Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP023437 Salmonella enterica strain FORC_074 plasmid pFORC74_2, complete sequence 0 crisprs cas14j 0 0 1 0
CP023436 Salmonella enterica strain FORC_074 chromosome, complete genome 2 crisprs PD-DExK,WYL,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3,DEDDh,DinG 0 13 9 0
CP023438 Salmonella enterica strain FORC_074 plasmid pFORC74_3, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP023437
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 14202 : 21203 8 Escherichia_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP023436
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023436_1 940940-941579 TypeI-E I-E
10 spacers
cas3,cas8e,cse2gr11

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023436_2 957731-958247 TypeI-E I-E
8 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP023436_1 1.15|941274|33|CP023436|CRISPRCasFinder 941274-941306 33 NZ_CP032236 Yersinia ruckeri strain NHV_3758 plasmid pYR4, complete sequence 63403-63435 4 0.879
CP023436_1 1.15|941274|33|CP023436|CRISPRCasFinder 941274-941306 33 NZ_LN681230 Yersinia ruckeri strain CSF007-82 plasmid pYR3, complete sequence 91355-91387 4 0.879
CP023436_1 1.5|941211|34|CP023436|PILER-CR,CRT 941211-941244 34 NZ_CP044178 Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1 18967-19000 5 0.853
CP023436_1 1.5|941211|34|CP023436|PILER-CR,CRT 941211-941244 34 CP053324 Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence 25136-25169 5 0.853
CP023436_1 1.6|941272|35|CP023436|PILER-CR,CRT 941272-941306 35 NZ_CP032236 Yersinia ruckeri strain NHV_3758 plasmid pYR4, complete sequence 63403-63437 5 0.857
CP023436_1 1.6|941272|35|CP023436|PILER-CR,CRT 941272-941306 35 NZ_LN681230 Yersinia ruckeri strain CSF007-82 plasmid pYR3, complete sequence 91353-91387 5 0.857
CP023436_1 1.5|941211|34|CP023436|PILER-CR,CRT 941211-941244 34 NZ_LN890526 Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence 31716-31749 6 0.824
CP023436_1 1.14|941213|32|CP023436|CRISPRCasFinder 941213-941244 32 NZ_CP044178 Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1 18969-19000 6 0.812
CP023436_1 1.14|941213|32|CP023436|CRISPRCasFinder 941213-941244 32 CP053324 Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence 25138-25169 6 0.812
CP023436_1 1.14|941213|32|CP023436|CRISPRCasFinder 941213-941244 32 NZ_LN890526 Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence 31718-31749 7 0.781
CP023436_1 1.8|941395|34|CP023436|PILER-CR,CRT 941395-941428 34 MN694003 Marine virus AFVG_250M677, complete genome 17627-17660 8 0.765
CP023436_1 1.12|941091|32|CP023436|CRISPRCasFinder 941091-941122 32 MG592432 Vibrio phage 1.050.O._10N.286.48.A6, partial genome 21687-21718 8 0.75
CP023436_1 1.12|941091|32|CP023436|CRISPRCasFinder 941091-941122 32 MG592431 Vibrio phage 1.049.O._10N.286.54.B5, partial genome 21426-21457 8 0.75
CP023436_1 1.14|941213|32|CP023436|CRISPRCasFinder 941213-941244 32 NZ_CP053022 Sphingobium yanoikuyae strain YC-XJ2 plasmid p-A-Sy, complete sequence 329022-329053 8 0.75
CP023436_1 1.17|941397|32|CP023436|CRISPRCasFinder 941397-941428 32 MN694003 Marine virus AFVG_250M677, complete genome 17629-17660 8 0.75
CP023436_1 1.10|940969|32|CP023436|CRISPRCasFinder 940969-941000 32 CP006879 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602b, complete sequence 405613-405644 9 0.719
CP023436_1 1.12|941091|32|CP023436|CRISPRCasFinder 941091-941122 32 NC_047790 Pseudoalteromonas phage C5a, complete genome 34441-34472 9 0.719
CP023436_1 1.14|941213|32|CP023436|CRISPRCasFinder 941213-941244 32 NZ_CP048340 Escherichia coli strain 142 plasmid p142_C, complete sequence 2410-2441 9 0.719
CP023436_1 1.14|941213|32|CP023436|CRISPRCasFinder 941213-941244 32 NZ_LR130559 Escherichia coli strain MS14385 isolate MS14385 plasmid 5 41882-41913 9 0.719
CP023436_1 1.14|941213|32|CP023436|CRISPRCasFinder 941213-941244 32 NZ_CP020518 Escherichia coli strain 222 plasmid unnamed2, complete sequence 13450-13481 9 0.719
CP023436_1 1.14|941213|32|CP023436|CRISPRCasFinder 941213-941244 32 NZ_CP020497 Escherichia coli strain 103 plasmid unnamed2, complete sequence 37140-37171 9 0.719
CP023436_1 1.14|941213|32|CP023436|CRISPRCasFinder 941213-941244 32 NZ_CP040921 Escherichia coli strain FC853_EC plasmid p853EC2, complete sequence 32060-32091 9 0.719
CP023436_1 1.14|941213|32|CP023436|CRISPRCasFinder 941213-941244 32 CP053252 Escherichia coli strain SCU-204 plasmid pSCU-204-5, complete sequence 19381-19412 9 0.719
CP023436_1 1.14|941213|32|CP023436|CRISPRCasFinder 941213-941244 32 NZ_CP042622 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-7, complete sequence 2614-2645 9 0.719
CP023436_1 1.14|941213|32|CP023436|CRISPRCasFinder 941213-941244 32 NZ_LT985302 Escherichia coli strain ECOR 39 genome assembly, plasmid: RCS82_pI 11943-11974 9 0.719
CP023436_1 1.14|941213|32|CP023436|CRISPRCasFinder 941213-941244 32 NZ_CP028194 Escherichia coli strain CFSAN018748 plasmid pGMI14-004_3, complete sequence 15383-15414 9 0.719
CP023436_1 1.14|941213|32|CP023436|CRISPRCasFinder 941213-941244 32 NZ_CP024865 Escherichia coli strain AR_0015 plasmid unitig_3_pilon, complete sequence 22646-22677 9 0.719
CP023436_1 1.14|941213|32|CP023436|CRISPRCasFinder 941213-941244 32 AP019710 Escherichia coli O145:H28 122715 plasmid pO145_122715_2 DNA, complete genome 4361-4392 9 0.719
CP023436_1 1.14|941213|32|CP023436|CRISPRCasFinder 941213-941244 32 NZ_CP024829 Escherichia coli strain CREC-544 plasmid pCREC-544_3, complete sequence 2221-2252 9 0.719
CP023436_1 1.14|941213|32|CP023436|CRISPRCasFinder 941213-941244 32 NZ_CP009861 Escherichia coli strain ECONIH1 plasmid pECO-b75, complete sequence 2868-2899 9 0.719
CP023436_1 1.14|941213|32|CP023436|CRISPRCasFinder 941213-941244 32 CP025877 Escherichia coli strain 503458 plasmid p503458_49, complete sequence 18343-18374 9 0.719
CP023436_1 1.14|941213|32|CP023436|CRISPRCasFinder 941213-941244 32 NZ_CP023368 Escherichia coli strain 1428 plasmid p48, complete sequence 4914-4945 9 0.719
CP023436_1 1.14|941213|32|CP023436|CRISPRCasFinder 941213-941244 32 NZ_CP032259 Escherichia coli strain AR_0067 plasmid unnamed2, complete sequence 23402-23433 9 0.719
CP023436_1 1.14|941213|32|CP023436|CRISPRCasFinder 941213-941244 32 NZ_CP037450 Escherichia coli strain ATCC 25922 plasmid unnamed, complete sequence 15851-15882 9 0.719
CP023436_1 1.15|941274|33|CP023436|CRISPRCasFinder 941274-941306 33 NZ_CP031947 Ruegeria sp. AD91A plasmid unnamed1, complete sequence 143751-143783 9 0.727
CP023436_2 2.2|957819|34|CP023436|PILER-CR 957819-957852 34 KY006853 Erythrobacter phage vB_EliS_R6L, complete genome 41416-41449 9 0.735
CP023436_2 2.10|957821|32|CP023436|CRISPRCasFinder,CRT 957821-957852 32 KY006853 Erythrobacter phage vB_EliS_R6L, complete genome 41418-41449 9 0.719
CP023436_2 2.14|958065|32|CP023436|CRISPRCasFinder,CRT 958065-958096 32 MK449011 Streptococcus phage Javan92, complete genome 36157-36188 9 0.719
CP023436_2 2.14|958065|32|CP023436|CRISPRCasFinder,CRT 958065-958096 32 MK448835 Streptococcus phage Javan93, complete genome 36157-36188 9 0.719
CP023436_2 2.14|958065|32|CP023436|CRISPRCasFinder,CRT 958065-958096 32 MK448836 Streptococcus phage Javan95, complete genome 37400-37431 9 0.719
CP023436_2 2.14|958065|32|CP023436|CRISPRCasFinder,CRT 958065-958096 32 MK448825 Streptococcus phage Javan639, complete genome 37400-37431 9 0.719
CP023436_2 2.16|958187|32|CP023436|CRISPRCasFinder,CRT 958187-958218 32 NZ_MG266000 Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence 5501-5532 9 0.719
CP023436_1 1.10|940969|32|CP023436|CRISPRCasFinder 940969-941000 32 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 699963-699994 10 0.688
CP023436_1 1.16|941336|32|CP023436|CRISPRCasFinder 941336-941367 32 NZ_LR134399 Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence 103231-103262 10 0.688
CP023436_1 1.6|941272|35|CP023436|PILER-CR,CRT 941272-941306 35 NZ_CP031947 Ruegeria sp. AD91A plasmid unnamed1, complete sequence 143751-143785 11 0.686

1. spacer 1.15|941274|33|CP023436|CRISPRCasFinder matches to NZ_CP032236 (Yersinia ruckeri strain NHV_3758 plasmid pYR4, complete sequence) position: , mismatch: 4, identity: 0.879

caaacaccaagctcttccgccgcgcgttcctga	CRISPR spacer
catttaccaagctcttccgctgcgcgttcctga	Protospacer
**  .***************.************

2. spacer 1.15|941274|33|CP023436|CRISPRCasFinder matches to NZ_LN681230 (Yersinia ruckeri strain CSF007-82 plasmid pYR3, complete sequence) position: , mismatch: 4, identity: 0.879

caaacaccaagctcttccgccgcgcgttcctga	CRISPR spacer
catttaccaagctcttccgctgcgcgttcctga	Protospacer
**  .***************.************

3. spacer 1.5|941211|34|CP023436|PILER-CR,CRT matches to NZ_CP044178 (Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1) position: , mismatch: 5, identity: 0.853

ccaattt----aggggccggaactccgggaaaggcagc	CRISPR spacer
----tttgagaaggggccggaactccgggaaaggcacc	Protospacer
    ***    ************************* *

4. spacer 1.5|941211|34|CP023436|PILER-CR,CRT matches to CP053324 (Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.853

ccaattt----aggggccggaactccgggaaaggcagc	CRISPR spacer
----tttgagaaggggccggaactccgggaaaggcacc	Protospacer
    ***    ************************* *

5. spacer 1.6|941272|35|CP023436|PILER-CR,CRT matches to NZ_CP032236 (Yersinia ruckeri strain NHV_3758 plasmid pYR4, complete sequence) position: , mismatch: 5, identity: 0.857

cgcaaacaccaagctcttccgccgcgcgttcctga	CRISPR spacer
ggcatttaccaagctcttccgctgcgcgttcctga	Protospacer
 ***  .***************.************

6. spacer 1.6|941272|35|CP023436|PILER-CR,CRT matches to NZ_LN681230 (Yersinia ruckeri strain CSF007-82 plasmid pYR3, complete sequence) position: , mismatch: 5, identity: 0.857

cgcaaacaccaagctcttccgccgcgcgttcctga	CRISPR spacer
ggcatttaccaagctcttccgctgcgcgttcctga	Protospacer
 ***  .***************.************

7. spacer 1.5|941211|34|CP023436|PILER-CR,CRT matches to NZ_LN890526 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.824

ccaattt----aggggccggaactccgggaaaggcagc	CRISPR spacer
----tttgagaaggggccggaactccggaaaaggcacc	Protospacer
    ***    *****************.******* *

8. spacer 1.14|941213|32|CP023436|CRISPRCasFinder matches to NZ_CP044178 (Salmonella enterica subsp. enterica serovar Concord strain AR-0407 plasmid pAR-0407-1) position: , mismatch: 6, identity: 0.812

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccgggaaaggcacc	Protospacer
 .   ************************* *

9. spacer 1.14|941213|32|CP023436|CRISPRCasFinder matches to CP053324 (Salmonella enterica subsp. salamae serovar 40:c:e,n,z15 strain 2013K-0524 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccgggaaaggcacc	Protospacer
 .   ************************* *

10. spacer 1.14|941213|32|CP023436|CRISPRCasFinder matches to NZ_LN890526 (Salmonella enterica subsp. enterica serovar Weltevreden strain 2511STDY5712385 plasmid 3, complete sequence) position: , mismatch: 7, identity: 0.781

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggaaaaggcacc	Protospacer
 .   *****************.******* *

11. spacer 1.8|941395|34|CP023436|PILER-CR,CRT matches to MN694003 (Marine virus AFVG_250M677, complete genome) position: , mismatch: 8, identity: 0.765

cgcggtcgcagcctggcctgttgccgtagaatcg	CRISPR spacer
cgcgatcgcagcctgggctgttgccgtgctcgcc	Protospacer
****.*********** **********.    * 

12. spacer 1.12|941091|32|CP023436|CRISPRCasFinder matches to MG592432 (Vibrio phage 1.050.O._10N.286.48.A6, partial genome) position: , mismatch: 8, identity: 0.75

ctgccggtctgtgctgttgtcgtcaataatca	CRISPR spacer
aatctgctctgtgctgttgtagtcaattataa	Protospacer
   *.* ************* ****** ** *

13. spacer 1.12|941091|32|CP023436|CRISPRCasFinder matches to MG592431 (Vibrio phage 1.049.O._10N.286.54.B5, partial genome) position: , mismatch: 8, identity: 0.75

ctgccggtctgtgctgttgtcgtcaataatca	CRISPR spacer
aatctgctctgtgctgttgtagtcaattataa	Protospacer
   *.* ************* ****** ** *

14. spacer 1.14|941213|32|CP023436|CRISPRCasFinder matches to NZ_CP053022 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-A-Sy, complete sequence) position: , mismatch: 8, identity: 0.75

---aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
gtcagtt---gggccggaaagccgggaaaggcata	Protospacer
   *.**   *********  ************  

15. spacer 1.17|941397|32|CP023436|CRISPRCasFinder matches to MN694003 (Marine virus AFVG_250M677, complete genome) position: , mismatch: 8, identity: 0.75

cggtcgcagcctggcctgttgccgtagaatcg	CRISPR spacer
cgatcgcagcctgggctgttgccgtgctcgcc	Protospacer
**.*********** **********.    * 

16. spacer 1.10|940969|32|CP023436|CRISPRCasFinder matches to CP006879 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602b, complete sequence) position: , mismatch: 9, identity: 0.719

aggatttcgccgcgctgttggcctccagattc	CRISPR spacer
cagggtcgaccgcgctgtcgccctccagattc	Protospacer
 .*. *. .*********.* ***********

17. spacer 1.12|941091|32|CP023436|CRISPRCasFinder matches to NC_047790 (Pseudoalteromonas phage C5a, complete genome) position: , mismatch: 9, identity: 0.719

ctgccggtctgtgctgttgtcgtcaataatca	CRISPR spacer
tttggtgtctgtgccgttttcgtcaataagct	Protospacer
.*    ********.*** ********** * 

18. spacer 1.14|941213|32|CP023436|CRISPRCasFinder matches to NZ_CP048340 (Escherichia coli strain 142 plasmid p142_C, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

19. spacer 1.14|941213|32|CP023436|CRISPRCasFinder matches to NZ_LR130559 (Escherichia coli strain MS14385 isolate MS14385 plasmid 5) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

20. spacer 1.14|941213|32|CP023436|CRISPRCasFinder matches to NZ_CP020518 (Escherichia coli strain 222 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

21. spacer 1.14|941213|32|CP023436|CRISPRCasFinder matches to NZ_CP020497 (Escherichia coli strain 103 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

22. spacer 1.14|941213|32|CP023436|CRISPRCasFinder matches to NZ_CP040921 (Escherichia coli strain FC853_EC plasmid p853EC2, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

23. spacer 1.14|941213|32|CP023436|CRISPRCasFinder matches to CP053252 (Escherichia coli strain SCU-204 plasmid pSCU-204-5, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

24. spacer 1.14|941213|32|CP023436|CRISPRCasFinder matches to NZ_CP042622 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-7, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

25. spacer 1.14|941213|32|CP023436|CRISPRCasFinder matches to NZ_LT985302 (Escherichia coli strain ECOR 39 genome assembly, plasmid: RCS82_pI) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

26. spacer 1.14|941213|32|CP023436|CRISPRCasFinder matches to NZ_CP028194 (Escherichia coli strain CFSAN018748 plasmid pGMI14-004_3, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

27. spacer 1.14|941213|32|CP023436|CRISPRCasFinder matches to NZ_CP024865 (Escherichia coli strain AR_0015 plasmid unitig_3_pilon, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

28. spacer 1.14|941213|32|CP023436|CRISPRCasFinder matches to AP019710 (Escherichia coli O145:H28 122715 plasmid pO145_122715_2 DNA, complete genome) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

29. spacer 1.14|941213|32|CP023436|CRISPRCasFinder matches to NZ_CP024829 (Escherichia coli strain CREC-544 plasmid pCREC-544_3, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

30. spacer 1.14|941213|32|CP023436|CRISPRCasFinder matches to NZ_CP009861 (Escherichia coli strain ECONIH1 plasmid pECO-b75, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

31. spacer 1.14|941213|32|CP023436|CRISPRCasFinder matches to CP025877 (Escherichia coli strain 503458 plasmid p503458_49, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

32. spacer 1.14|941213|32|CP023436|CRISPRCasFinder matches to NZ_CP023368 (Escherichia coli strain 1428 plasmid p48, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

33. spacer 1.14|941213|32|CP023436|CRISPRCasFinder matches to NZ_CP032259 (Escherichia coli strain AR_0067 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

34. spacer 1.14|941213|32|CP023436|CRISPRCasFinder matches to NZ_CP037450 (Escherichia coli strain ATCC 25922 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719

aatttaggggccggaactccgggaaaggcagc	CRISPR spacer
tgagaaggggccggaactccggtaaagggcac	Protospacer
 .   ***************** *****  .*

35. spacer 1.15|941274|33|CP023436|CRISPRCasFinder matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727

caaacaccaagctcttccgccgcgcgttcctga	CRISPR spacer
gaaacaccaaggtcttccgccgcacgggcaaag	Protospacer
 ********** ***********.**  *  ..

36. spacer 2.2|957819|34|CP023436|PILER-CR matches to KY006853 (Erythrobacter phage vB_EliS_R6L, complete genome) position: , mismatch: 9, identity: 0.735

cgaatat-atggcgctcacgcgcatgagcattctc	CRISPR spacer
-gaacgcaatggcgctgacgcgcatgatcatttcg	Protospacer
 ***... ******** ********** ****.. 

37. spacer 2.10|957821|32|CP023436|CRISPRCasFinder,CRT matches to KY006853 (Erythrobacter phage vB_EliS_R6L, complete genome) position: , mismatch: 9, identity: 0.719

aatatatggcgctcacgcgcatgagcattctc	CRISPR spacer
acgcaatggcgctgacgcgcatgatcatttcg	Protospacer
*    ******** ********** ****.. 

38. spacer 2.14|958065|32|CP023436|CRISPRCasFinder,CRT matches to MK449011 (Streptococcus phage Javan92, complete genome) position: , mismatch: 9, identity: 0.719

gattgctcagattgggaatttgaccagcggcc	CRISPR spacer
agtcgctcagattgggaatttgtcaagatgta	Protospacer
..*.****************** * **  *. 

39. spacer 2.14|958065|32|CP023436|CRISPRCasFinder,CRT matches to MK448835 (Streptococcus phage Javan93, complete genome) position: , mismatch: 9, identity: 0.719

gattgctcagattgggaatttgaccagcggcc	CRISPR spacer
agtcgctcagattgggaatttgtcaagatgta	Protospacer
..*.****************** * **  *. 

40. spacer 2.14|958065|32|CP023436|CRISPRCasFinder,CRT matches to MK448836 (Streptococcus phage Javan95, complete genome) position: , mismatch: 9, identity: 0.719

gattgctcagattgggaatttgaccagcggcc	CRISPR spacer
agtcgctcagattgggaatttgtcaagatgta	Protospacer
..*.****************** * **  *. 

41. spacer 2.14|958065|32|CP023436|CRISPRCasFinder,CRT matches to MK448825 (Streptococcus phage Javan639, complete genome) position: , mismatch: 9, identity: 0.719

gattgctcagattgggaatttgaccagcggcc	CRISPR spacer
agtcgctcagattgggaatttgtcaagatgta	Protospacer
..*.****************** * **  *. 

42. spacer 2.16|958187|32|CP023436|CRISPRCasFinder,CRT matches to NZ_MG266000 (Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence) position: , mismatch: 9, identity: 0.719

gttgggttgcatagatgacacgcttataaata	CRISPR spacer
gaattatggcatagatgacatgattataaatt	Protospacer
*    .* ************.* ******** 

43. spacer 1.10|940969|32|CP023436|CRISPRCasFinder matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

aggatttcgccgcgctgttggcctccagattc	CRISPR spacer
gggatatcgccgcgctgatggcctatgaccac	Protospacer
.**** *********** ****** ... . *

44. spacer 1.16|941336|32|CP023436|CRISPRCasFinder matches to NZ_LR134399 (Listeria monocytogenes strain NCTC7974 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.688

ttgctctcattaaaggggtttccatgtttgat	CRISPR spacer
gattcgtcattacagtggtttccatgttttag	Protospacer
   .. ****** ** ************* * 

45. spacer 1.6|941272|35|CP023436|PILER-CR,CRT matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.686

cgcaaacaccaagctcttccgccgcgcgttcctga	CRISPR spacer
gagaaacaccaaggtcttccgccgcacgggcaaag	Protospacer
 . ********** ***********.**  *  ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1658096 : 1667267 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_2 1734465 : 1744972 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_3 1857895 : 1905391 62 Salmonella_phage(77.78%) transposase,portal,head,plate,capsid,holin,tail,integrase,terminase attL 1860796:1860810|attR 1908986:1909000
DBSCAN-SWA_4 2438394 : 2457066 26 Escherichia_phage(66.67%) integrase,tRNA attL 2440999:2441012|attR 2453898:2453911
DBSCAN-SWA_5 2623330 : 2690152 78 Enterobacteria_phage(29.41%) protease,tRNA,holin,tail,integrase,terminase attL 2674342:2674366|attR 2693953:2693977
DBSCAN-SWA_6 2896743 : 2907968 12 Salmonella_phage(30.0%) tail NA
DBSCAN-SWA_7 2979412 : 2986560 7 Ralstonia_phage(16.67%) protease,integrase attL 2974044:2974058|attR 2985296:2985310
DBSCAN-SWA_8 3320237 : 3328141 11 Salmonella_phage(57.14%) NA NA
DBSCAN-SWA_9 3379499 : 3438758 53 Bacillus_phage(23.08%) protease,tRNA,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage