp. enterica serovar Enteritidis strain 74-1357 plasmid pSE74-1357, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
462. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025254 (Escherichia coli strain BH100L substr. MG2014 plasmid pBH100alpha, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
463. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT985265 (Escherichia coli strain 364 plasmid RCS57TR364_p, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
464. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT985304 (Escherichia coli strain ECOR 31 plasmid RCS89_p, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
465. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT985214 (Escherichia coli strain 649 plasmid RCS101_p, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
466. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT985274 (Escherichia coli strain 723 plasmid RCS66_p, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
467. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT985267 (Escherichia coli strain 637 plasmid RCS61_p, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
468. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT985272 (Escherichia coli strain 506 plasmid RCS62_pI, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
469. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT985277 (Escherichia coli strain 522 plasmid RCS65_p, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
470. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031655 (Escherichia coli strain UK_Dog_Liverpool plasmid pCARB35_02, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
471. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK461929 (Escherichia coli strain 2009_36 plasmid p2009_36_F, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
472. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK419152 (Escherichia coli strain D72C plasmid pD72C, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
473. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK492688 (Escherichia coli strain M63c plasmid pMB2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
474. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK461928 (Escherichia coli strain F2_14D plasmid pF2_14D_F, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
475. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK878893 (Escherichia coli strain J53 plasmid pMG335, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
476. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK878891 (Escherichia coli strain J53 plasmid pMG336, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
477. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MN101852 (Escherichia coli strain 13ZX28-TC-98 plasmid p13ZX28-TC-98, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
478. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MN101857 (Escherichia coli strain 2019XSD11 plasmid p2019XSD11-92, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
479. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MN101858 (Escherichia coli strain 2019XSD11-TC2 plasmid p2019XSD11-TC2-284, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
480. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MN101854 (Escherichia coli strain 13ZX36 plasmid p13ZX36-70, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
481. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MN101850 (Escherichia coli strain 13ZX28 plasmid p13ZX28-272, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
482. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MN702385 (Escherichia coli strain LWY24J plasmid pLWY24J-3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
483. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK673546 (Salmonella enterica subsp. enterica serovar Typhimurium strain GDD27-24 plasmid pGDD27-24, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
484. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK778454 (Salmonella enterica strain W043 plasmid pYUW043, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
485. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MN328348 (Salmonella enterica subsp. enterica serovar Enteritidis strain S14 plasmid pTS14, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
486. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_005327 (Escherichia coli plasmid pC15-1a, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
487. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053082 (Escherichia coli strain HB37 plasmid pHB37-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
488. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH316135 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-16 plasmid pGDD25-16, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
489. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH316136 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-21 plasmid pGDD25-21, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
490. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH255829 (Klebsiella pneumoniae subsp. pneumoniae strain SH9 plasmid pSH9-CTX-TEM, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
491. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH917279 (Klebsiella pneumoniae strain A1706 plasmid pA1706-NDM, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
492. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK079570 (Klebsiella pneumoniae strain BC6-3 plasmid pHNBC6-3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
493. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH909349 (Klebsiella pneumoniae strain A1705 plasmid pA1705-NDM, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
494. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH909349 (Klebsiella pneumoniae strain A1705 plasmid pA1705-NDM, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
495. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH316133 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-3 plasmid pGDD25-3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
496. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH316134 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-5 plasmid pGDD25-5, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
497. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH213345 (Escherichia coli strain EC1188 plasmid pEC1188-NDM16, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
498. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH257956 (Escherichia coli strain 104 plasmid pHXH-4, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
499. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH454107 (Escherichia coli strain 417957 plasmid p417957-CTXM, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
500. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH329656 (Escherichia coli strain 92944 plasmid p92944-CTXM, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
501. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK048477 (Escherichia coli strain U-5227 plasmid pUB_DHA-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
502. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK079574 (Escherichia coli strain TS62CTX plasmid pHNTS62, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
503. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK092064 (Escherichia coli strain 39R861 plasmid 39R861-3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
504. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK036888 (Klebsiella pneumoniae strain 911021 plasmid p911021-KPC, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
505. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MN537908 (Escherichia coli strain E.coli4feg plasmid pIV_IncFII_DHA, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
506. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038858 (Escherichia coli strain PigCaeca_2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
507. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MT090959 (Klebsiella pneumoniae strain KP18-2079 plasmid pKP18-2079_KPC, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
508. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF133495 (Klebsiella pneumoniae strain 675920 plasmid p675920-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
509. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG197492 (Escherichia coli strain GDK4P177 plasmid pHNGD4P177, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
510. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG197488 (Escherichia coli strain 04NHB3 plasmid pHN04NHB3, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
511. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF168404 (Klebsiella pneumoniae strain 20049 plasmid p20049-KPC, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
512. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG197489 (Escherichia coli strain MC02 plasmid pHNMC02, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
513. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG197491 (Escherichia coli strain FKU92 plasmid pHNFKU92, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
514. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG197497 (Escherichia coli strain HNC02 plasmid pHNHNC02, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
515. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF168402 (Klebsiella pneumoniae strain 1068 plasmid p1068-KPC, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
516. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG197496 (Escherichia coli strain AHC33 plasmid pHNAH33, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
517. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG197498 (Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
518. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG197503 (Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
519. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG197495 (Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
520. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG197499 (Escherichia coli strain HZMPC32 plasmid pHNMPC32, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
521. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF156695 (Klebsiella pneumoniae strain 1642 plasmid p1642-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
522. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG014720 (Escherichia coli strain A74 plasmid pA74T, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
523. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF156714 (Escherichia coli strain 15061806 plasmid p61806-dfrA, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
524. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG825370 (Escherichia coli strain 974 plasmid p974-NDM, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
525. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG764548 (Escherichia coli strain 11011 plasmid p11011-fosA, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
526. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG197490 (Escherichia coli strain FKD271 plasmid pHNFKD271, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
527. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG197494 (Escherichia coli strain AHC17 plasmid pHNAH17, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
528. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG197502 (Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
529. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG591701 (Escherichia coli strain EC36 plasmid pEC36-2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
530. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG878866 (Escherichia coli strain Ec19397 plasmid pEc19397-131, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
531. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH195200 (Escherichia coli strain 2009-52 plasmid pSDJ2009-52F, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
532. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to LN897474 (Klebsiella pneumoniae p397Kp plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
533. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to LN897475 (Klebsiella pneumoniae p477Kp plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
534. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018455 (Klebsiella pneumoniae strain SWU01 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
535. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025329 (Escherichia coli strain ExPEC XM plasmid unnamed) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
536. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032226 (Klebsiella pneumoniae strain AR_0046 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
537. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025919 (Escherichia coli strain 120899 plasmid p120899_50, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
538. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MN823991 (Escherichia coli strain 140801063 plasmid p801063-FII, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
539. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LC506716 (Klebsiella pneumoniae strain JUNP053 plasmid pJUNP53, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
540. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY865321 (Escherichia coli strain CH292B plasmid pECB11, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
541. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY865322 (Escherichia coli strain DH286F plasmid pECF12, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
542. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LC506719 (Klebsiella pneumoniae strain JUNP254 plasmid pJUNP254, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
543. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LC506717 (Klebsiella pneumoniae strain JUNP054 plasmid pJUNP054, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
544. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LC506718 (Klebsiella pneumoniae strain JUNP055 plasmid pJUNP055, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
545. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LC506720 (Klebsiella pneumoniae strain JUNP268 plasmid pJUNP268, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
546. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG197500 (Klebsiella pneumoniae strain HZMPC51-2 plasmid pHNMPC51, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
547. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG197501 (Klebsiella pneumoniae strain HZMPC43 plasmid pHNMPC43, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
548. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG288681 (Klebsiella aerogenes strain E20 plasmid pE20-FIIA, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
549. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MF554641 (uncultured bacterium clone AA-104 plasmid pFEMG, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
550. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP043740 (Escherichia coli strain CVM N17EC0320 plasmid pN17EC0320-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
551. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048360 (Escherichia coli strain 53 plasmid p53_A, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
552. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011065 (Escherichia coli str. Sanji plasmid pSJ_82, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
553. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023835 (Escherichia coli strain 4/2-1 plasmid p4_2_1.1, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
554. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023828 (Escherichia coli strain 4/4 plasmid p4_4.2, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
555. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017726 (Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 strain SGSC 2518 isolate SARB61 plasmid pSARB26_03, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
556. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031720 (Klebsiella pneumoniae strain SCKP020003 plasmid pKPC2_020003, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
557. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MT108212 (Klebsiella pneumoniae strain 12478 plasmid p12478-KPC, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
558. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040535 (Klebsiella pneumoniae strain CR-HvKP1 plasmid pCR-HvKP1-KPC, complete sequence) position: , mismatch: 9, identity: 0.719
ctgcttggccagcaggccattattgatcagca CRISPR spacer
catcaggggcatcaggccattattgatcaaag Protospacer
* * ** ** *****************. .
559. spacer 2.37|1018629|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 9, identity: 0.719
acttagctacaatctctttacgcagcttcgtg CRISPR spacer
gcttgcctacaatctctttacgcagaagccga Protospacer
.***. ******************* * .
560. spacer 2.37|1018629|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.719
acttagctacaatctctttacgcagcttcgtg CRISPR spacer
ccagagctacaatctctttccgcacctgacgg Protospacer
* *************** **** ** *
561. spacer 2.37|1018629|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.719
acttagctacaatctctttacgcagcttcgtg CRISPR spacer
ccagagctacaatctctttccgcacctgacgg Protospacer
* *************** **** ** *
562. spacer 2.41|1018873|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041351 (Komagataeibacter xylinus strain CGMCC 17276 plasmid pC, complete sequence) position: , mismatch: 9, identity: 0.719
tagcgtccgtggcttttacgttggccttgcgg CRISPR spacer
tgctgcgcgtggctttgccgttggccttgctt Protospacer
*. .*. ********* ************
563. spacer 2.47|1019239|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022991 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN1, complete sequence) position: , mismatch: 9, identity: 0.719
gcggcagcgcagcaacacgccagtctcggggt CRISPR spacer
gcggctgcgcagcaacaagccagtgcgaccat Protospacer
***** *********** ****** . . .*
564. spacer 2.48|1019300|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
cgggctttggctagggcggcgtctgcgcgctg- CRISPR spacer
accgctttggctggggcggcggctgc-catcgc Protospacer
*********.******** **** *...*
565. spacer 2.49|1019361|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KU356480 (Vibrio parahaemolyticus strain VPS92 plasmid pVPS92-VEB, complete sequence) position: , mismatch: 9, identity: 0.719
cctgttaatcgcataaatcatttctcactctc----- CRISPR spacer
agtgttaatcccataaagcatttct-----tcgggag Protospacer
******** ****** ******* **
566. spacer 2.49|1019361|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053812 (Vibrio cholerae strain W6G plasmid pW6G, complete sequence) position: , mismatch: 9, identity: 0.719
cctgttaatcgcataaatcatttctcactctc----- CRISPR spacer
agtgttaatcccataaagcatttct-----tcgggag Protospacer
******** ****** ******* **
567. spacer 2.49|1019361|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053815 (Vibrio cholerae strain W7G plasmid pW7G, complete sequence) position: , mismatch: 9, identity: 0.719
cctgttaatcgcataaatcatttctcactctc----- CRISPR spacer
agtgttaatcccataaagcatttct-----tcgggag Protospacer
******** ****** ******* **
568. spacer 2.49|1019361|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN831184 (Vibrio cholerae isolate V. cholerae 116-14 plasmid pNDM-116-14, complete sequence) position: , mismatch: 9, identity: 0.719
cctgttaatcgcataaatcatttctcactctc----- CRISPR spacer
agtgttaatcccataaagcatttct-----tcgggag Protospacer
******** ****** ******* **
569. spacer 2.53|1019605|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_HG813238 (Erwinia amylovora strain 692 plasmid pEA68, complete sequence) position: , mismatch: 9, identity: 0.719
tcctgcgtgatgccaaacacgttgagcagttc CRISPR spacer
tcctgcgcgatgccgaacacgttggtggtgtt Protospacer
*******.******.*********. . *.
570. spacer 2.54|1019666|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 9, identity: 0.719
aatatccgtttgcaggtcgcccgcccggcgcg CRISPR spacer
gccggcccgttccaggtcgcccgcgcggcgcg Protospacer
. .. ** ** ************ *******
571. spacer 2.59|1019971|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021811 (Sinorhizobium meliloti strain Rm41 plasmid accessoryA, complete sequence) position: , mismatch: 9, identity: 0.719
cttggtctggctatcgaagtcacggtaaacgt CRISPR spacer
cttggtctggctctcgatgtcaccaatgctgt Protospacer
************ **** ***** . . .**
572. spacer 2.59|1019971|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_018682 (Sinorhizobium meliloti Rm41 plasmid pRM41A, complete sequence) position: , mismatch: 9, identity: 0.719
cttggtctggctatcgaagtcacggtaaacgt CRISPR spacer
cttggtctggctctcgatgtcaccaatgctgt Protospacer
************ **** ***** . . .**
573. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 9, identity: 0.719
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctttcgcgcattctcggcccggtaagctggga Protospacer
*..*************** **** *** .
574. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035512 (Haematobacter massiliensis strain OT1 plasmid pOT1-2, complete sequence) position: , mismatch: 9, identity: 0.719
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
ctttcgcgcattctcggcccggtaagctggga Protospacer
*..*************** **** *** .
575. spacer 2.66|1020399|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MN694419 (Marine virus AFVG_250M478, complete genome) position: , mismatch: 9, identity: 0.719
gtctgggaatagggttatttccttactcatca CRISPR spacer
ttctgggaataaggttattaccttcgcgccca Protospacer
**********.******* **** . .**
576. spacer 2.73|1020826|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026517 (Deinococcus sp. NW-56 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gggaacccccgaccgcggacgagatccgggag CRISPR spacer
gtgcgaaggcgaccgtggccgagatccgggag Protospacer
* * . ******.** *************
577. spacer 2.73|1020826|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_042352 (Salinibacter virus M31CR41-2, partial genome) position: , mismatch: 9, identity: 0.719
gggaacccccgaccgcggacgagatccgggag CRISPR spacer
gactgaacgcgaccgcggacgagatgcaggag Protospacer
*. . * **************** *.****
578. spacer 2.73|1020826|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MF629150 (Salinibacter virus SRUTV-1, partial genome) position: , mismatch: 9, identity: 0.719
gggaacccccgaccgcggacgagatccgggag CRISPR spacer
gactgaacgcgaccgcggacgagatgcaggag Protospacer
*. . * **************** *.****
579. spacer 2.73|1020826|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MF580962 (Salinibacter virus M31CR41-3, partial genome) position: , mismatch: 9, identity: 0.719
gggaacccccgaccgcggacgagatccgggag CRISPR spacer
gactgaacgcgaccgcggacgagatgcaggag Protospacer
*. . * **************** *.****
580. spacer 2.76|1021009|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR130540 (Klebsiella variicola strain AJ055 isolate AJ055 plasmid 2) position: , mismatch: 9, identity: 0.719
acctccctgccagtgctttcgtaaaaagatac CRISPR spacer
aaagccctgccagtcctttcggaaaaatcagc Protospacer
* ********** ****** ***** .*
581. spacer 2.3|1016555|32|CP024811|CRISPRCasFinder,CRT matches to MK883718 (Escherichia phage vB_EcoM-ECP32, complete genome) position: , mismatch: 10, identity: 0.688
cagactcaggtaaaccattcgccctggctcac CRISPR spacer
ttgtaacaggtaaaccattctccatggctgtg Protospacer
. * ************** ** *****
582. spacer 2.4|1016616|32|CP024811|CRISPRCasFinder,CRT matches to MN693898 (Marine virus AFVG_250M937, complete genome) position: , mismatch: 10, identity: 0.688
-ttgcaggtgaagcgcaatatcctgctgaaaac CRISPR spacer
cttatcagcaagat-caatatcctgctgaaaac Protospacer
**.. .*..*... ******************
583. spacer 2.5|1016677|32|CP024811|CRISPRCasFinder,CRT matches to NZ_CP015319 (Mesorhizobium amorphae CCNWGS0123 plasmid pM0123a) position: , mismatch: 10, identity: 0.688
cctttttcgcgcttgtaggccgcccaggcttc CRISPR spacer
tccccgagccgcttgtacgccgcccaggcatc Protospacer
.*... ******** *********** **
584. spacer 2.19|1017531|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039703 (Clostridium butyricum strain 29-1 plasmid p-butyl_plas_29-1, complete sequence) position: , mismatch: 10, identity: 0.688
acaattttcaatttcataaaatggcttccttt CRISPR spacer
acaattttcaatttcattacatgaatatgaac Protospacer
***************** * ***. * . .
585. spacer 2.19|1017531|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688
acaattttcaatttcataaaatggcttccttt CRISPR spacer
ttgcttatcaatttcatacaatggctttgata Protospacer
.. ** *********** ********. *
586. spacer 2.23|1017775|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_013417 (Streptomyces sp. x3 plasmid pTSC2, complete sequence) position: , mismatch: 10, identity: 0.688
tccgcctcgtactcctcccagctctcgtcaat CRISPR spacer
gcagcctcgtactccgcccagcgctccaggcc Protospacer
* ************ ****** *** . .
587. spacer 2.25|1017897|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MK415405 (Phage FAKO05_000032F, complete genome) position: , mismatch: 10, identity: 0.688
gagcgacgcggctctatgttagccgctatctc CRISPR spacer
ggatcctcgggatctatgttagcctctatctc Protospacer
*... . ** ************ *******
588. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 10, identity: 0.688
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
ccagccgcaccgccatcacctatatcgaggcg Protospacer
**************** *** *** ..
589. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 10, identity: 0.688
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
ccagccgcaccgccatcacctatatcgaggcg Protospacer
**************** *** *** ..
590. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 10, identity: 0.688
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
ccagccgcaccgccatcacctatatcgaggcg Protospacer
**************** *** *** ..
591. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027765 (Escherichia coli strain 2015C-3125 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
ctgcttggccagcaggccattattgatcagca CRISPR spacer
ccatcagggcatcaggccattattgatcaaag Protospacer
*.... ** ** *****************. .
592. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025677 (Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence) position: , mismatch: 10, identity: 0.688
ctgcttggccagcaggccattattgatcagca CRISPR spacer
ccatcagggcatcaggccattattgatcaaag Protospacer
*.... ** ** *****************. .
593. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF168403 (Klebsiella pneumoniae strain 12139 plasmid p12139-KPC, complete sequence) position: , mismatch: 10, identity: 0.688
ctgcttggccagcaggccattattgatcagca CRISPR spacer
ccatcagggcatcaggccattattgatcaaag Protospacer
*.... ** ** *****************. .
594. spacer 2.31|1018263|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF168405 (Klebsiella pneumoniae strain 64917 plasmid p64917-KPC, complete sequence) position: , mismatch: 10, identity: 0.688
ctgcttggccagcaggccattattgatcagca CRISPR spacer
ccatcagggcatcaggccattattgatcaaag Protospacer
*.... ** ** *****************. .
595. spacer 2.52|1019544|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019438 (Thioclava nitratireducens strain 25B10_4 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ccattcagcggatgatccgcgcctttcggtgc CRISPR spacer
attttccgaggatgatccgcgccttttgccag Protospacer
. *** * *****************.* ..
596. spacer 2.52|1019544|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019438 (Thioclava nitratireducens strain 25B10_4 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
ccattcagcggatgatccgcgcctttcggtgc CRISPR spacer
attttccgaggatgatccgcgccttttgccag Protospacer
. *** * *****************.* ..
597. spacer 2.54|1019666|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 10, identity: 0.688
aatatccgtttgcaggtcgcccgcccggcgcg CRISPR spacer
atggagcgttttcaggtcggccgcccggccat Protospacer
* . ***** ******* *********
598. spacer 2.54|1019666|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 10, identity: 0.688
aatatccgtttgcaggtcgcccgcccggcgcg CRISPR spacer
atggagcgttttcaggtcggccgcccggccat Protospacer
* . ***** ******* *********
599. spacer 2.54|1019666|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 10, identity: 0.688
aatatccgtttgcaggtcgcccgcccggcgcg CRISPR spacer
atggagcgttttcaggtcggccgcccggccat Protospacer
* . ***** ******* *********
600. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 10, identity: 0.688
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
cagcaacgcgttctcggcgcggtccgcataga Protospacer
* . .***.************** **** .
601. spacer 2.65|1020338|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049914 (Vibrio sp. HDW18 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
tgattgagtttcacatcattcagcacggcaag CRISPR spacer
ccattgagctgcacatcattcagcaattgatt Protospacer
. ******.* ************** *
602. spacer 2.69|1020582|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MH518298 (Pseudomonas phage SCYZ1, complete genome) position: , mismatch: 10, identity: 0.688
atctactctggccccgttatgattagcggggg CRISPR spacer
gcctactctggcgcctttatgattaccacctc Protospacer
..********** ** ********* *.
603. spacer 2.77|1021070|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016489 (Synechococcus sp. PCC 8807 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.688
tcagtaatcaagtcctcaatgatctcgatgcg CRISPR spacer
cggctaatcaagttctcaatgatctcgcgaaa Protospacer
. . *********.************* . .
604. spacer 2.12|1017104|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038639 (Cupriavidus oxalaticus strain X32 plasmid unnamed4, complete sequence) position: , mismatch: 11, identity: 0.656
aagattaagcgggcaggcaaggaagtcgatta CRISPR spacer
cgccagtagcgggctggcaagggagtcgatgg Protospacer
. ******* *******.******* .
605. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_022126 (Staphylococcus aureus subsp. aureus 55/2053 plasmid, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
606. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KJ756353 (Staphylococcus aureus strain SM39 plasmid pSM39, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
607. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007658 (Staphylococcus aureus strain V2200 plasmid pV2200, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
608. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026081 (Staphylococcus aureus strain FDAARGOS_12 plasmid unnamed) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
609. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054833 (Staphylococcus saprophyticus strain UTI-045 plasmid pUTI-045-2, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
610. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013958 (Staphylococcus aureus strain V521 isolate Sequencing plasmid pV521, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
611. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026075 (Staphylococcus aureus strain FDAARGOS_47 plasmid unnamed) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
612. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_013337 (Staphylococcus aureus plasmid SAP064A, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
613. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR027879 (Staphylococcus aureus strain BPH2003 isolate BPH2003 plasmid 2) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
614. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017683 (Staphylococcus aureus strain CFSAN007850 plasmid pCFSAN007850, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
615. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_013319 (Staphylococcus aureus plasmid pI258, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
616. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_013323 (Staphylococcus aureus plasmid pCM05, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
617. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_013347 (Staphylococcus aureus plasmid pSK62, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
618. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_013352 (Staphylococcus aureus plasmid pSK76, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
619. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR130516 (Staphylococcus aureus strain BPH2947 isolate BPH2947 plasmid 2) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
620. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_017352 (Staphylococcus aureus subsp. aureus TW20 plasmid pTW20_1, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
621. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_022610 (Staphylococcus aureus subsp. aureus Z172 plasmid pZ172_1, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
622. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_018968 (Staphylococcus aureus plasmid p18809-P04, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
623. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MK992500 (Staphylococcus aureus strain 5Sau489 plasmid p5Sau489, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
624. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_020530 (Staphylococcus aureus subsp. aureus ST228 plasmid pI1T1, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
625. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_020567 (Staphylococcus aureus subsp. aureus ST228 plasmid pI6T6, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
626. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to MK992499 (Staphylococcus aureus strain 17Sau58 plasmid p17Sau58, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
627. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_020565 (Staphylococcus aureus subsp. aureus ST228 plasmid pI3T3, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
628. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_020534 (Staphylococcus aureus subsp. aureus ST228 plasmid pI4T8, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
629. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041009 (Staphylococcus aureus strain FDAARGOS_766 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
630. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_013377 (Staphylococcus epidermidis plasmid SAP105A, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
631. spacer 2.29|1018141|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH470063 (Staphylococcus aureus strain CMRSA3 plasmid pCMRSA3, complete sequence) position: , mismatch: 11, identity: 0.656
ccagccgcaccgccataaccaataatatctgc CRISPR spacer
aacgccgcaccgccggaaccaataatcagaag Protospacer
***********. ********** .
632. spacer 2.63|1020216|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 11, identity: 0.656
ccctcgcgcattctcggcgcggtcagcatttg CRISPR spacer
tagatgcccattcccggcgcggtcagcaaacc Protospacer
. .** *****.************** .
633. spacer 2.77|1021070|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to NC_010474 (Synechococcus sp. PCC 7002 plasmid pAQ7, complete sequence) position: , mismatch: 11, identity: 0.656
tcagtaatcaagtcctcaatgatctcgatgcg CRISPR spacer
cggctaatcaagttcttaatgatctcgcgaaa Protospacer
. . *********.**.********** . .
634. spacer 2.78|1021131|32|CP024811|CRISPRCasFinder,CRT,PILER-CR matches to CP047390 (Agrobacterium sp. CGMCC 11546 plasmid pB) position: , mismatch: 11, identity: 0.656
catatctggtaacgaatagcggcggcgctggt CRISPR spacer
ggcatctggtgacgaatggcggcggccagacc Protospacer
..*******.******.******** . .