Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP024778 Bacillus thuringiensis LM1212 plasmid pLM5, complete sequence 0 crisprs NA 0 0 0 0
CP024772 Bacillus thuringiensis LM1212 plasmid pLM1, complete sequence 0 crisprs WYL,csa3 0 0 13 0
CP024775 Bacillus thuringiensis LM1212 plasmid pLM4, complete sequence 0 crisprs NA 0 0 1 0
CP024779 Bacillus thuringiensis LM1212 plasmid pLM7, complete sequence 0 crisprs NA 0 0 0 0
CP024774 Bacillus thuringiensis LM1212 plasmid pLM3, complete sequence 0 crisprs csa3 0 0 1 0
CP024776 Bacillus thuringiensis LM1212 plasmid pLM8, complete sequence 0 crisprs NA 0 0 0 0
CP024771 Bacillus thuringiensis LM1212 chromosome, complete genome 2 crisprs cas3,csa3,cas14k,DEDDh,c2c9_V-U4,WYL,RT,cas14j,DinG 1 0 13 0
CP024777 Bacillus thuringiensis LM1212 plasmid pLM6, complete sequence 0 crisprs NA 0 0 0 0
CP024773 Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence 0 crisprs csa3,cas14j,RT 0 0 2 0

Results visualization

1. CP024774
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4435 : 52639 35 Streptococcus_phage(57.14%) transposase,integrase attL 3718:3731|attR 55332:55345
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP024772
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 1940 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_2 5403 : 92056 55 Streptococcus_phage(64.0%) transposase NA
DBSCAN-SWA_3 95306 : 95894 1 Bacillus_phage(100.0%) NA NA
DBSCAN-SWA_4 102738 : 167873 57 Streptococcus_phage(53.33%) bacteriocin,integrase,transposase attL 91255:91314|attR 118492:119344
DBSCAN-SWA_5 170921 : 171959 1 Lactococcus_phage(100.0%) NA NA
DBSCAN-SWA_6 181751 : 182468 1 Streptococcus_phage(100.0%) transposase NA
DBSCAN-SWA_7 191098 : 191806 1 Streptococcus_phage(100.0%) transposase NA
DBSCAN-SWA_8 202570 : 203278 1 Streptococcus_phage(100.0%) transposase NA
DBSCAN-SWA_9 208303 : 209533 1 Streptococcus_phage(100.0%) transposase NA
DBSCAN-SWA_10 215135 : 223342 7 Streptococcus_phage(60.0%) transposase NA
DBSCAN-SWA_11 232029 : 235915 3 Streptococcus_phage(100.0%) transposase NA
DBSCAN-SWA_12 239404 : 241480 3 uncultured_Caudovirales_phage(66.67%) holin,transposase NA
DBSCAN-SWA_13 245915 : 246788 1 Aeromonas_phage(100.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP024773
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3049 : 60196 50 Bacillus_phage(41.18%) transposase NA
DBSCAN-SWA_2 68963 : 132849 51 Bacillus_phage(40.0%) transposase,integrase attL 67792:67851|attR 112122:113835
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. CP024771
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024771_3 4123389-4123544 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024771_4 5244110-5244213 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP024771_4 4.1|5244136|52|CP024771|CRISPRCasFinder 5244136-5244187 52 CP024771.1 5246070-5246121 1 0.981

1. spacer 4.1|5244136|52|CP024771|CRISPRCasFinder matches to position: 5246070-5246121, mismatch: 1, identity: 0.981

ggtatatttacatgtcccgaagtagccgtggattgtctcctttccttccttg	CRISPR spacer
ggtatatttacatgtcccgaagcagccgtggattgtctcctttccttccttg	Protospacer
**********************.*****************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 34562 : 105500 92 Bacillus_phage(79.63%) tail,portal,protease,integrase,capsid,tRNA,head,transposase,terminase attL 26751:26767|attR 99975:99991
DBSCAN-SWA_2 656001 : 663680 10 Staphylococcus_phage(16.67%) NA NA
DBSCAN-SWA_3 1031678 : 1109953 86 Bacillus_phage(44.68%) tail,portal,protease,integrase,coat,capsid,tRNA,holin,head,transposase,terminase attL 1053480:1053497|attR 1113523:1113540
DBSCAN-SWA_4 1953713 : 1962086 8 Synechococcus_phage(50.0%) NA NA
DBSCAN-SWA_5 1980787 : 2070790 104 Bacillus_phage(67.31%) tail,integrase,protease,coat,capsid,head,tRNA,holin,portal,transposase,terminase attL 2003933:2003963|attR 2043729:2043759
DBSCAN-SWA_6 2961331 : 3000230 42 Acinetobacter_phage(30.0%) coat,bacteriocin,transposase NA
DBSCAN-SWA_7 3145325 : 3224661 69 Bacillus_phage(74.0%) tail,integrase,protease,bacteriocin,capsid,head,portal,transposase,terminase attL 3162561:3162578|attR 3190206:3190223
DBSCAN-SWA_8 3662951 : 3697158 40 Staphylococcus_phage(33.33%) transposase NA
DBSCAN-SWA_9 4254000 : 4261504 10 Geobacillus_phage(28.57%) NA NA
DBSCAN-SWA_10 4642973 : 4667465 29 Bacillus_phage(88.24%) tail,transposase,holin NA
DBSCAN-SWA_11 4671269 : 4686258 22 Bacillus_phage(41.67%) portal,transposase NA
DBSCAN-SWA_12 5131179 : 5140498 9 Bacillus_phage(71.43%) NA NA
DBSCAN-SWA_13 5285621 : 5396224 113 Bacillus_phage(80.0%) tail,integrase,protease,portal,capsid,holin,head,transposase,terminase attL 5325324:5325383|attR 5396216:5397065
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
5. CP024775
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 28639 : 34618 9 Bacillus_phage(50.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage