Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP032446 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 chromosome, complete genome 2 crisprs PD-DExK,WYL,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3,cas3,DEDDh,DinG 0 1 12 0
CP032448 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU2-USMARC-69840, complete sequence 0 crisprs DEDDh 0 0 1 0
CP032447 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU1-USMARC-69840, complete sequence 0 crisprs cas14j 0 0 0 0

Results visualization

1. CP032446
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032446_1 974714-974984 TypeI-E I-E
4 spacers
cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032446_2 991144-991292 TypeI-E I-E
2 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP032446_1 1.2|974804|32|CP032446|PILER-CR 974804-974835 32 MG592432 Vibrio phage 1.050.O._10N.286.48.A6, partial genome 21687-21718 8 0.75
CP032446_1 1.2|974804|32|CP032446|PILER-CR 974804-974835 32 MG592431 Vibrio phage 1.049.O._10N.286.54.B5, partial genome 21426-21457 8 0.75
CP032446_1 1.2|974804|32|CP032446|PILER-CR 974804-974835 32 NC_047790 Pseudoalteromonas phage C5a, complete genome 34441-34472 9 0.719

1. spacer 1.2|974804|32|CP032446|PILER-CR matches to MG592432 (Vibrio phage 1.050.O._10N.286.48.A6, partial genome) position: , mismatch: 8, identity: 0.75

ctgccggtctgtgctgttgtcgtcaataatca	CRISPR spacer
aatctgctctgtgctgttgtagtcaattataa	Protospacer
   *.* ************* ****** ** *

2. spacer 1.2|974804|32|CP032446|PILER-CR matches to MG592431 (Vibrio phage 1.049.O._10N.286.54.B5, partial genome) position: , mismatch: 8, identity: 0.75

ctgccggtctgtgctgttgtcgtcaataatca	CRISPR spacer
aatctgctctgtgctgttgtagtcaattataa	Protospacer
   *.* ************* ****** ** *

3. spacer 1.2|974804|32|CP032446|PILER-CR matches to NC_047790 (Pseudoalteromonas phage C5a, complete genome) position: , mismatch: 9, identity: 0.719

ctgccggtctgtgctgttgtcgtcaataatca	CRISPR spacer
tttggtgtctgtgccgttttcgtcaataagct	Protospacer
.*    ********.*** ********** * 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1152432 : 1245952 83 Salmonella_phage(75.56%) plate,transposase,tail,capsid,tRNA,head,integrase,portal,lysis attL 1155469:1155484|attR 1168736:1168751
DBSCAN-SWA_2 1481307 : 1487346 6 Salmonella_virus(50.0%) NA NA
DBSCAN-SWA_3 1723551 : 1732722 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_4 1799918 : 1810425 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_5 1923352 : 1969563 64 Salmonella_phage(84.91%) plate,tail,transposase,capsid,head,terminase,holin,integrase attL 1921324:1921338|attR 1941644:1941658
DBSCAN-SWA_6 2661752 : 2718657 58 Moraxella_phage(16.67%) protease,tail,integrase,tRNA attL 2691535:2691550|attR 2717139:2717154
DBSCAN-SWA_7 2723022 : 2760283 45 Enterobacteria_phage(26.47%) tail,protease,integrase,holin,portal,lysis attL 2712514:2712573|attR 2760284:2760448
DBSCAN-SWA_8 2862381 : 2872089 12 Burkholderia_phage(28.57%) NA NA
DBSCAN-SWA_9 2957007 : 3000970 44 Escherichia_phage(33.33%) protease,tail NA
DBSCAN-SWA_10 3007911 : 3033545 32 Salmonella_phage(72.41%) holin,terminase NA
DBSCAN-SWA_11 3104513 : 3111826 7 Ralstonia_phage(16.67%) protease,integrase attL 3099569:3099583|attR 3110562:3110576
DBSCAN-SWA_12 3449284 : 3494921 68 Salmonella_phage(71.64%) coat,tail,protease,integrase,terminase,holin,portal,lysis attL 3448951:3448991|attR 3494939:3494979
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP032448
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 18834 : 56296 42 Escherichia_phage(25.0%) integrase,transposase attL 6522:6541|attR 46060:46079
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage