Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP023486 Vibrio parahaemolyticus strain FORC_071 chromosome 2, complete sequence 2 crisprs DEDDh,WYL,csa3,cas3,cas5f,cas7f,cas6f 0 1 0 0
CP023485 Vibrio parahaemolyticus strain FORC_071 chromosome 1, complete sequence 0 crisprs cas3,DinG,csa3,csx1,DEDDh 0 0 3 0

Results visualization

1. CP023486
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023486_1 67592-67689 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023486_2 1443438-1443584 Unclear NA
2 spacers
cas6f,cas7f,cas5f

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP023486_2 2.1|1443466|32|CP023486|CRISPRCasFinder 1443466-1443497 32 NZ_CP017904 Vibrio alginolyticus strain K05K4 plasmid pL289, complete sequence 201007-201038 2 0.938
CP023486_2 2.1|1443466|32|CP023486|CRISPRCasFinder 1443466-1443497 32 NZ_CP017901 Vibrio alginolyticus strain K04M5 plasmid pL294, complete sequence 206663-206694 2 0.938
CP023486_2 2.1|1443466|32|CP023486|CRISPRCasFinder 1443466-1443497 32 NZ_CP017909 Vibrio alginolyticus strain K06K5 plasmid pL291, complete sequence 203227-203258 2 0.938
CP023486_2 2.1|1443466|32|CP023486|CRISPRCasFinder 1443466-1443497 32 NZ_CP017893 Vibrio alginolyticus strain K04M1 plasmid pL280, complete sequence 184601-184632 2 0.938
CP023486_2 2.1|1443466|32|CP023486|CRISPRCasFinder 1443466-1443497 32 NZ_CP017898 Vibrio alginolyticus isolate K04M3 plasmid pL294, complete sequence 206028-206059 2 0.938

1. spacer 2.1|1443466|32|CP023486|CRISPRCasFinder matches to NZ_CP017904 (Vibrio alginolyticus strain K05K4 plasmid pL289, complete sequence) position: , mismatch: 2, identity: 0.938

gagataccacaggctcaagcagatgctaacag	CRISPR spacer
cggataccacaggctcaagcagatgctaacag	Protospacer
 .******************************

2. spacer 2.1|1443466|32|CP023486|CRISPRCasFinder matches to NZ_CP017901 (Vibrio alginolyticus strain K04M5 plasmid pL294, complete sequence) position: , mismatch: 2, identity: 0.938

gagataccacaggctcaagcagatgctaacag	CRISPR spacer
cggataccacaggctcaagcagatgctaacag	Protospacer
 .******************************

3. spacer 2.1|1443466|32|CP023486|CRISPRCasFinder matches to NZ_CP017909 (Vibrio alginolyticus strain K06K5 plasmid pL291, complete sequence) position: , mismatch: 2, identity: 0.938

gagataccacaggctcaagcagatgctaacag	CRISPR spacer
cggataccacaggctcaagcagatgctaacag	Protospacer
 .******************************

4. spacer 2.1|1443466|32|CP023486|CRISPRCasFinder matches to NZ_CP017893 (Vibrio alginolyticus strain K04M1 plasmid pL280, complete sequence) position: , mismatch: 2, identity: 0.938

gagataccacaggctcaagcagatgctaacag	CRISPR spacer
cggataccacaggctcaagcagatgctaacag	Protospacer
 .******************************

5. spacer 2.1|1443466|32|CP023486|CRISPRCasFinder matches to NZ_CP017898 (Vibrio alginolyticus isolate K04M3 plasmid pL294, complete sequence) position: , mismatch: 2, identity: 0.938

gagataccacaggctcaagcagatgctaacag	CRISPR spacer
cggataccacaggctcaagcagatgctaacag	Protospacer
 .******************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP023485
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 678278 : 684980 7 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_2 1425747 : 1436521 16 Vibrio_phage(44.44%) NA NA
DBSCAN-SWA_3 2709813 : 2726993 15 uncultured_Mediterranean_phage(18.18%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage