Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP023492 Lactobacillus plantarum strain NCIMB 700965 plasmid unamed2, complete sequence 0 crisprs NA 0 0 0 0
CP023493 Lactobacillus plantarum strain NCIMB 700965 plasmid unamed3, complete sequence 0 crisprs NA 0 0 0 0
CP023491 Lactobacillus plantarum strain NCIMB 700965 plasmid unamed1, complete sequence 0 crisprs csa3 0 0 1 0
CP023495 Lactobacillus plantarum strain NCIMB 700965 plasmid unamed5, complete sequence 0 crisprs NA 0 0 0 0
CP023494 Lactobacillus plantarum strain NCIMB 700965 plasmid unamed4, complete sequence 1 crisprs NA 0 1 0 0
CP023490 Lactobacillus plantarum strain NCIMB 700965 chromosome, complete genome 0 crisprs DEDDh,cas3,csa3,WYL,DinG 0 0 14 0

Results visualization

1. CP023494
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023494_1 19655-19764 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP023494_1 1.1|19689|42|CP023494|CRISPRCasFinder 19689-19730 42 NZ_CP026508 Lactobacillus plantarum strain NCIMB700965.EF.A plasmid punamed3, complete sequence 5601-5642 0 1.0
CP023494_1 1.1|19689|42|CP023494|CRISPRCasFinder 19689-19730 42 NZ_CP023494 Lactobacillus plantarum strain NCIMB 700965 plasmid unamed4, complete sequence 19689-19730 0 1.0

1. spacer 1.1|19689|42|CP023494|CRISPRCasFinder matches to NZ_CP026508 (Lactobacillus plantarum strain NCIMB700965.EF.A plasmid punamed3, complete sequence) position: , mismatch: 0, identity: 1.0

atagtctagttggttgaataaccttagacaacctgatgaaat	CRISPR spacer
atagtctagttggttgaataaccttagacaacctgatgaaat	Protospacer
******************************************

2. spacer 1.1|19689|42|CP023494|CRISPRCasFinder matches to NZ_CP023494 (Lactobacillus plantarum strain NCIMB 700965 plasmid unamed4, complete sequence) position: , mismatch: 0, identity: 1.0

atagtctagttggttgaataaccttagacaacctgatgaaat	CRISPR spacer
atagtctagttggttgaataaccttagacaacctgatgaaat	Protospacer
******************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP023490
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 37871 : 98354 56 unidentified_phage(12.5%) transposase NA
DBSCAN-SWA_2 250664 : 348402 102 Lactobacillus_phage(66.0%) tail,capsid,tRNA,portal,integrase,terminase,transposase,holin,protease,head attL 293575:293592|attR 355335:355352
DBSCAN-SWA_3 639324 : 702688 80 Lactobacillus_phage(41.03%) tail,capsid,portal,integrase,terminase,transposase,holin,head attL 687731:687752|attR 701971:701992
DBSCAN-SWA_4 898291 : 906805 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 1038083 : 1078708 40 Bacillus_phage(37.5%) transposase,protease NA
DBSCAN-SWA_6 1174731 : 1240464 54 unidentified_phage(25.0%) transposase NA
DBSCAN-SWA_7 1286772 : 1342238 49 Erysipelothrix_phage(18.18%) tRNA,holin,bacteriocin,transposase NA
DBSCAN-SWA_8 1432139 : 1493664 58 unidentified_phage(10.0%) transposase NA
DBSCAN-SWA_9 1832521 : 1889813 57 unidentified_phage(30.0%) transposase,protease NA
DBSCAN-SWA_10 1906462 : 1940498 31 Bacillus_phage(25.0%) tRNA,transposase,bacteriocin,protease NA
DBSCAN-SWA_11 2109620 : 2118233 11 Streptococcus_phage(66.67%) NA NA
DBSCAN-SWA_12 2198216 : 2248957 43 Staphylococcus_phage(16.67%) tRNA,transposase,protease NA
DBSCAN-SWA_13 2315053 : 2370239 39 unidentified_phage(40.0%) transposase,protease NA
DBSCAN-SWA_14 2511430 : 2572894 50 Bacillus_phage(23.53%) tRNA,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP023491
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 19546 : 54955 31 Streptococcus_phage(20.0%) transposase,holin,protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage