Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP028886 Borrelia turcica IST7 plasmid lp32-A, complete sequence 0 crisprs NA 0 0 0 0
CP028889 Borrelia turcica IST7 plasmid lp35, complete sequence 1 crisprs NA 0 1 0 0
CP028891 Borrelia turcica IST7 plasmid lp27, complete sequence 0 crisprs NA 0 0 0 0
CP028885 Borrelia turcica IST7 plasmid lp129, complete sequence 0 crisprs NA 0 0 0 0
CP028887 Borrelia turcica IST7 plasmid lp32-B, complete sequence 0 crisprs NA 0 0 0 0
CP028884 Borrelia turcica IST7 chromosome, complete genome 0 crisprs NA 0 0 1 0
CP028888 Borrelia turcica IST7 plasmid cp33, complete sequence 0 crisprs NA 0 0 0 0
CP028890 Borrelia turcica IST7 plasmid lp34, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP028884
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 464727 : 473217 8 Streptococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP028889
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028889_1 28789-28918 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP028889_1 1.1|28828|52|CP028889|CRISPRCasFinder 28828-28879 52 NZ_CP028889 Borrelia turcica IST7 plasmid lp35, complete sequence 28828-28879 0 1.0

1. spacer 1.1|28828|52|CP028889|CRISPRCasFinder matches to NZ_CP028889 (Borrelia turcica IST7 plasmid lp35, complete sequence) position: , mismatch: 0, identity: 1.0

gaaaagatatagtctgctagttctttgtccgtactcttactaccaacaatag	CRISPR spacer
gaaaagatatagtctgctagttctttgtccgtactcttactaccaacaatag	Protospacer
****************************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage