Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
AP018677 Vibrio cholerae V060002 DNA, complete genome 1 crisprs cas3,RT,DEDDh,DinG,csx1,csa3,WYL 0 1 5 0

Results visualization

1. AP018677
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018677_1 3686908-3687151 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
AP018677_1 1.1|3686957|37|AP018677|PILER-CR 3686957-3686993 37 NC_049942 Escherichia phage JLK-2012, complete sequence 23524-23560 4 0.892
AP018677_1 1.1|3686957|37|AP018677|PILER-CR 3686957-3686993 37 NC_021742 Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence 35428-35464 4 0.892

1. spacer 1.1|3686957|37|AP018677|PILER-CR matches to NC_049942 (Escherichia phage JLK-2012, complete sequence) position: , mismatch: 4, identity: 0.892

taggtcgccagttcgattccggcagccggcaccactt	CRISPR spacer
caggtcgccagttcgattccggtagccggcaccatat	Protospacer
.*********************.***********. *

2. spacer 1.1|3686957|37|AP018677|PILER-CR matches to NC_021742 (Serratia liquefaciens ATCC 27592 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.892

taggtcgccagttcgattccggcagccggcaccactt	CRISPR spacer
taggtcaccagttcgattccggtagccggcaccaatc	Protospacer
******.***************.*********** *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 705377 : 711994 7 Staphylococcus_phage(66.67%) NA NA
DBSCAN-SWA_2 1425156 : 1438522 20 Vibrio_phage(88.89%) NA NA
DBSCAN-SWA_3 3359954 : 3367147 9 Anguillid_herpesvirus(16.67%) NA NA
DBSCAN-SWA_4 3598776 : 3606000 6 uncultured_Mediterranean_phage(33.33%) NA NA
DBSCAN-SWA_5 3631654 : 3637958 7 Vibrio_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage