1. spacer 1.10|1109866|32|CP023014|CRT,CRISPRCasFinder matches to MT740734 (Ralstonia phage Dina, complete genome) position: , mismatch: 0, identity: 1.0
atttccgggatctgctgcatggcgttgttgac CRISPR spacer
atttccgggatctgctgcatggcgttgttgac Protospacer
********************************
2. spacer 1.19|1110414|32|CP023014|CRT,CRISPRCasFinder matches to MT740734 (Ralstonia phage Dina, complete genome) position: , mismatch: 0, identity: 1.0
gccattgcacatggccgagcggccccgccgct CRISPR spacer
gccattgcacatggccgagcggccccgccgct Protospacer
********************************
3. spacer 1.29|1109865|33|CP023014|PILER-CR matches to MT740734 (Ralstonia phage Dina, complete genome) position: , mismatch: 0, identity: 1.0
gatttccgggatctgctgcatggcgttgttgac CRISPR spacer
gatttccgggatctgctgcatggcgttgttgac Protospacer
*********************************
4. spacer 1.38|1110413|33|CP023014|PILER-CR matches to MT740734 (Ralstonia phage Dina, complete genome) position: , mismatch: 0, identity: 1.0
ggccattgcacatggccgagcggccccgccgct CRISPR spacer
ggccattgcacatggccgagcggccccgccgct Protospacer
*********************************
5. spacer 2.2|1120357|33|CP023014|PILER-CR matches to AB863625 (Ralstonia phage RSK1 DNA, complete genome) position: , mismatch: 0, identity: 1.0
cgcttgggcattgccgacaacctgcaaccggac CRISPR spacer
cgcttgggcattgccgacaacctgcaaccggac Protospacer
*********************************
6. spacer 2.2|1120357|33|CP023014|PILER-CR matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 0, identity: 1.0
cgcttgggcattgccgacaacctgcaaccggac CRISPR spacer
cgcttgggcattgccgacaacctgcaaccggac Protospacer
*********************************
7. spacer 2.2|1120357|33|CP023014|PILER-CR matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 0, identity: 1.0
cgcttgggcattgccgacaacctgcaaccggac CRISPR spacer
cgcttgggcattgccgacaacctgcaaccggac Protospacer
*********************************
8. spacer 2.10|1120358|32|CP023014|CRISPRCasFinder,CRT matches to AB863625 (Ralstonia phage RSK1 DNA, complete genome) position: , mismatch: 0, identity: 1.0
gcttgggcattgccgacaacctgcaaccggac CRISPR spacer
gcttgggcattgccgacaacctgcaaccggac Protospacer
********************************
9. spacer 2.10|1120358|32|CP023014|CRISPRCasFinder,CRT matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 0, identity: 1.0
gcttgggcattgccgacaacctgcaaccggac CRISPR spacer
gcttgggcattgccgacaacctgcaaccggac Protospacer
********************************
10. spacer 2.10|1120358|32|CP023014|CRISPRCasFinder,CRT matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 0, identity: 1.0
gcttgggcattgccgacaacctgcaaccggac CRISPR spacer
gcttgggcattgccgacaacctgcaaccggac Protospacer
********************************
11. spacer 2.49|1122731|32|CP023014|CRISPRCasFinder,CRT matches to AB981169 (Ralstonia phage RSY1 DNA, complete genome) position: , mismatch: 0, identity: 1.0
ttgatgcgggtcaggaaatcgctcgactcctg CRISPR spacer
ttgatgcgggtcaggaaatcgctcgactcctg Protospacer
********************************
12. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022767 (Ralstonia solanacearum strain T78 plasmid pRsT78, complete sequence) position: , mismatch: 0, identity: 1.0
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
tcgcggcggtcggcgcagttgtcgtgattgtg Protospacer
********************************
13. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022483 (Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence) position: , mismatch: 0, identity: 1.0
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
tcgcggcggtcggcgcagttgtcgtgattgtg Protospacer
********************************
14. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022767 (Ralstonia solanacearum strain T78 plasmid pRsT78, complete sequence) position: , mismatch: 0, identity: 1.0
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
tcgcggcggtcggcgcagttgtcgtgattgtg Protospacer
********************************
15. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022483 (Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence) position: , mismatch: 0, identity: 1.0
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
tcgcggcggtcggcgcagttgtcgtgattgtg Protospacer
********************************
16. spacer 2.65|1123707|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT740734 (Ralstonia phage Dina, complete genome) position: , mismatch: 0, identity: 1.0
gaaggcgataccctgctgctgaacctgccgga CRISPR spacer
gaaggcgataccctgctgctgaacctgccgga Protospacer
********************************
17. spacer 2.101|1122737|32|CP023014|PILER-CR matches to AB981169 (Ralstonia phage RSY1 DNA, complete genome) position: , mismatch: 0, identity: 1.0
ttgatgcgggtcaggaaatcgctcgactcctg CRISPR spacer
ttgatgcgggtcaggaaatcgctcgactcctg Protospacer
********************************
18. spacer 1.5|1109562|32|CP023014|CRISPRCasFinder,CRT matches to AB863625 (Ralstonia phage RSK1 DNA, complete genome) position: , mismatch: 1, identity: 0.969
ccagcgccaacggccggaatgcccttcgaacg CRISPR spacer
ccggcgccaacggccggaatgcccttcgaacg Protospacer
**.*****************************
19. spacer 1.5|1109562|32|CP023014|CRISPRCasFinder,CRT matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 1, identity: 0.969
ccagcgccaacggccggaatgcccttcgaacg CRISPR spacer
ccggcgccaacggccggaatgcccttcgaacg Protospacer
**.*****************************
20. spacer 1.5|1109562|32|CP023014|CRISPRCasFinder,CRT matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 1, identity: 0.969
ccagcgccaacggccggaatgcccttcgaacg CRISPR spacer
ccggcgccaacggccggaatgcccttcgaacg Protospacer
**.*****************************
21. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to MT740734 (Ralstonia phage Dina, complete genome) position: , mismatch: 1, identity: 0.969
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ccgctcgcgccagcgccgcgcaaacacgtcga Protospacer
*********************.**********
22. spacer 1.15|1110170|32|CP023014|CRT,CRISPRCasFinder matches to NC_018452 (Burkholderia phage DC1, complete genome) position: , mismatch: 1, identity: 0.969
gatgaggcgctggcccgccagctccggccgct CRISPR spacer
gacgaggcgctggcccgccagctccggccgct Protospacer
**.*****************************
23. spacer 1.26|1110841|32|CP023014|CRT matches to MT740736 (Ralstonia phage Eline, complete genome) position: , mismatch: 1, identity: 0.969
cccatgatctgaaacaggccccagctcgccga CRISPR spacer
cccatgatctggaacaggccccagctcgccga Protospacer
***********.********************
24. spacer 1.32|1110047|33|CP023014|PILER-CR matches to MT740734 (Ralstonia phage Dina, complete genome) position: , mismatch: 1, identity: 0.97
gccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
gccgctcgcgccagcgccgcgcaaacacgtcga Protospacer
**********************.**********
25. spacer 1.34|1110169|33|CP023014|PILER-CR matches to NC_018452 (Burkholderia phage DC1, complete genome) position: , mismatch: 1, identity: 0.97
ggatgaggcgctggcccgccagctccggccgct CRISPR spacer
ggacgaggcgctggcccgccagctccggccgct Protospacer
***.*****************************
26. spacer 2.20|1120965|32|CP023014|CRISPRCasFinder matches to AB863625 (Ralstonia phage RSK1 DNA, complete genome) position: , mismatch: 1, identity: 0.969
gaattgggcgcactgagcaacggcctgcacgc CRISPR spacer
gaactgggcgcactgagcaacggcctgcacgc Protospacer
***.****************************
27. spacer 2.20|1120965|32|CP023014|CRISPRCasFinder matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 1, identity: 0.969
gaattgggcgcactgagcaacggcctgcacgc CRISPR spacer
gaactgggcgcactgagcaacggcctgcacgc Protospacer
***.****************************
28. spacer 2.20|1120965|32|CP023014|CRISPRCasFinder matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 1, identity: 0.969
gaattgggcgcactgagcaacggcctgcacgc CRISPR spacer
gaactgggcgcactgagcaacggcctgcacgc Protospacer
***.****************************
29. spacer 2.37|1122003|32|CP023014|CRISPRCasFinder,CRT matches to MT740734 (Ralstonia phage Dina, complete genome) position: , mismatch: 1, identity: 0.969
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
ttctgcggcacctcgaccatcggcagctcttc Protospacer
**************************.*****
30. spacer 2.70|1120966|31|CP023014|CRT matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 1, identity: 0.968
aattgggcgcactgagcaacggcctgcacgc CRISPR spacer
aactgggcgcactgagcaacggcctgcacgc Protospacer
**.****************************
31. spacer 2.70|1120966|31|CP023014|CRT matches to AB863625 (Ralstonia phage RSK1 DNA, complete genome) position: , mismatch: 1, identity: 0.968
aattgggcgcactgagcaacggcctgcacgc CRISPR spacer
aactgggcgcactgagcaacggcctgcacgc Protospacer
**.****************************
32. spacer 2.70|1120966|31|CP023014|CRT matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 1, identity: 0.968
aattgggcgcactgagcaacggcctgcacgc CRISPR spacer
aactgggcgcactgagcaacggcctgcacgc Protospacer
**.****************************
33. spacer 2.72|1120971|32|CP023014|PILER-CR matches to AB863625 (Ralstonia phage RSK1 DNA, complete genome) position: , mismatch: 1, identity: 0.969
gaattgggcgcactgagcaacggcctgcacgc CRISPR spacer
gaactgggcgcactgagcaacggcctgcacgc Protospacer
***.****************************
34. spacer 2.72|1120971|32|CP023014|PILER-CR matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 1, identity: 0.969
gaattgggcgcactgagcaacggcctgcacgc CRISPR spacer
gaactgggcgcactgagcaacggcctgcacgc Protospacer
***.****************************
35. spacer 2.72|1120971|32|CP023014|PILER-CR matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 1, identity: 0.969
gaattgggcgcactgagcaacggcctgcacgc CRISPR spacer
gaactgggcgcactgagcaacggcctgcacgc Protospacer
***.****************************
36. spacer 2.89|1122009|32|CP023014|PILER-CR matches to MT740734 (Ralstonia phage Dina, complete genome) position: , mismatch: 1, identity: 0.969
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
ttctgcggcacctcgaccatcggcagctcttc Protospacer
**************************.*****
37. spacer 1.7|1109683|31|CP023014|CRT matches to AB863625 (Ralstonia phage RSK1 DNA, complete genome) position: , mismatch: 2, identity: 0.935
cggccgaccagctcatcgcatctccagaatt CRISPR spacer
ctgccgatcagctcatcgcatctccagaatt Protospacer
* *****.***********************
38. spacer 1.7|1109683|31|CP023014|CRT matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 2, identity: 0.935
cggccgaccagctcatcgcatctccagaatt CRISPR spacer
ctgccgatcagctcatcgcatctccagaatt Protospacer
* *****.***********************
39. spacer 1.7|1109683|31|CP023014|CRT matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 2, identity: 0.935
cggccgaccagctcatcgcatctccagaatt CRISPR spacer
ctgccgatcagctcatcgcatctccagaatt Protospacer
* *****.***********************
40. spacer 1.26|1110841|32|CP023014|CRT matches to MT740733 (Ralstonia phage Dimitile, complete genome) position: , mismatch: 2, identity: 0.938
cccatgatctgaaacaggccccagctcgccga CRISPR spacer
cccatgatctggaacaggccccaactcgccga Protospacer
***********.***********.********
41. spacer 1.26|1110841|32|CP023014|CRT matches to MT740738 (Ralstonia phage Gamede, complete genome) position: , mismatch: 2, identity: 0.938
cccatgatctgaaacaggccccagctcgccga CRISPR spacer
cccatgatctggaacaggccccaactcgccga Protospacer
***********.***********.********
42. spacer 1.26|1110841|32|CP023014|CRT matches to MT740730 (Ralstonia phage Cimandef, complete genome) position: , mismatch: 2, identity: 0.938
cccatgatctgaaacaggccccagctcgccga CRISPR spacer
cccatgatctggaacaggccccaactcgccga Protospacer
***********.***********.********
43. spacer 1.26|1110841|32|CP023014|CRT matches to MT740739 (Ralstonia phage Gerry, complete genome) position: , mismatch: 2, identity: 0.938
cccatgatctgaaacaggccccagctcgccga CRISPR spacer
cccatgatctggaacaggccccaactcgccga Protospacer
***********.***********.********
44. spacer 1.26|1110841|32|CP023014|CRT matches to MT740732 (Ralstonia phage Darius, complete genome) position: , mismatch: 2, identity: 0.938
cccatgatctgaaacaggccccagctcgccga CRISPR spacer
cccatgatctggaacaggccccaactcgccga Protospacer
***********.***********.********
45. spacer 1.26|1110841|32|CP023014|CRT matches to MT740742 (Ralstonia phage Heva, complete genome) position: , mismatch: 2, identity: 0.938
cccatgatctgaaacaggccccagctcgccga CRISPR spacer
cccatgatctggaacaggccccaactcgccga Protospacer
***********.***********.********
46. spacer 1.26|1110841|32|CP023014|CRT matches to MT740740 (Ralstonia phage Gervaise, complete genome) position: , mismatch: 2, identity: 0.938
cccatgatctgaaacaggccccagctcgccga CRISPR spacer
cccatgatctggaacaggccccaactcgccga Protospacer
***********.***********.********
47. spacer 1.26|1110841|32|CP023014|CRT matches to MT740727 (Ralstonia phage Alix, complete genome) position: , mismatch: 2, identity: 0.938
cccatgatctgaaacaggccccagctcgccga CRISPR spacer
cccatgatctggaacaggccccaactcgccga Protospacer
***********.***********.********
48. spacer 1.26|1110841|32|CP023014|CRT matches to MT740731 (Ralstonia phage Claudette, complete genome) position: , mismatch: 2, identity: 0.938
cccatgatctgaaacaggccccagctcgccga CRISPR spacer
cccatgatctggaacaggccccaactcgccga Protospacer
***********.***********.********
49. spacer 1.26|1110841|32|CP023014|CRT matches to NC_049432 (Ralstonia phage RsoM1USA, complete genome) position: , mismatch: 2, identity: 0.938
cccatgatctgaaacaggccccagctcgccga CRISPR spacer
cccatgatctggaacaggccccagcttgccga Protospacer
***********.**************.*****
50. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to AB863625 (Ralstonia phage RSK1 DNA, complete genome) position: , mismatch: 2, identity: 0.938
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
ctgatcgagatgctgcgcctcgtccaggaccc Protospacer
.****************.**************
51. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 2, identity: 0.938
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
ctgatcgagatgctgcgcctcgtccaggaccc Protospacer
.****************.**************
52. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 2, identity: 0.938
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
ctgatcgagatgctgcgcctcgtccaggaccc Protospacer
.****************.**************
53. spacer 2.38|1122064|32|CP023014|CRISPRCasFinder,CRT matches to AB276040 (Ralstonia phage RSA1 DNA, complete genome) position: , mismatch: 2, identity: 0.938
gtggtgttcggcgccttcaccagcacgttcgc CRISPR spacer
gtggtgtttggcgccttcaccagcacattcgc Protospacer
********.*****************.*****
54. spacer 2.38|1122064|32|CP023014|CRISPRCasFinder,CRT matches to NC_009382 (Ralstonia phage phiRSA1, complete genome) position: , mismatch: 2, identity: 0.938
gtggtgttcggcgccttcaccagcacgttcgc CRISPR spacer
gtggtgtttggcgccttcaccagcacattcgc Protospacer
********.*****************.*****
55. spacer 2.73|1121032|32|CP023014|PILER-CR matches to AB863625 (Ralstonia phage RSK1 DNA, complete genome) position: , mismatch: 2, identity: 0.938
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
ctgatcgagatgctgcgcctcgtccaggaccc Protospacer
.****************.**************
56. spacer 2.73|1121032|32|CP023014|PILER-CR matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 2, identity: 0.938
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
ctgatcgagatgctgcgcctcgtccaggaccc Protospacer
.****************.**************
57. spacer 2.73|1121032|32|CP023014|PILER-CR matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 2, identity: 0.938
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
ctgatcgagatgctgcgcctcgtccaggaccc Protospacer
.****************.**************
58. spacer 2.90|1122070|32|CP023014|PILER-CR matches to AB276040 (Ralstonia phage RSA1 DNA, complete genome) position: , mismatch: 2, identity: 0.938
gtggtgttcggcgccttcaccagcacgttcgc CRISPR spacer
gtggtgtttggcgccttcaccagcacattcgc Protospacer
********.*****************.*****
59. spacer 2.90|1122070|32|CP023014|PILER-CR matches to NC_009382 (Ralstonia phage phiRSA1, complete genome) position: , mismatch: 2, identity: 0.938
gtggtgttcggcgccttcaccagcacgttcgc CRISPR spacer
gtggtgtttggcgccttcaccagcacattcgc Protospacer
********.*****************.*****
60. spacer 2.19|1120905|31|CP023014|CRISPRCasFinder matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 3, identity: 0.903
ctacggttgagttgggccagcgcgacgatcg CRISPR spacer
ccacggttgagctgggccagcgcgatgatcg Protospacer
*.*********.*************.*****
61. spacer 2.19|1120905|31|CP023014|CRISPRCasFinder matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 3, identity: 0.903
ctacggttgagttgggccagcgcgacgatcg CRISPR spacer
ccacggttgagctgggccagcgcgatgatcg Protospacer
*.*********.*************.*****
62. spacer 2.69|1120905|32|CP023014|CRT matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 3, identity: 0.906
ctacggttgagttgggccagcgcgacgatcgg CRISPR spacer
ccacggttgagctgggccagcgcgatgatcgg Protospacer
*.*********.*************.******
63. spacer 2.69|1120905|32|CP023014|CRT matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 3, identity: 0.906
ctacggttgagttgggccagcgcgacgatcgg CRISPR spacer
ccacggttgagctgggccagcgcgatgatcgg Protospacer
*.*********.*************.******
64. spacer 2.33|1121759|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 4, identity: 0.875
attgaccagcaggaagaggtcatcaagcgcgc- CRISPR spacer
attgccctgcaggaagaggtcat-aggcgcgca Protospacer
**** ** *************** *.******
65. spacer 2.36|1121942|32|CP023014|CRISPRCasFinder,CRT matches to NC_047861 (Bordetella phage vB_BbrM_PHB04, complete genome) position: , mismatch: 4, identity: 0.875
gggcccgtcatctgcatcgtgatcgatgtggc CRISPR spacer
gggcccgtcatcttcatcgtgatcgattcgac Protospacer
************* ************* .*.*
66. spacer 2.38|1122064|32|CP023014|CRISPRCasFinder,CRT matches to AB981169 (Ralstonia phage RSY1 DNA, complete genome) position: , mismatch: 4, identity: 0.875
gtggtgttcggcgccttcaccagcacgttcgc CRISPR spacer
acggtgtccggcgccttcaccagcacattcgc Protospacer
..*****.******************.*****
67. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 4, identity: 0.875
cggccatcgagaacgcgctggcga--tgctggca CRISPR spacer
cggccatccagaacgcgcgggcgaactgctgg-- Protospacer
******** ********* ***** ******
68. spacer 2.46|1122553|31|CP023014|CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 4, identity: 0.871
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gagatggtgaagaccttgccccccgtcgcct Protospacer
*.********.************** ****
69. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 4, identity: 0.857
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
gaggacagcacgtcgctcgccagcgcga Protospacer
* ** *****.****************
70. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 4, identity: 0.857
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
gaggacagcacgtcgctcgccagcgcga Protospacer
* ** *****.****************
71. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 4, identity: 0.857
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
gaggacagcacgtcgctcgccagcgcga Protospacer
* ** *****.****************
72. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 4, identity: 0.857
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
gaggacagcacgtcgctcgccagcgcga Protospacer
* ** *****.****************
73. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 4, identity: 0.857
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
gaggacagcacgtcgctcgccagcgcga Protospacer
* ** *****.****************
74. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 4, identity: 0.857
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
gaggacagcacgtcgctcgccagcgcga Protospacer
* ** *****.****************
75. spacer 2.48|1122670|32|CP023014|CRISPRCasFinder,CRT matches to MN693733 (Marine virus AFVG_250M308, complete genome) position: , mismatch: 4, identity: 0.875
tcctctgagtatctcgggctgctcaatcagac- CRISPR spacer
tcctctgagtatctggggctactc-atcatacc Protospacer
************** *****.*** **** **
76. spacer 2.85|1121765|32|CP023014|PILER-CR matches to NZ_CP020911 (Rhizobium etli strain NXC12 plasmid pRetNXC12e, complete sequence) position: , mismatch: 4, identity: 0.875
attgaccagcaggaagaggtcatcaagcgcgc- CRISPR spacer
attgccctgcaggaagaggtcat-aggcgcgca Protospacer
**** ** *************** *.******
77. spacer 2.88|1121948|32|CP023014|PILER-CR matches to NC_047861 (Bordetella phage vB_BbrM_PHB04, complete genome) position: , mismatch: 4, identity: 0.875
gggcccgtcatctgcatcgtgatcgatgtggc CRISPR spacer
gggcccgtcatcttcatcgtgatcgattcgac Protospacer
************* ************* .*.*
78. spacer 2.90|1122070|32|CP023014|PILER-CR matches to AB981169 (Ralstonia phage RSY1 DNA, complete genome) position: , mismatch: 4, identity: 0.875
gtggtgttcggcgccttcaccagcacgttcgc CRISPR spacer
acggtgtccggcgccttcaccagcacattcgc Protospacer
..*****.******************.*****
79. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 4, identity: 0.875
cggccatcgagaacgcgctggcga--tgctggca CRISPR spacer
cggccatccagaacgcgcgggcgaactgctgg-- Protospacer
******** ********* ***** ******
80. spacer 2.98|1122559|31|CP023014|PILER-CR matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 4, identity: 0.871
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gagatggtgaagaccttgccccccgtcgcct Protospacer
*.********.************** ****
81. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 4, identity: 0.857
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
gaggacagcacgtcgctcgccagcgcga Protospacer
* ** *****.****************
82. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 4, identity: 0.857
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
gaggacagcacgtcgctcgccagcgcga Protospacer
* ** *****.****************
83. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 4, identity: 0.857
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
gaggacagcacgtcgctcgccagcgcga Protospacer
* ** *****.****************
84. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 4, identity: 0.857
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
gaggacagcacgtcgctcgccagcgcga Protospacer
* ** *****.****************
85. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 4, identity: 0.857
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
gaggacagcacgtcgctcgccagcgcga Protospacer
* ** *****.****************
86. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 4, identity: 0.857
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
gaggacagcacgtcgctcgccagcgcga Protospacer
* ** *****.****************
87. spacer 2.100|1122676|32|CP023014|PILER-CR matches to MN693733 (Marine virus AFVG_250M308, complete genome) position: , mismatch: 4, identity: 0.875
tcctctgagtatctcgggctgctcaatcagac- CRISPR spacer
tcctctgagtatctggggctactc-atcatacc Protospacer
************** *****.*** **** **
88. spacer 1.8|1109743|32|CP023014|CRT,CRISPRCasFinder matches to NC_005342 (Burkholderia phage Bcep43, complete genome) position: , mismatch: 5, identity: 0.844
tagctctggcgttgcgggtagttgatgttggc CRISPR spacer
tacgactggcgttgcgggtagttgatattcgc Protospacer
** *********************.** **
89. spacer 1.8|1109743|32|CP023014|CRT,CRISPRCasFinder matches to NC_004333 (Burkholderia phage Bcep781, complete genome) position: , mismatch: 5, identity: 0.844
tagctctggcgttgcgggtagttgatgttggc CRISPR spacer
tacgactggcgttgcgggtagttgatattcgc Protospacer
** *********************.** **
90. spacer 1.8|1109743|32|CP023014|CRT,CRISPRCasFinder matches to AY368235 (Burkholderia cepacia phage Bcep43, complete genome) position: , mismatch: 5, identity: 0.844
tagctctggcgttgcgggtagttgatgttggc CRISPR spacer
tacgactggcgttgcgggtagttgatattcgc Protospacer
** *********************.** **
91. spacer 1.8|1109743|32|CP023014|CRT,CRISPRCasFinder matches to AF543311 (Burkholderia cepacia phage Bcep781, complete genome) position: , mismatch: 5, identity: 0.844
tagctctggcgttgcgggtagttgatgttggc CRISPR spacer
tacgactggcgttgcgggtagttgatattcgc Protospacer
** *********************.** **
92. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 5, identity: 0.844
ccgctcgcgccagcgccgcgcgaa-cacgtcga CRISPR spacer
ccgggcgcgccagcgccgcgcgaaccgcggcg- Protospacer
*** ******************* *.** **
93. spacer 1.27|1109742|33|CP023014|PILER-CR matches to NC_005342 (Burkholderia phage Bcep43, complete genome) position: , mismatch: 5, identity: 0.848
gtagctctggcgttgcgggtagttgatgttggc CRISPR spacer
gtacgactggcgttgcgggtagttgatattcgc Protospacer
*** *********************.** **
94. spacer 1.27|1109742|33|CP023014|PILER-CR matches to NC_004333 (Burkholderia phage Bcep781, complete genome) position: , mismatch: 5, identity: 0.848
gtagctctggcgttgcgggtagttgatgttggc CRISPR spacer
gtacgactggcgttgcgggtagttgatattcgc Protospacer
*** *********************.** **
95. spacer 1.27|1109742|33|CP023014|PILER-CR matches to AY368235 (Burkholderia cepacia phage Bcep43, complete genome) position: , mismatch: 5, identity: 0.848
gtagctctggcgttgcgggtagttgatgttggc CRISPR spacer
gtacgactggcgttgcgggtagttgatattcgc Protospacer
*** *********************.** **
96. spacer 1.27|1109742|33|CP023014|PILER-CR matches to AF543311 (Burkholderia cepacia phage Bcep781, complete genome) position: , mismatch: 5, identity: 0.848
gtagctctggcgttgcgggtagttgatgttggc CRISPR spacer
gtacgactggcgttgcgggtagttgatattcgc Protospacer
*** *********************.** **
97. spacer 2.31|1121636|33|CP023014|CRISPRCasFinder,CRT matches to NC_031059 (Rhodovulum phage vB_RhkS_P1, complete genome) position: , mismatch: 5, identity: 0.848
gacgtgagcgagggcgaggacgtgacctacctg CRISPR spacer
gacgtgagcgagggcgagggcgtgatctggttg Protospacer
*******************.*****.**. .**
98. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to CP000663 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence) position: , mismatch: 5, identity: 0.844
cacgg-gaccggcgcgctgaacatgacccgcca CRISPR spacer
-gcggtggccggcgcgctgaacgtgaccggcca Protospacer
.*** *.**************.***** ****
99. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031752 (Rhodobacter sphaeroides strain EBL0706 plasmid p.A, complete sequence) position: , mismatch: 5, identity: 0.844
cacgg-gaccggcgcgctgaacatgacccgcca CRISPR spacer
-gcggtggccggcgcgctgaacgtgaccggcca Protospacer
.*** *.**************.***** ****
100. spacer 2.68|1120480|31|CP023014|CRT matches to MT740732 (Ralstonia phage Darius, complete genome) position: , mismatch: 5, identity: 0.839
ttgggcatcagcaggtcgagccgggggcgga CRISPR spacer
tcgcccagcagcaggccgagccgggggcgga Protospacer
*.* ** *******.***************
101. spacer 2.68|1120480|31|CP023014|CRT matches to MT740740 (Ralstonia phage Gervaise, complete genome) position: , mismatch: 5, identity: 0.839
ttgggcatcagcaggtcgagccgggggcgga CRISPR spacer
tcgcccagcagcaggccgagccgggggcgga Protospacer
*.* ** *******.***************
102. spacer 2.83|1121642|33|CP023014|PILER-CR matches to NC_031059 (Rhodovulum phage vB_RhkS_P1, complete genome) position: , mismatch: 5, identity: 0.848
gacgtgagcgagggcgaggacgtgacctacctg CRISPR spacer
gacgtgagcgagggcgagggcgtgatctggttg Protospacer
*******************.*****.**. .**
103. spacer 1.8|1109743|32|CP023014|CRT,CRISPRCasFinder matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 6, identity: 0.812
tagctctggcgttgcgggtagttgatgttggc CRISPR spacer
tacgactgacgttgcgggtagttgatgttcgt Protospacer
** ***.******************** *.
104. spacer 1.8|1109743|32|CP023014|CRT,CRISPRCasFinder matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 6, identity: 0.812
tagctctggcgttgcgggtagttgatgttggc CRISPR spacer
tacgactgacgttgcgggtagttgatgttcgt Protospacer
** ***.******************** *.
105. spacer 1.8|1109743|32|CP023014|CRT,CRISPRCasFinder matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 6, identity: 0.812
tagctctggcgttgcgggtagttgatgttggc CRISPR spacer
tacgactgacgttgcgggtagttgatgttcgt Protospacer
** ***.******************** *.
106. spacer 1.10|1109866|32|CP023014|CRT,CRISPRCasFinder matches to NC_010507 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD08, complete sequence) position: , mismatch: 6, identity: 0.812
atttccgggatctgctgcatggcgttgttgac CRISPR spacer
gtgtacgggatctgctgcagggcgtcgttgat Protospacer
.* * ************** *****.*****.
107. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
108. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
109. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
110. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
111. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
112. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
113. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
114. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
115. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
116. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
117. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
118. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
119. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
120. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
121. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
122. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
123. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
124. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
125. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
126. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
127. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
128. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
129. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
130. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
131. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
132. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
133. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
134. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
135. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
136. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
137. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
138. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
139. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
140. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
141. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
142. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
143. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
144. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
145. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
146. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
147. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 6, identity: 0.812
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ctgctcgcgccagcgtcgcgcgaactcgctca Protospacer
*.*************.********* **.. *
148. spacer 1.16|1110231|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP049814 (Monaibacterium sp. ALG8 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812
cagcttgtcgcgcgcgtcatcgtccagactgt CRISPR spacer
gagcttctcgcgcgcgtcatcgttcagccact Protospacer
***** ****************.*** * *
149. spacer 1.19|1110414|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 6, identity: 0.812
gccattgcacatggccgagcggccccgccgct CRISPR spacer
ggcattgcacattgcccagcggccccgttcct Protospacer
* ********** *** **********.. **
150. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
tcgcccggcgtcggcacggcggcc--ttgacgat CRISPR spacer
gcgcccggcgtcggcaccgcgaccgattgagg-- Protospacer
**************** ***.** **** *
151. spacer 1.25|1110780|32|CP023014|CRT,CRISPRCasFinder matches to MK422450 (Klebsiella phage ST13-OXA48phi12.4, complete genome) position: , mismatch: 6, identity: 0.812
aactcgattgaggcgtacggcgcctcaggcaa CRISPR spacer
aactcgatcgacgcgtacggcgccagcggtaa Protospacer
********.** ************ **.**
152. spacer 1.32|1110047|33|CP023014|PILER-CR matches to NZ_CP042332 (Bosea sp. F3-2 plasmid pB32-1, complete sequence) position: , mismatch: 6, identity: 0.818
gccgctcgcgccagcgccgcgcgaa-cacgtcga CRISPR spacer
cccgggcgcgccagcgccgcgcgaaccgcggcg- Protospacer
*** ******************* *.** **
153. spacer 2.12|1120479|32|CP023014|CRISPRCasFinder matches to MT740732 (Ralstonia phage Darius, complete genome) position: , mismatch: 6, identity: 0.812
attgggcatcagcaggtcgagccgggggcgga CRISPR spacer
gtcgcccagcagcaggccgagccgggggcgga Protospacer
.*.* ** *******.***************
154. spacer 2.12|1120479|32|CP023014|CRISPRCasFinder matches to MT740740 (Ralstonia phage Gervaise, complete genome) position: , mismatch: 6, identity: 0.812
attgggcatcagcaggtcgagccgggggcgga CRISPR spacer
gtcgcccagcagcaggccgagccgggggcgga Protospacer
.*.* ** *******.***************
155. spacer 2.15|1120662|32|CP023014|CRISPRCasFinder,CRT matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 6, identity: 0.812
agcgcg-tcaaatccgagccggtgaaggccagc CRISPR spacer
-cctcgcttaaatccgagcgggtgatggccagc Protospacer
* ** *.********** ***** *******
156. spacer 2.23|1121148|32|CP023014|CRISPRCasFinder,CRT matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.812
ttcggtagccttggctgcatcgatctcacgca CRISPR spacer
ttcagtagccttggctgcatggataccaaaca Protospacer
***.**************** *** .** .**
157. spacer 2.25|1121270|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812
tacctgctcgacggttttttcgg--agccatcat CRISPR spacer
tacctgcacgacgcttttttcggcaagcctgc-- Protospacer
******* ***** ********* **** *
158. spacer 2.25|1121270|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
tacctgctcgacggttttttcgg--agccatcat CRISPR spacer
tacctgcacgacgcttttttcggcaagcctgc-- Protospacer
******* ***** ********* **** *
159. spacer 2.36|1121942|32|CP023014|CRISPRCasFinder,CRT matches to KF806588 (Erwinia phage Ea9-2, complete genome) position: , mismatch: 6, identity: 0.812
gggcccg---tcatctgcatcgtgatcgatgtggc CRISPR spacer
---cccggtttcaactgcatcgtcatcgatgtgga Protospacer
**** *** ********* **********
160. spacer 2.37|1122003|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP038638 (Cupriavidus oxalaticus strain X32 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
ttctgcggcaccgccaccatcggcacgtcatg Protospacer
************ * ********** ** *
161. spacer 2.38|1122064|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
gtggtgttcggcgccttcaccagcacgttcgc CRISPR spacer
gcgccgatcggcgccatcaccagcacggtcgc Protospacer
*.* .* ******** *********** ****
162. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP021918 (Sagittula sp. P11 plasmid unnamed6, complete sequence) position: , mismatch: 6, identity: 0.812
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
cggccatcgaggacgcgctggggatgaccgcc Protospacer
***********.********* **** . **
163. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
cggccatcgagaacgcgctggcgatgctggca-- CRISPR spacer
cggccatcgagatcgcgcgggcggcg--ggcact Protospacer
************ ***** ****..* ****
164. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812
cggccatcgagaacgcgctggcgatgctggca-- CRISPR spacer
cggccatcgagatcgcgcgggcggcg--ggcact Protospacer
************ ***** ****..* ****
165. spacer 2.46|1122553|31|CP023014|CRISPRCasFinder,CRT matches to NC_006462 (Thermus thermophilus HB8 plasmid pTT27, complete sequence) position: , mismatch: 6, identity: 0.806
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca Protospacer
* ** *. ********** ***.********
166. spacer 2.46|1122553|31|CP023014|CRISPRCasFinder,CRT matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 6, identity: 0.806
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca Protospacer
* ** *. ********** ***.********
167. spacer 2.46|1122553|31|CP023014|CRISPRCasFinder,CRT matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 6, identity: 0.806
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca Protospacer
* ** *. ********** ***.********
168. spacer 2.46|1122553|31|CP023014|CRISPRCasFinder,CRT matches to NZ_CP014142 (Thermus parvatiensis strain RL plasmid pTP143, complete sequence) position: , mismatch: 6, identity: 0.806
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca Protospacer
* ** *. ********** ***.********
169. spacer 2.46|1122553|31|CP023014|CRISPRCasFinder,CRT matches to NC_005838 (Thermus thermophilus HB27 plasmid pTT27, complete sequence) position: , mismatch: 6, identity: 0.806
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca Protospacer
* ** *. ********** ***.********
170. spacer 2.46|1122553|31|CP023014|CRISPRCasFinder,CRT matches to NZ_AP019802 (Thermus thermophilus strain HC11 plasmid pHC11, complete sequence) position: , mismatch: 6, identity: 0.806
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca Protospacer
* ** *. ********** ***.********
171. spacer 2.46|1122553|31|CP023014|CRISPRCasFinder,CRT matches to NC_017588 (Thermus thermophilus JL-18 plasmid pTTJL1801, complete sequence) position: , mismatch: 6, identity: 0.806
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca Protospacer
* ** *. ********** ***.********
172. spacer 2.46|1122553|31|CP023014|CRISPRCasFinder,CRT matches to NZ_AP019795 (Thermus thermophilus strain AA2-29 plasmid pAA229, complete sequence) position: , mismatch: 6, identity: 0.806
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca Protospacer
* ** *. ********** ***.********
173. spacer 2.46|1122553|31|CP023014|CRISPRCasFinder,CRT matches to NZ_LR027520 (Thermus thermophilus isolate TTHNAR1 plasmid 4, complete sequence) position: , mismatch: 6, identity: 0.806
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca Protospacer
* ** *. ********** ***.********
174. spacer 2.46|1122553|31|CP023014|CRISPRCasFinder,CRT matches to NZ_AP019793 (Thermus thermophilus strain AA2-20 plasmid pAA220, complete sequence) position: , mismatch: 6, identity: 0.806
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca Protospacer
* ** *. ********** ***.********
175. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP049041 (Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_4, complete sequence) position: , mismatch: 6, identity: 0.786
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
tgggccagcatgtcgcgcgccggcgcat Protospacer
************** ****.****..
176. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.786
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
tcgctcagcatgccgcccgccagcgcgc Protospacer
.* .*******.***.***********
177. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.786
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
tggatcagcatgtcgggcgccagcgcgc Protospacer
*..********** ***********
178. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.812
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
gacacgaccggcgcgccgaacctgacccgcct Protospacer
**. ***********.**** *********
179. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT498043 (Arthrobacter phage Jinkies, complete genome) position: , mismatch: 6, identity: 0.812
cacgggaccggcgcgctgaacat-gacccgcca CRISPR spacer
cacggcaccggagcgctgaacatcgacgcaac- Protospacer
***** ***** *********** *** *. *
180. spacer 2.66|1123768|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.812
-ccgcgcgaggtctgggcggccgagttccgcga CRISPR spacer
gaagcgc-aggtctgggcggacgagttgcgcca Protospacer
**** ************ ****** *** *
181. spacer 2.75|1121154|32|CP023014|PILER-CR matches to NZ_AP021845 (Azospira sp. I09 plasmid pAZI09, complete sequence) position: , mismatch: 6, identity: 0.812
ttcggtagccttggctgcatcgatctcacgca CRISPR spacer
ttcagtagccttggctgcatggataccaaaca Protospacer
***.**************** *** .** .**
182. spacer 2.77|1121276|32|CP023014|PILER-CR matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812
tacctgctcgacggttttttcgg--agccatcat CRISPR spacer
tacctgcacgacgcttttttcggcaagcctgc-- Protospacer
******* ***** ********* **** *
183. spacer 2.77|1121276|32|CP023014|PILER-CR matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
tacctgctcgacggttttttcgg--agccatcat CRISPR spacer
tacctgcacgacgcttttttcggcaagcctgc-- Protospacer
******* ***** ********* **** *
184. spacer 2.88|1121948|32|CP023014|PILER-CR matches to KF806588 (Erwinia phage Ea9-2, complete genome) position: , mismatch: 6, identity: 0.812
gggcccg---tcatctgcatcgtgatcgatgtggc CRISPR spacer
---cccggtttcaactgcatcgtcatcgatgtgga Protospacer
**** *** ********* **********
185. spacer 2.89|1122009|32|CP023014|PILER-CR matches to NZ_CP038638 (Cupriavidus oxalaticus strain X32 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.812
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
ttctgcggcaccgccaccatcggcacgtcatg Protospacer
************ * ********** ** *
186. spacer 2.90|1122070|32|CP023014|PILER-CR matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
gtggtgttcggcgccttcaccagcacgttcgc CRISPR spacer
gcgccgatcggcgccatcaccagcacggtcgc Protospacer
*.* .* ******** *********** ****
187. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP021918 (Sagittula sp. P11 plasmid unnamed6, complete sequence) position: , mismatch: 6, identity: 0.812
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
cggccatcgaggacgcgctggggatgaccgcc Protospacer
***********.********* **** . **
188. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
cggccatcgagaacgcgctggcgatgctggca-- CRISPR spacer
cggccatcgagatcgcgcgggcggcg--ggcact Protospacer
************ ***** ****..* ****
189. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.812
cggccatcgagaacgcgctggcgatgctggca-- CRISPR spacer
cggccatcgagatcgcgcgggcggcg--ggcact Protospacer
************ ***** ****..* ****
190. spacer 2.98|1122559|31|CP023014|PILER-CR matches to NC_006462 (Thermus thermophilus HB8 plasmid pTT27, complete sequence) position: , mismatch: 6, identity: 0.806
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca Protospacer
* ** *. ********** ***.********
191. spacer 2.98|1122559|31|CP023014|PILER-CR matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 6, identity: 0.806
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca Protospacer
* ** *. ********** ***.********
192. spacer 2.98|1122559|31|CP023014|PILER-CR matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 6, identity: 0.806
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca Protospacer
* ** *. ********** ***.********
193. spacer 2.98|1122559|31|CP023014|PILER-CR matches to NZ_CP014142 (Thermus parvatiensis strain RL plasmid pTP143, complete sequence) position: , mismatch: 6, identity: 0.806
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca Protospacer
* ** *. ********** ***.********
194. spacer 2.98|1122559|31|CP023014|PILER-CR matches to NC_005838 (Thermus thermophilus HB27 plasmid pTT27, complete sequence) position: , mismatch: 6, identity: 0.806
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca Protospacer
* ** *. ********** ***.********
195. spacer 2.98|1122559|31|CP023014|PILER-CR matches to NZ_AP019802 (Thermus thermophilus strain HC11 plasmid pHC11, complete sequence) position: , mismatch: 6, identity: 0.806
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca Protospacer
* ** *. ********** ***.********
196. spacer 2.98|1122559|31|CP023014|PILER-CR matches to NC_017588 (Thermus thermophilus JL-18 plasmid pTTJL1801, complete sequence) position: , mismatch: 6, identity: 0.806
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca Protospacer
* ** *. ********** ***.********
197. spacer 2.98|1122559|31|CP023014|PILER-CR matches to NZ_AP019795 (Thermus thermophilus strain AA2-29 plasmid pAA229, complete sequence) position: , mismatch: 6, identity: 0.806
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca Protospacer
* ** *. ********** ***.********
198. spacer 2.98|1122559|31|CP023014|PILER-CR matches to NZ_LR027520 (Thermus thermophilus isolate TTHNAR1 plasmid 4, complete sequence) position: , mismatch: 6, identity: 0.806
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca Protospacer
* ** *. ********** ***.********
199. spacer 2.98|1122559|31|CP023014|PILER-CR matches to NZ_AP019793 (Thermus thermophilus strain AA2-20 plasmid pAA220, complete sequence) position: , mismatch: 6, identity: 0.806
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gtgaggaggaggaccttggccctcggcgcca Protospacer
* ** *. ********** ***.********
200. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP049041 (Pseudohalocynthiibacter aestuariivivens strain RR4-35 plasmid pRR4-35_4, complete sequence) position: , mismatch: 6, identity: 0.786
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
tgggccagcatgtcgcgcgccggcgcat Protospacer
************** ****.****..
201. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.786
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
tcgctcagcatgccgcccgccagcgcgc Protospacer
.* .*******.***.***********
202. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 6, identity: 0.786
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
tggatcagcatgtcgggcgccagcgcgc Protospacer
*..********** ***********
203. spacer 1.3|1109440|32|CP023014|CRISPRCasFinder,CRT matches to CP000877 (Herpetosiphon aurantiacus DSM 785 plasmid pHAU02, complete sequence) position: , mismatch: 7, identity: 0.781
ctcagcag--tcacgatgaaggtggcttcatttc CRISPR spacer
--gaacaatctcactatgaaggtggcttcatgtc Protospacer
*.**. **** **************** **
204. spacer 1.5|1109562|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ccagcgccaacggccggaatgcccttcgaacg CRISPR spacer
gcgccgccaacggccggaacacccttcgagcc Protospacer
*. ***************..********.*
205. spacer 1.5|1109562|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
ccagcgccaacggccggaatgcccttcgaacg CRISPR spacer
gccccgccaacggccggaacgcccttggaccc Protospacer
* ***************.****** ** *
206. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NC_047977 (Microbacterium phage Hendrix, complete genome) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
cgagctggcggcgatcgtcgcgcgggagcgcgg Protospacer
************.********** **** .
207. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
ggccatggcggcggtcgtcgcggccgagccgga Protospacer
** ***************** *******.
208. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
ggccatggcggcggtcgtcgcggccgagccgga Protospacer
** ***************** *******.
209. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
210. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
211. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
212. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
213. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
214. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
215. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
216. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
217. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
218. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
219. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
220. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
221. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
222. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
223. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
224. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
225. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
226. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
227. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
228. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
229. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
230. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
231. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
232. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
233. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
234. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
235. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
236. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
237. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
238. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
239. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
240. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
241. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
242. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
243. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
244. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
245. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
246. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
247. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
248. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
249. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
250. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
251. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
252. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
253. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
254. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
255. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
256. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
257. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
258. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
259. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
260. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
261. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
262. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
263. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
264. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
265. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
266. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
267. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
268. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
269. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
270. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
271. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
272. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.788
ggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
ggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
273. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
cagccgccgccagcgccgcgcgatcccgtcgc Protospacer
* **. **************** * *****
274. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NC_013531 (Xylanimonas cellulosilytica DSM 15894 plasmid pXCEL01, complete sequence) position: , mismatch: 7, identity: 0.781
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ccgctcgggccagcgccccgcgacctggaaga Protospacer
******* ********* ***** * * **
275. spacer 1.15|1110170|32|CP023014|CRT,CRISPRCasFinder matches to MH779514 (Mycobacterium phage Paito, complete genome) position: , mismatch: 7, identity: 0.781
gatgaggc-gctggcccgccagctccggccgct CRISPR spacer
-ctgtgacagcgggcccgccaggtccggccgcc Protospacer
** *.* ** ********** *********.
276. spacer 1.16|1110231|32|CP023014|CRT,CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781
cagcttgtcgcgcgcgtcatcgtccagactgt- CRISPR spacer
cagcgtgtcgcgcgcgacatcgt-cgggccatg Protospacer
**** *********** ****** *.*.*..*
277. spacer 1.16|1110231|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 7, identity: 0.781
cagcttgtcgcgcgcgtcatcgtccagactgt- CRISPR spacer
cagcgtgtcgcgcgcgacatcgt-cgggccatg Protospacer
**** *********** ****** *.*.*..*
278. spacer 1.16|1110231|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP018385 (Burkholderia pseudomallei strain 2008724860 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
cagc-ttgtcgcgcgcgtcatcgtccagactgt CRISPR spacer
-agcgacgaagcgcgcgacatcgcccagactgt Protospacer
*** .* ******* *****.*********
279. spacer 1.17|1110292|32|CP023014|CRT,CRISPRCasFinder matches to MH533020 (Acinetobacter phage ABPH49, complete genome) position: , mismatch: 7, identity: 0.781
gcaatcaaggtcgccatccttggtcagccacc CRISPR spacer
gcaatcaagttcgccatcgttggtggtgtacc Protospacer
********* ******** ***** . .***
280. spacer 1.17|1110292|32|CP023014|CRT,CRISPRCasFinder matches to MT094431 (Pseudomonas phage BIM BV-46, complete genome) position: , mismatch: 7, identity: 0.781
gcaatcaaggtcgccatccttggtcagccacc-- CRISPR spacer
ggcatcaaggtcgccatcgttgttca--cgccga Protospacer
* *************** *** *** *.**
281. spacer 1.17|1110292|32|CP023014|CRT,CRISPRCasFinder matches to KP025626 (Pseudomonas phage Pf-10, complete genome) position: , mismatch: 7, identity: 0.781
gcaatcaaggtcgccatccttggtcagccacc-- CRISPR spacer
ggcatcaaggtcgccatcgttgttca--cgccga Protospacer
* *************** *** *** *.**
282. spacer 1.19|1110414|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP015585 (Roseomonas gilardii strain U14-5 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781
gccatt-gcacatggccgagcggccccgccgct CRISPR spacer
-ccaccagcacatgggcgagcagccccgccgtg Protospacer
***.. ******** *****.*********.
283. spacer 1.19|1110414|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP015585 (Roseomonas gilardii strain U14-5 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.781
gccatt-gcacatggccgagcggccccgccgct CRISPR spacer
-ccaccagcacatgggcgagcagccccgccgtg Protospacer
***.. ******** *****.*********.
284. spacer 1.19|1110414|32|CP023014|CRT,CRISPRCasFinder matches to NC_021986 (Streptomyces collinus Tu 365 plasmid pSCO2, complete sequence) position: , mismatch: 7, identity: 0.781
gccattgca---catggccgagcggccccgccgct CRISPR spacer
---cttgcgcgccatggccgaggggccccaccgct Protospacer
****. ********** ******.*****
285. spacer 1.19|1110414|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
gccattgcacatggccgagcggccccgccgct CRISPR spacer
ggcctggagcatggcccagcggccccgcagct Protospacer
* * * * .******* *********** ***
286. spacer 1.19|1110414|32|CP023014|CRT,CRISPRCasFinder matches to MN234216 (Streptomyces phage Gilgamesh, complete genome) position: , mismatch: 7, identity: 0.781
gccattgc--acatggccgagcggccccgccgct CRISPR spacer
--cgtcgcgggcatggccgagcgccgccgccgct Protospacer
*.*.** .************ * ********
287. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 7, identity: 0.781
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
ccgcccggcgtcggcacggcggccaccgccac Protospacer
.*********************** . .* *.
288. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
ccgcccggcgtcggcacggcggccaccgccac Protospacer
.*********************** . .* *.
289. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
ccgcccggcgtcggcacggcggccaccgccac Protospacer
.*********************** . .* *.
290. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP033323 (Azospirillum brasilense strain Cd plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.781
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
ccgcccggcgtcggcacggcggccaccgccac Protospacer
.*********************** . .* *.
291. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
ccgcccggcgtcggcacggcggccaccgccac Protospacer
.*********************** . .* *.
292. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP033317 (Azospirillum brasilense strain Sp 7 plasmid p5, complete sequence) position: , mismatch: 7, identity: 0.781
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
ccgcccggcgtcggcacggcggccaccgccac Protospacer
.*********************** . .* *.
293. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 7, identity: 0.781
tcgcccggcgtcggcacggcggc--cttgacgat CRISPR spacer
tcgcccggtgtcggcacgacggcagcctgcag-- Protospacer
********.*********.**** *.** *
294. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gtcg-ttgccggcggcatggcggccttgacgag Protospacer
*** ..* ** *****.**************
295. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gtcg-ttgccggcggcatggcggccttgacgag Protospacer
*** ..* ** *****.**************
296. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gtcg-ttgccggcggcatggcggccttgacgag Protospacer
*** ..* ** *****.**************
297. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gtcg-ttgccgacggcatggcggccttgacgag Protospacer
*** ..* ** *****.**************
298. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 7, identity: 0.781
tcgcccggcgtcggcacggcggc--cttgacgat CRISPR spacer
tcgcccggtgtcggcacgacggcagcctgcag-- Protospacer
********.*********.**** *.** *
299. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gtcg-ttgccggcggcatggcggccttgacgag Protospacer
*** ..* ** *****.**************
300. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gtcg-ttgccggcggcatggcggccttgacgag Protospacer
*** ..* ** *****.**************
301. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gtcg-ttgccggcggcatggcggccttgacgag Protospacer
*** ..* ** *****.**************
302. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gtcg-ttgccggcggcatggcggccttgacgag Protospacer
*** ..* ** *****.**************
303. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 7, identity: 0.781
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
ctgcgcggcgtcggcacgtcggccttttcggt Protospacer
..** ************* ******* **.*
304. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gtcg-ttgccggcggcatggcggccttgacgag Protospacer
*** ..* ** *****.**************
305. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gtcg-ttgccggcggcatggcggccttgacgag Protospacer
*** ..* ** *****.**************
306. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP029730 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
tcctcgggcttcggcacggcgcccttgaccag Protospacer
** .* *** *********** ******* *
307. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gtcg-ttgccgacggcatggcggccttgacgag Protospacer
*** ..* ** *****.**************
308. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gtcg-ttgccggcggcatggcggccttgacgag Protospacer
*** ..* ** *****.**************
309. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gtcg-ttgccgacggcatggcggccttgacgag Protospacer
*** ..* ** *****.**************
310. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gtcg-ttgccgacggcatggcggccttgacgag Protospacer
*** ..* ** *****.**************
311. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gtcg-ttgccggcggcatggcggccttgacgag Protospacer
*** ..* ** *****.**************
312. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP021821 (Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gtcg-ttgccggcggcatggcggccttgacgag Protospacer
*** ..* ** *****.**************
313. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gtcg-ttgccggcggcatggcggccttgacgag Protospacer
*** ..* ** *****.**************
314. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gtcg-ttgccggcggcatggcggccttgacgag Protospacer
*** ..* ** *****.**************
315. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gtcg-ttgccgacggcatggcggccttgacgag Protospacer
*** ..* ** *****.**************
316. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.781
-tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gtcg-ttgccgacggcatggcggccttgacgag Protospacer
*** ..* ** *****.**************
317. spacer 1.23|1110658|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 7, identity: 0.781
aacgggatcgtcatccacgacaacatcatgca CRISPR spacer
tatgatgtcgtcatcctcgacaacatcatgcc Protospacer
*.*. .********* **************
318. spacer 1.27|1109742|33|CP023014|PILER-CR matches to EF602154 (Burkholderia phage BcepNY3, complete genome) position: , mismatch: 7, identity: 0.788
gtagctctggcgttgcgggtagttgatgttggc CRISPR spacer
atacgactgacgttgcgggtagttgatgttcgt Protospacer
.** ***.******************** *.
319. spacer 1.27|1109742|33|CP023014|PILER-CR matches to AY369265 (Burkholderia cenocepacia phage Bcep1, complete genome) position: , mismatch: 7, identity: 0.788
gtagctctggcgttgcgggtagttgatgttggc CRISPR spacer
atacgactgacgttgcgggtagttgatgttcgt Protospacer
.** ***.******************** *.
320. spacer 1.27|1109742|33|CP023014|PILER-CR matches to NC_005263 (Burkholderia phage Bcep1, complete genome) position: , mismatch: 7, identity: 0.788
gtagctctggcgttgcgggtagttgatgttggc CRISPR spacer
atacgactgacgttgcgggtagttgatgttcgt Protospacer
.** ***.******************** *.
321. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.794
aggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
aggccatggcggcggtcgtcgcggccgagccgga Protospacer
*** ***************** *******.
322. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.794
aggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
aggccatggcggcggtcgtcgcggccgagccgga Protospacer
*** ***************** *******.
323. spacer 1.29|1109865|33|CP023014|PILER-CR matches to NC_010507 (Methylobacterium radiotolerans JCM 2831 plasmid pMRAD08, complete sequence) position: , mismatch: 7, identity: 0.788
gatttccgggatctgctgcatggcgttgttgac CRISPR spacer
cgtgtacgggatctgctgcagggcgtcgttgat Protospacer
.* * ************** *****.*****.
324. spacer 1.32|1110047|33|CP023014|PILER-CR matches to NC_013531 (Xylanimonas cellulosilytica DSM 15894 plasmid pXCEL01, complete sequence) position: , mismatch: 7, identity: 0.788
gccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
gccgctcgggccagcgccccgcgacctggaaga Protospacer
******** ********* ***** * * **
325. spacer 1.32|1110047|33|CP023014|PILER-CR matches to NZ_CP017759 (Cupriavidus necator strain NH9 plasmid pENH92, complete sequence) position: , mismatch: 7, identity: 0.788
gccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
gcgggtcgcgccagcgccgcgcgagttcggcgc Protospacer
** * *******************.. ** **
326. spacer 1.35|1110230|33|CP023014|PILER-CR matches to NZ_CP049814 (Monaibacterium sp. ALG8 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.788
gcagcttgtcgcgcgcgtcatcgtccagactgt CRISPR spacer
cgagcttctcgcgcgcgtcatcgttcagccact Protospacer
***** ****************.*** * *
327. spacer 1.38|1110413|33|CP023014|PILER-CR matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 7, identity: 0.788
ggccattgcacatggccgagcggccccgccgct CRISPR spacer
aggcattgcacattgcccagcggccccgttcct Protospacer
.* ********** *** **********.. **
328. spacer 1.38|1110413|33|CP023014|PILER-CR matches to NZ_CP015585 (Roseomonas gilardii strain U14-5 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.788
ggccatt-gcacatggccgagcggccccgccgct CRISPR spacer
-gccaccagcacatgggcgagcagccccgccgtg Protospacer
****.. ******** *****.*********.
329. spacer 1.38|1110413|33|CP023014|PILER-CR matches to NZ_CP015585 (Roseomonas gilardii strain U14-5 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.788
ggccatt-gcacatggccgagcggccccgccgct CRISPR spacer
-gccaccagcacatgggcgagcagccccgccgtg Protospacer
****.. ******** *****.*********.
330. spacer 1.39|1110474|33|CP023014|PILER-CR matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 7, identity: 0.788
gtcgcccggcgtcggcacggcggc--cttgacgat CRISPR spacer
gtcgcccggtgtcggcacgacggcagcctgcag-- Protospacer
*********.*********.**** *.** *
331. spacer 1.39|1110474|33|CP023014|PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 7, identity: 0.788
gtcgcccggcgtcggcacggcggc--cttgacgat CRISPR spacer
gtcgcccggtgtcggcacgacggcagcctgcag-- Protospacer
*********.*********.**** *.** *
332. spacer 2.1|1120296|33|CP023014|PILER-CR matches to NZ_CP023451 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.788
gcgttcatagaccgtcaccacgtccgcgggctg CRISPR spacer
gcggtcatagaccgtcaccacctcgacgcccgg Protospacer
*** ***************** ** .** * *
333. spacer 2.1|1120296|33|CP023014|PILER-CR matches to NZ_CP039699 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK234, complete sequence) position: , mismatch: 7, identity: 0.788
gcgttcatagaccgtcaccacgtccgcgggctg CRISPR spacer
gcggtcatagaccgtcaccacctcgacgcccgg Protospacer
*** ***************** ** .** * *
334. spacer 2.1|1120296|33|CP023014|PILER-CR matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 7, identity: 0.788
gcgttcatagaccgtcaccacgtccgcgggctg CRISPR spacer
gcggtcatagaccgtcaccacctcgacgcccgg Protospacer
*** ***************** ** .** * *
335. spacer 2.1|1120296|33|CP023014|PILER-CR matches to NZ_CP053224 (Sphingobium sp. RSMS plasmid pRSMS1, complete sequence) position: , mismatch: 7, identity: 0.788
gcgttcatagaccgtcaccacgtccgcgggctg CRISPR spacer
gcggtcatagaccgtcaccacctcgacgcccgg Protospacer
*** ***************** ** .** * *
336. spacer 2.4|1120484|33|CP023014|PILER-CR matches to MT740732 (Ralstonia phage Darius, complete genome) position: , mismatch: 7, identity: 0.788
gattgggcatcagcaggtcgagccgggggcgga CRISPR spacer
agtcgcccagcagcaggccgagccgggggcgga Protospacer
..*.* ** *******.***************
337. spacer 2.4|1120484|33|CP023014|PILER-CR matches to MT740740 (Ralstonia phage Gervaise, complete genome) position: , mismatch: 7, identity: 0.788
gattgggcatcagcaggtcgagccgggggcgga CRISPR spacer
agtcgcccagcagcaggccgagccgggggcgga Protospacer
..*.* ** *******.***************
338. spacer 2.6|1120606|33|CP023014|PILER-CR matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 7, identity: 0.788
gccgttctgcccggtgctcacgatcggcgcggt CRISPR spacer
ggcgttcggcccggtgctcacggtcggtctggg Protospacer
* ***** **************.****. .**
339. spacer 2.7|1120667|33|CP023014|PILER-CR matches to NC_014718 (Paraburkholderia rhizoxinica HKI 454 plasmid pBRH01, complete sequence) position: , mismatch: 7, identity: 0.788
gagcgcg-tcaaatccgagccggtgaaggccagc CRISPR spacer
-tcctcgcttaaatccgagcgggtgatggccagc Protospacer
* ** *.********** ***** *******
340. spacer 2.9|1120297|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 7, identity: 0.781
-cgttcatagaccgtcaccacgtccgcgggctg CRISPR spacer
tcggccg-agacggtcaccgcgtccgcgggctc Protospacer
** .*. **** ******.************
341. spacer 2.9|1120297|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP023451 (Rhizorhabdus dicambivorans strain Ndbn-20 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781
cgttcatagaccgtcaccacgtccgcgggctg CRISPR spacer
cggtcatagaccgtcaccacctcgacgcccgg Protospacer
** ***************** ** .** * *
342. spacer 2.9|1120297|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
-cgttcatagaccgtcaccacgtccgcgggctg CRISPR spacer
gcgggca-agaccgtcaccgcgtacgcgggcat Protospacer
** ** ***********.*** *******
343. spacer 2.9|1120297|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP039699 (Novosphingobium sp. ABRDHK2 plasmid pABRDHK234, complete sequence) position: , mismatch: 7, identity: 0.781
cgttcatagaccgtcaccacgtccgcgggctg CRISPR spacer
cggtcatagaccgtcaccacctcgacgcccgg Protospacer
** ***************** ** .** * *
344. spacer 2.9|1120297|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 7, identity: 0.781
cgttcatagaccgtcaccacgtccgcgggctg CRISPR spacer
cggtcatagaccgtcaccacctcgacgcccgg Protospacer
** ***************** ** .** * *
345. spacer 2.9|1120297|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP053224 (Sphingobium sp. RSMS plasmid pRSMS1, complete sequence) position: , mismatch: 7, identity: 0.781
cgttcatagaccgtcaccacgtccgcgggctg CRISPR spacer
cggtcatagaccgtcaccacctcgacgcccgg Protospacer
** ***************** ** .** * *
346. spacer 2.14|1120601|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP028920 (Gemmobacter sp. HYN0069 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ccgttctgcccggtgctcacgatcggcgcggt CRISPR spacer
tcgttctgcccggtgcccacgatgggcatgac Protospacer
.***************.****** ***..*..
347. spacer 2.14|1120601|32|CP023014|CRISPRCasFinder,CRT matches to NC_015727 (Cupriavidus necator N-1 plasmid pBB1, complete sequence) position: , mismatch: 7, identity: 0.781
ccgttctgcccggtgctcacgatcggcgcggt CRISPR spacer
gcgttcggcccggtgctcacggtcggtctggg Protospacer
***** **************.****. .**
348. spacer 2.14|1120601|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
ccgttctg--cccggtgctcacgatcggcgcggt CRISPR spacer
--gatcaggtgccggtgctcgggatcggcgcggt Protospacer
* ** * *********. ************
349. spacer 2.16|1120723|31|CP023014|CRISPRCasFinder,CRT matches to NZ_CP021368 (Acidovorax carolinensis strain P4 plasmid pACP4.2, complete sequence) position: , mismatch: 7, identity: 0.774
gccaagcccccatgccaccagcaacgccctc CRISPR spacer
gcttcgagccaatgcgaccagcaacgccctc Protospacer
**. * ** **** ***************
350. spacer 2.16|1120723|31|CP023014|CRISPRCasFinder,CRT matches to NZ_CP021364 (Acidovorax carolinensis strain P3 plasmid pACP3.2, complete sequence) position: , mismatch: 7, identity: 0.774
gccaagcccccatgccaccagcaacgccctc CRISPR spacer
gcttcgagccaatgcgaccagcaacgccctc Protospacer
**. * ** **** ***************
351. spacer 2.22|1121087|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP018476 (Xanthomonas perforans strain LH3 plasmid pLH3.2, complete sequence) position: , mismatch: 7, identity: 0.781
gactacgcggccgcgcagaggcgcatccgtga CRISPR spacer
gactacggggccgcgcagaagcgccatcgcgt Protospacer
******* ***********.**** .**.*
352. spacer 2.22|1121087|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022265 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plC, complete sequence) position: , mismatch: 7, identity: 0.781
gactacgcggccgcgcagaggcgcatccgtga CRISPR spacer
gactacggggccgcgcagaagcgccatcgcgt Protospacer
******* ***********.**** .**.*
353. spacer 2.22|1121087|32|CP023014|CRISPRCasFinder,CRT matches to CP022268 (Xanthomonas citri pv. vignicola strain CFBP7112 plasmid plA, complete sequence) position: , mismatch: 7, identity: 0.781
gactacgcggccgcgcagaggcgcatccgtga CRISPR spacer
gactacggggccgcgcagaagcgccatcgcgt Protospacer
******* ***********.**** .**.*
354. spacer 2.22|1121087|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP017309 (Xanthomonas campestris pv. campestris str. CN03 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gactacgcggccgcgcagaggcgcatccgtga CRISPR spacer
gactacggggccgcgcagaagcgccatcgcgt Protospacer
******* ***********.**** .**.*
355. spacer 2.24|1121209|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP010421 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence) position: , mismatch: 7, identity: 0.781
tagacgaggcccagcgcgccctg-tcggcgctg CRISPR spacer
tagacgaggcccagcacgcgctgaacagcgag- Protospacer
***************.*** *** *.***
356. spacer 2.34|1121820|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP054606 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence) position: , mismatch: 7, identity: 0.781
tagttcaggatgtcccactcggaccgctcatc CRISPR spacer
ccgttcaggatcacccactcggaccgcacccc Protospacer
. ********* ************** * .*
357. spacer 2.38|1122064|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP020613 (Paracoccus contaminans strain RKI 16-01929T=LMG 29738T=CCM 8701T=CIP 111112T plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gtggtgttcggcgccttcaccagcacgttcgc CRISPR spacer
gccgcgatgggcgccatcaccagcacggtcgc Protospacer
*. *.* * ****** *********** ****
358. spacer 2.38|1122064|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 7, identity: 0.781
gtggtgttcggcgccttcaccagcacgttcgc CRISPR spacer
gcgccgatgggcgccatcaccagcacggtcgc Protospacer
*.* .* * ****** *********** ****
359. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP048424 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
cctccatcgaaaacgcgctgtcgatgctcggc Protospacer
* *******.********* ******* *
360. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_AF135182 (Serratia entomophila strain A1MO2 plasmid pADAP, complete sequence) position: , mismatch: 7, identity: 0.781
cggccat-cgagaacgcgctggcgatgctggca CRISPR spacer
-ggccgcaggagaacgtgctggcgctgctggcc Protospacer
****.. *******.******* *******
361. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP010420 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50e, complete sequence) position: , mismatch: 7, identity: 0.781
cggccatcgagaacgcgctggcgatg---ctggca CRISPR spacer
cggccatcgagaatgcgctcgcgcagggcctg--- Protospacer
*************.***** *** * ***
362. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 7, identity: 0.781
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
cggccatcgagaacgcgattgcggaattggcg Protospacer
***************** * ***. ..****.
363. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NC_002523 (Serratia entomophila plasmid pADAP, complete sequence) position: , mismatch: 7, identity: 0.781
cggccat-cgagaacgcgctggcgatgctggca CRISPR spacer
-ggccgcaggagaacgtgctggcgctgctggcc Protospacer
****.. *******.******* *******
364. spacer 2.45|1122492|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP018077 (Sulfitobacter sp. AM1-D1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
gtgcagatcatcgaagacagcccgctcttcga Protospacer
.************.***.********. *.*
365. spacer 2.45|1122492|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
---tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
atctggcgg---atcgaggacggcctgcaccacaa Protospacer
* **.* *************.** ******
366. spacer 2.46|1122553|31|CP023014|CRISPRCasFinder,CRT matches to NZ_CP054622 (Azospirillum oryzae strain KACC 14407 plasmid unnamed7, complete sequence) position: , mismatch: 7, identity: 0.774
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gccgtgcagaggagcttgccgcccggcgcca Protospacer
* .** ***** ****** **********
367. spacer 2.46|1122553|31|CP023014|CRISPRCasFinder,CRT matches to NZ_CP039651 (Azospirillum sp. TSA2s plasmid p1) position: , mismatch: 7, identity: 0.774
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gccgtgcagaggagcttgccgcccggcgcca Protospacer
* .** ***** ****** **********
368. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_KY416992 (Escherichia coli strain FAM21805 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
369. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
370. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
371. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
372. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
373. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
374. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP026206 (Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
375. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NC_023136 (Leisingera methylohalidivorans DSM 14336 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
cagcccagcatgtcgcgcgccagcgaca Protospacer
* ************ ********
376. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP026404 (Escherichia coli strain ECONIH4 plasmid pECO-6357, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
377. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
378. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
379. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
380. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
381. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
382. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
383. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
384. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
385. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to CP052373 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
386. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
387. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NC_009955 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI01, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ctcatgggcgtgtcgctcgccagcgcgc Protospacer
* .. .**.******************
388. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
389. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
390. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP033758 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
391. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
392. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP016838 (Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
393. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
394. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
395. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
396. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
397. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
398. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
399. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
400. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP030920 (Escherichia coli strain KL53 plasmid pKL53-L, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
401. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP040096 (Pantoea sp. SO10 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
acaaactgcatgccgctcgccagcgcgc Protospacer
.... * *****.***************
402. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
403. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
404. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
405. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to KT997858 (Uncultured Mediterranean phage uvDeep-CGR2-KM19-C37, complete genome) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
aacgccagcttgtcgctcgccagcacaa Protospacer
. ****** **************.*.
406. spacer 2.47|1122613|28|CP023014|CRISPRCasFinder,CRT matches to KU998247 (Gordonia phage Bachita, complete genome) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
aaggccaccatgtcgcgcgccagcgtct Protospacer
. ***** ******** ********. .
407. spacer 2.50|1122792|32|CP023014|CRISPRCasFinder,CRT matches to NC_009717 (Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence) position: , mismatch: 7, identity: 0.781
tccatcaccatggcctgctggtcgagcagctt CRISPR spacer
tccatcaccacggcctgctgggcgacacggtg Protospacer
**********.********** *** * *
408. spacer 2.50|1122792|32|CP023014|CRISPRCasFinder,CRT matches to NC_009717 (Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence) position: , mismatch: 7, identity: 0.781
tccatcaccatggcctgctggtcgagcagctt CRISPR spacer
tccatcaccacggcctgctgggcgacacggtg Protospacer
**********.********** *** * *
409. spacer 2.52|1122914|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_013449 (Streptomyces sp. W9 plasmid pCQ3, complete sequence) position: , mismatch: 7, identity: 0.781
ccgcccgtggcctgccagcacgtcgccatcgg CRISPR spacer
ccgtcgaccgcccgccagctcgtcgccatcgg Protospacer
***.* .. ***.****** ************
410. spacer 2.52|1122914|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038639 (Cupriavidus oxalaticus strain X32 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781
ccgcccg-tggcctgccagcacgtcgccatcgg CRISPR spacer
-cgcaggctggcccgccagcacggcgccatcca Protospacer
*** * *****.********* ******* .
411. spacer 2.52|1122914|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 7, identity: 0.781
ccgcccgtggcctgccagcacgtcgccatcgg CRISPR spacer
ccgtcgaccgcccgccagctcgtcgccatcgg Protospacer
***.* .. ***.****** ************
412. spacer 2.52|1122914|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051182 (Thalassobius gelatinovorus strain NEB572 plasmid pAge77, complete sequence) position: , mismatch: 7, identity: 0.781
ccgcccgtggcctgccagcacgtcgccatcgg CRISPR spacer
cccggcattgcccgccagcacgtcgccatggg Protospacer
** *.* ***.**************** **
413. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
acgagacggtcggcgcagttgtcgacatcgag Protospacer
** *.****************** **.* *
414. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
acgagacggtcggcgcagttgtcgacatcgag Protospacer
** *.****************** **.* *
415. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to AY576273 (Bacteriophage Phi JL001, complete genome) position: , mismatch: 7, identity: 0.781
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
agccggaccggcgcgcgggacatgacccggcc Protospacer
.* ************ *.********** *
416. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_006938 (Phage phiJL001, complete genome) position: , mismatch: 7, identity: 0.781
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
agccggaccggcgcgcgggacatgacccggcc Protospacer
.* ************ *.********** *
417. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN585963 (Gordonia phage Wocket, complete genome) position: , mismatch: 7, identity: 0.781
cacgggaccggcgcgctgaacat-gacccgcca CRISPR spacer
cacggcaccggggcgctgaacatcgatgcatc- Protospacer
***** ***** *********** **. *..*
418. spacer 2.63|1123585|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_022368 (Bacillaceae bacterium JMAK1 plasmid pGIAK1, complete sequence) position: , mismatch: 7, identity: 0.781
gcaagaaggttaaaactggaattgtcattccg CRISPR spacer
ggacgtactttaaaaccggaattgtcattacg Protospacer
* * * * *******.************ **
419. spacer 2.64|1123646|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK929790 (Caulobacter phage RW, complete genome) position: , mismatch: 7, identity: 0.781
aaaccggaggaaggcaagggcatggacgccaa CRISPR spacer
cgctgggaggaaggcacgagcatggacgccaa Protospacer
. . *********** *.*************
420. spacer 2.68|1120480|31|CP023014|CRT matches to NZ_CP014690 (Gluconobacter albidus strain TMW2.1191 plasmid pGS1191_1, complete sequence) position: , mismatch: 7, identity: 0.774
ttgggcatcagcaggtcgagccgggggcgga CRISPR spacer
ttggccatcagcaggtcgagcggggaaagac Protospacer
**** **************** ***.. *.
421. spacer 2.68|1120480|31|CP023014|CRT matches to NZ_CP035514 (Haematobacter massiliensis strain OT1 plasmid pOT1-4, complete sequence) position: , mismatch: 7, identity: 0.774
ttgggcatcagcaggtcgagccgggggcgga CRISPR spacer
gcgcggatcagcaggccgagccgggtgcggg Protospacer
.* * *********.********* ****.
422. spacer 2.68|1120480|31|CP023014|CRT matches to MT740736 (Ralstonia phage Eline, complete genome) position: , mismatch: 7, identity: 0.774
ttgggc---atcagcaggtcgagccgggggcgga CRISPR spacer
---agccaaagcagcaggccgagccgggggcggg Protospacer
.** * *******.**************.
423. spacer 2.68|1120480|31|CP023014|CRT matches to MT740739 (Ralstonia phage Gerry, complete genome) position: , mismatch: 7, identity: 0.774
ttgggc---atcagcaggtcgagccgggggcgga CRISPR spacer
---agccaaagcagcaggccgagccgggggcggg Protospacer
.** * *******.**************.
424. spacer 2.68|1120480|31|CP023014|CRT matches to MT361768 (Ralstonia phage RPZH6, complete genome) position: , mismatch: 7, identity: 0.774
ttgggcatcagcaggtcgagccgggggcgga CRISPR spacer
ccgcccaggagcaggccgagccgggggcgga Protospacer
..* ** ******.***************
425. spacer 2.71|1120905|37|CP023014|PILER-CR matches to MT740741 (Ralstonia phage Hennie, complete genome) position: , mismatch: 7, identity: 0.811
ctacggttgagttgggccagcgcgacgatcgggtgtt CRISPR spacer
ccacggttgagctgggccagcgcgatgatcggaatgt Protospacer
*.*********.*************.******. *
426. spacer 2.71|1120905|37|CP023014|PILER-CR matches to MT740737 (Ralstonia phage Firinga, complete genome) position: , mismatch: 7, identity: 0.811
ctacggttgagttgggccagcgcgacgatcgggtgtt CRISPR spacer
ccacggttgagctgggccagcgcgatgatcggaatgt Protospacer
*.*********.*************.******. *
427. spacer 2.74|1121093|32|CP023014|PILER-CR matches to NZ_CP018476 (Xanthomonas perforans strain LH3 plasmid pLH3.2, complete sequence) position: , mismatch: 7, identity: 0.781
gactacgcggccgcgcagaggcgcatccgtga CRISPR spacer
gactacggggccgcgcagaagcgccatcgcgt Protospacer
******* ***********.**** .**.*
428. spacer 2.74|1121093|32|CP023014|PILER-CR matches to NZ_CP022265 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plC, complete sequence) position: , mismatch: 7, identity: 0.781
gactacgcggccgcgcagaggcgcatccgtga CRISPR spacer
gactacggggccgcgcagaagcgccatcgcgt Protospacer
******* ***********.**** .**.*
429. spacer 2.74|1121093|32|CP023014|PILER-CR matches to CP022268 (Xanthomonas citri pv. vignicola strain CFBP7112 plasmid plA, complete sequence) position: , mismatch: 7, identity: 0.781
gactacgcggccgcgcagaggcgcatccgtga CRISPR spacer
gactacggggccgcgcagaagcgccatcgcgt Protospacer
******* ***********.**** .**.*
430. spacer 2.74|1121093|32|CP023014|PILER-CR matches to NZ_CP017309 (Xanthomonas campestris pv. campestris str. CN03 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gactacgcggccgcgcagaggcgcatccgtga CRISPR spacer
gactacggggccgcgcagaagcgccatcgcgt Protospacer
******* ***********.**** .**.*
431. spacer 2.76|1121215|32|CP023014|PILER-CR matches to NZ_CP010421 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence) position: , mismatch: 7, identity: 0.781
tagacgaggcccagcgcgccctg-tcggcgctg CRISPR spacer
tagacgaggcccagcacgcgctgaacagcgag- Protospacer
***************.*** *** *.***
432. spacer 2.86|1121826|32|CP023014|PILER-CR matches to NZ_CP054606 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence) position: , mismatch: 7, identity: 0.781
tagttcaggatgtcccactcggaccgctcatc CRISPR spacer
ccgttcaggatcacccactcggaccgcacccc Protospacer
. ********* ************** * .*
433. spacer 2.90|1122070|32|CP023014|PILER-CR matches to NZ_CP020613 (Paracoccus contaminans strain RKI 16-01929T=LMG 29738T=CCM 8701T=CIP 111112T plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gtggtgttcggcgccttcaccagcacgttcgc CRISPR spacer
gccgcgatgggcgccatcaccagcacggtcgc Protospacer
*. *.* * ****** *********** ****
434. spacer 2.90|1122070|32|CP023014|PILER-CR matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 7, identity: 0.781
gtggtgttcggcgccttcaccagcacgttcgc CRISPR spacer
gcgccgatgggcgccatcaccagcacggtcgc Protospacer
*.* .* * ****** *********** ****
435. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP048424 (Rhizobium daejeonense strain KACC 13094 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
cctccatcgaaaacgcgctgtcgatgctcggc Protospacer
* *******.********* ******* *
436. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_AF135182 (Serratia entomophila strain A1MO2 plasmid pADAP, complete sequence) position: , mismatch: 7, identity: 0.781
cggccat-cgagaacgcgctggcgatgctggca CRISPR spacer
-ggccgcaggagaacgtgctggcgctgctggcc Protospacer
****.. *******.******* *******
437. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP010420 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50e, complete sequence) position: , mismatch: 7, identity: 0.781
cggccatcgagaacgcgctggcgatg---ctggca CRISPR spacer
cggccatcgagaatgcgctcgcgcagggcctg--- Protospacer
*************.***** *** * ***
438. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_AP022335 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49c, complete sequence) position: , mismatch: 7, identity: 0.781
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
cggccatcgagaacgcgattgcggaattggcg Protospacer
***************** * ***. ..****.
439. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NC_002523 (Serratia entomophila plasmid pADAP, complete sequence) position: , mismatch: 7, identity: 0.781
cggccat-cgagaacgcgctggcgatgctggca CRISPR spacer
-ggccgcaggagaacgtgctggcgctgctggcc Protospacer
****.. *******.******* *******
440. spacer 2.97|1122498|32|CP023014|PILER-CR matches to NZ_CP018077 (Sulfitobacter sp. AM1-D1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
gtgcagatcatcgaagacagcccgctcttcga Protospacer
.************.***.********. *.*
441. spacer 2.97|1122498|32|CP023014|PILER-CR matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
---tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
atctggcgg---atcgaggacggcctgcaccacaa Protospacer
* **.* *************.** ******
442. spacer 2.98|1122559|31|CP023014|PILER-CR matches to NZ_CP054622 (Azospirillum oryzae strain KACC 14407 plasmid unnamed7, complete sequence) position: , mismatch: 7, identity: 0.774
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gccgtgcagaggagcttgccgcccggcgcca Protospacer
* .** ***** ****** **********
443. spacer 2.98|1122559|31|CP023014|PILER-CR matches to NZ_CP039651 (Azospirillum sp. TSA2s plasmid p1) position: , mismatch: 7, identity: 0.774
gggatggtgaggaccttgccccccggcgcca CRISPR spacer
gccgtgcagaggagcttgccgcccggcgcca Protospacer
* .** ***** ****** **********
444. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_KY416992 (Escherichia coli strain FAM21805 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
445. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
446. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
447. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
448. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
449. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
450. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP026206 (Escherichia coli strain ECONIH5 plasmid pECO-cbb3, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
451. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NC_023136 (Leisingera methylohalidivorans DSM 14336 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
cagcccagcatgtcgcgcgccagcgaca Protospacer
* ************ ********
452. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP026404 (Escherichia coli strain ECONIH4 plasmid pECO-6357, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
453. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
454. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
455. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
456. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
457. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
458. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
459. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
460. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
461. spacer 2.99|1122619|28|CP023014|PILER-CR matches to CP052373 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
462. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
463. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NC_009955 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI01, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ctcatgggcgtgtcgctcgccagcgcgc Protospacer
* .. .**.******************
464. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
465. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
466. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP033758 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
467. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
468. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP016838 (Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
469. spacer 2.99|1122619|28|CP023014|PILER-CR matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
470. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
471. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
472. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
473. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
474. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
475. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
476. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP030920 (Escherichia coli strain KL53 plasmid pKL53-L, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
477. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP040096 (Pantoea sp. SO10 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
acaaactgcatgccgctcgccagcgcgc Protospacer
.... * *****.***************
478. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
479. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP024507 (Klebsiella pneumoniae strain KSB2_1B plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
ccacccagcatctcgcgcgccagcgcgg Protospacer
.. ******* **** **********
480. spacer 2.99|1122619|28|CP023014|PILER-CR matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
accggcagcatgtcgcacgccagcgccg Protospacer
.. * *********** *********
481. spacer 2.99|1122619|28|CP023014|PILER-CR matches to KT997858 (Uncultured Mediterranean phage uvDeep-CGR2-KM19-C37, complete genome) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
aacgccagcttgtcgctcgccagcacaa Protospacer
. ****** **************.*.
482. spacer 2.99|1122619|28|CP023014|PILER-CR matches to KU998247 (Gordonia phage Bachita, complete genome) position: , mismatch: 7, identity: 0.75
gtggccagcatgtcgctcgccagcgcgc CRISPR spacer
aaggccaccatgtcgcgcgccagcgtct Protospacer
. ***** ******** ********. .
483. spacer 2.102|1122798|32|CP023014|PILER-CR matches to NC_009717 (Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence) position: , mismatch: 7, identity: 0.781
tccatcaccatggcctgctggtcgagcagctt CRISPR spacer
tccatcaccacggcctgctgggcgacacggtg Protospacer
**********.********** *** * *
484. spacer 2.102|1122798|32|CP023014|PILER-CR matches to NC_009717 (Xanthobacter autotrophicus Py2 plasmid pXAUT01, complete sequence) position: , mismatch: 7, identity: 0.781
tccatcaccatggcctgctggtcgagcagctt CRISPR spacer
tccatcaccacggcctgctgggcgacacggtg Protospacer
**********.********** *** * *
485. spacer 1.5|1109562|32|CP023014|CRISPRCasFinder,CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 8, identity: 0.75
ccagcgccaacggccggaatgcccttcgaacg CRISPR spacer
acagcgccaacgcccggactgcccagcgcctg Protospacer
*********** ***** ***** ** .*
486. spacer 1.5|1109562|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP051678 (Spirosoma sp. CJU-R4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ccagcgccaacggccggaatgcccttcgaacg CRISPR spacer
acagcgccaacggccggattgaccagcaacgg Protospacer
***************** ** ** *.* *
487. spacer 1.5|1109562|32|CP023014|CRISPRCasFinder,CRT matches to KM434184 (Pseudomonas phage vB_Pae_PS44, complete genome) position: , mismatch: 8, identity: 0.75
ccagcgccaacggccggaatgcccttcgaacg CRISPR spacer
ccagcgcccacagccggaatgccggtagcttg Protospacer
******** **.*********** * * .*
488. spacer 1.6|1109623|31|CP023014|CRT matches to NZ_CP053022 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-A-Sy, complete sequence) position: , mismatch: 8, identity: 0.742
cggtgtgcctggcgggcgtcagcttcgttgt CRISPR spacer
ccttgtgcccggcaggcgtcagcttcgccag Protospacer
* ******.***.*************...
489. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 8, identity: 0.758
ggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
cgcggcagcggcgcgcgtcgcgcgcgagccgac Protospacer
* * ..****** *****************.
490. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to KU998238 (Gordonia phage Splinter, complete genome) position: , mismatch: 8, identity: 0.758
ggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
ggagctggcggcggtcgtgtcgcggatgctgcg Protospacer
****************** **** . **.*
491. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NC_030911 (Gordonia phage Vendetta, complete genome) position: , mismatch: 8, identity: 0.758
ggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
ggagctggcggcggtcgtgtcgcggatgctgcg Protospacer
****************** **** . **.*
492. spacer 1.10|1109866|32|CP023014|CRT,CRISPRCasFinder matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 8, identity: 0.75
atttccgggatctgctgcatggcgttgttgac CRISPR spacer
atttcctgcatctgctgcatggcgtcgagccg Protospacer
****** * ****************.*
493. spacer 1.10|1109866|32|CP023014|CRT,CRISPRCasFinder matches to AB276040 (Ralstonia phage RSA1 DNA, complete genome) position: , mismatch: 8, identity: 0.75
atttccgggatctgctgcatggcgttgttgac CRISPR spacer
gtatccgggagcggctgcatggcgttgtcata Protospacer
.* ******* * ***************..
494. spacer 1.10|1109866|32|CP023014|CRT,CRISPRCasFinder matches to NC_009382 (Ralstonia phage phiRSA1, complete genome) position: , mismatch: 8, identity: 0.75
atttccgggatctgctgcatggcgttgttgac CRISPR spacer
gtatccgggagcggctgcatggcgttgtcata Protospacer
.* ******* * ***************..
495. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
cagcacgcgccagcgccgggcgaacatcggca Protospacer
* ** ************* *******. *
496. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 8, identity: 0.75
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
gagttcgcgacagcgccgcgcgaactcgaagg Protospacer
*.***** *************** ** *.
497. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
cagcacgcgccagcgccgggcgaacatcggca Protospacer
* ** ************* *******. *
498. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.75
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
cgggaggtaccagcgcagcgcgaacacgtaga Protospacer
* * *..******* ************ **
499. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 8, identity: 0.75
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
cggctcgcgccggcgccgctcgaaccgcgcgc Protospacer
* *********.******* ***** **
500. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.75
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
cgggaggtaccagcgcagcgcgaacacgtaga Protospacer
* * *..******* ************ **
501. spacer 1.14|1110109|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 8, identity: 0.75
cggctcggcaaaggcaacgcccgcctggtcct CRISPR spacer
acgctcggcgaaggcatcgcccgcctgctgtc Protospacer
*******.****** ********** * ..
502. spacer 1.14|1110109|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP016365 (Phaeobacter porticola strain P97 plasmid pP97_a, complete sequence) position: , mismatch: 8, identity: 0.75
cggctcggcaaaggcaacgcccgcctggtcct CRISPR spacer
ccgctcggcaaaggcagcgcgcgccagtggcg Protospacer
* **************.*** **** * *
503. spacer 1.14|1110109|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 8, identity: 0.75
cggctcggcaaaggcaacgcccgcctggtcct CRISPR spacer
tgcctgggcgaaggcaacgcccgcctcagcgt Protospacer
.* ** ***.**************** . * *
504. spacer 1.15|1110170|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gatgaggcgctggcccgccagctccggccgct CRISPR spacer
ccggcggcgctggcccgccaggtcctgccggc Protospacer
* **************** *** **** .
505. spacer 1.15|1110170|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP026517 (Deinococcus sp. NW-56 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gatgaggcgctggcccgccagctccggccgct CRISPR spacer
tttgaggcgctggcccgccagatcccccggga Protospacer
******************* *** * *
506. spacer 1.15|1110170|32|CP023014|CRT,CRISPRCasFinder matches to MH825697 (Mycobacterium phage Bangla1971, complete genome) position: , mismatch: 8, identity: 0.75
gatgaggcgctggcccgccagctccggccgct CRISPR spacer
accgacgagctggcccgccagctccgccgggt Protospacer
. .** * ****************** * * *
507. spacer 1.15|1110170|32|CP023014|CRT,CRISPRCasFinder matches to MN617843 (Mycobacterium phage Quesadilla, complete genome) position: , mismatch: 8, identity: 0.75
gatgaggcgctggcccgccagctccggccgct CRISPR spacer
ggcgcggcgcttgcccgccagctccagcgccc Protospacer
*..* ****** *************.** *.
508. spacer 1.15|1110170|32|CP023014|CRT,CRISPRCasFinder matches to NC_019407 (Caulobacter phage CcrMagneto, complete genome) position: , mismatch: 8, identity: 0.75
-gatgaggcgctggcccgccagctccggccgct CRISPR spacer
cggcaacg-gctggcacgccagcgccggccgcc Protospacer
*...* * ****** ******* ********.
509. spacer 1.15|1110170|32|CP023014|CRT,CRISPRCasFinder matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 8, identity: 0.75
-gatgaggcgctggcccgccagctccggccgct CRISPR spacer
cggcaacg-gctggcacgccagcgccggccgcc Protospacer
*...* * ****** ******* ********.
510. spacer 1.15|1110170|32|CP023014|CRT,CRISPRCasFinder matches to NC_019411 (Caulobacter phage CcrSwift, complete genome) position: , mismatch: 8, identity: 0.75
-gatgaggcgctggcccgccagctccggccgct CRISPR spacer
cggcaacg-gctggcacgccagcgccggccgcc Protospacer
*...* * ****** ******* ********.
511. spacer 1.16|1110231|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP014688 (Acetobacter persici strain TMW2.1084 plasmid pAC1084_1, complete sequence) position: , mismatch: 8, identity: 0.75
cagcttgtcgcgcgcgtcatcgtccagactgt CRISPR spacer
tgtctggtcgcgcgcgtcagcgtccagcgttt Protospacer
.. ** ************* ******* * *
512. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
ccgcccggcgtcggcacggccgccaccgccac Protospacer
.******************* *** . .* *.
513. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
tcgcccggcgacggcaccgcggccgaaattct Protospacer
********** ****** ****** .*. *
514. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
cggcccggcgtcggcgcggcgacctcgcagaa Protospacer
. *************.*****.***.* **
515. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcccggcgtcggcacggcggccttgacgat--- CRISPR spacer
gcggccggcggcggcacggcggcc---accgtccg Protospacer
** ****** ************* ** .*
516. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcccggcgtcggcacggcggccttgacgat--- CRISPR spacer
gcggccggcggcggcacggcggcc---accgtccg Protospacer
** ****** ************* ** .*
517. spacer 1.23|1110658|32|CP023014|CRT,CRISPRCasFinder matches to NZ_AP022338 (Mameliella alba strain KU6B plasmid pKUB257, complete sequence) position: , mismatch: 8, identity: 0.75
aacgggatcgtcatccacgacaacatcatgca CRISPR spacer
atggagatcgtcatccacgatcacatcatcgt Protospacer
* *.***************. *******
518. spacer 1.23|1110658|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.75
aacgggatcgtcatccacgacaacatcatgca CRISPR spacer
atccgttgcgtcatccacgagaagatcatgcg Protospacer
* * * ************ ** *******.
519. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NC_047977 (Microbacterium phage Hendrix, complete genome) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
tcgagctggcggcgatcgtcgcgcgggagcgcgg Protospacer
************.********** **** .
520. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP029777 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
agcagctggcggcggtcgtcacgcggatgcccgc Protospacer
** *****************.**** . *** ..
521. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
522. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
523. spacer 1.28|1109803|34|CP023014|PILER-CR matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
524. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
525. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
526. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
527. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
528. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
529. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
530. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
531. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
532. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
533. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
534. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
535. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
536. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
537. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
538. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
539. spacer 1.28|1109803|34|CP023014|PILER-CR matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
540. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
541. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
542. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
543. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
544. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
545. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
546. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
547. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
548. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
549. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
550. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
551. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
552. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
553. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
554. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
555. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
556. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
557. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
558. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
559. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
560. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
561. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
562. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
563. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
564. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
565. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
566. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
567. spacer 1.28|1109803|34|CP023014|PILER-CR matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
568. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
569. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
570. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
571. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
572. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
573. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
574. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
575. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
576. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
577. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
578. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
579. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
580. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
581. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
582. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
583. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
584. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 8, identity: 0.765
aggagctggcggcggtcgtcgcgcgcgagccgat-- CRISPR spacer
tggagctggcggtggccgtcgcgcgt--gccggcgg Protospacer
***********.**.*********. ****..
585. spacer 1.32|1110047|33|CP023014|PILER-CR matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758
gccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
acagccgccgccagcgccgcgcgatcccgtcgc Protospacer
.* **. **************** * *****
586. spacer 1.34|1110169|33|CP023014|PILER-CR matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758
ggatgaggcgctggcccgccagctccggccgct CRISPR spacer
ggttgaggcgctggcccgccggctggcgcaacg Protospacer
** *****************.*** ** .*
587. spacer 1.35|1110230|33|CP023014|PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.758
gcagcttgtcgcgcgcgtcatcgtccagactgt- CRISPR spacer
tcagcgtgtcgcgcgcgacatcgt-cgggccatg Protospacer
**** *********** ****** *.*.*..*
588. spacer 1.35|1110230|33|CP023014|PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 8, identity: 0.758
gcagcttgtcgcgcgcgtcatcgtccagactgt- CRISPR spacer
tcagcgtgtcgcgcgcgacatcgt-cgggccatg Protospacer
**** *********** ****** *.*.*..*
589. spacer 1.36|1110291|33|CP023014|PILER-CR matches to MH533020 (Acinetobacter phage ABPH49, complete genome) position: , mismatch: 8, identity: 0.758
ggcaatcaaggtcgccatccttggtcagccacc CRISPR spacer
agcaatcaagttcgccatcgttggtggtgtacc Protospacer
.********* ******** ***** . .***
590. spacer 1.39|1110474|33|CP023014|PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 8, identity: 0.758
gtcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gtcgcccggcgacggcaccgcggccgaaattct Protospacer
*********** ****** ****** .*. *
591. spacer 1.39|1110474|33|CP023014|PILER-CR matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 8, identity: 0.758
gtcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
cctgcgcggcgtcggcacgtcggccttttcggt Protospacer
..** ************* ******* **.*
592. spacer 1.42|1110657|33|CP023014|PILER-CR matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 8, identity: 0.758
gaacgggatcgtcatccacgacaacatcatgca CRISPR spacer
ttatgatgtcgtcatcctcgacaacatcatgcc Protospacer
*.*. .********* **************
593. spacer 1.42|1110657|33|CP023014|PILER-CR matches to NZ_AP022338 (Mameliella alba strain KU6B plasmid pKUB257, complete sequence) position: , mismatch: 8, identity: 0.758
gaacgggatcgtcatccacgacaacatcatgca CRISPR spacer
gatggagatcgtcatccacgatcacatcatcgt Protospacer
** *.***************. *******
594. spacer 2.1|1120296|33|CP023014|PILER-CR matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 8, identity: 0.758
-gcgttcatagaccgtcaccacgtccgcgggctg CRISPR spacer
ctcggccg-agacggtcaccgcgtccgcgggctc Protospacer
** .*. **** ******.************
595. spacer 2.6|1120606|33|CP023014|PILER-CR matches to NZ_CP028920 (Gemmobacter sp. HYN0069 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.758
gccgttctgcccggtgctcacgatcggcgcggt CRISPR spacer
ttcgttctgcccggtgcccacgatgggcatgac Protospacer
.***************.****** ***..*..
596. spacer 2.6|1120606|33|CP023014|PILER-CR matches to NZ_CP006373 (Aureimonas sp. AU20 plasmid pAU20f, complete sequence) position: , mismatch: 8, identity: 0.758
gccgt-tctgcccggtgctcacgatcggcgcggt CRISPR spacer
-cagcatcggcccggtgcgcacgatcggcgcccc Protospacer
* *. ** ********* ************ .
597. spacer 2.12|1120479|32|CP023014|CRISPRCasFinder matches to NZ_CP014690 (Gluconobacter albidus strain TMW2.1191 plasmid pGS1191_1, complete sequence) position: , mismatch: 8, identity: 0.75
attgggcatcagcaggtcgagccgggggcgga CRISPR spacer
cttggccatcagcaggtcgagcggggaaagac Protospacer
**** **************** ***.. *.
598. spacer 2.12|1120479|32|CP023014|CRISPRCasFinder matches to NZ_CP035514 (Haematobacter massiliensis strain OT1 plasmid pOT1-4, complete sequence) position: , mismatch: 8, identity: 0.75
attgggcatcagcaggtcgagccgggggcgga CRISPR spacer
cgcgcggatcagcaggccgagccgggtgcggg Protospacer
.* * *********.********* ****.
599. spacer 2.14|1120601|32|CP023014|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
ccgttctgcccggtgctcacgatcggcgcggt CRISPR spacer
gcgatgccgccgatgctcatgatcggcgcggt Protospacer
** * . ***.******.************
600. spacer 2.16|1120723|31|CP023014|CRISPRCasFinder,CRT matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 8, identity: 0.742
gccaagcccccatgccaccagcaacgccctc CRISPR spacer
acccttcccgcctgccaccagcaacgcccgg Protospacer
.** *** * *****************
601. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga Protospacer
* ************** *********
602. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga Protospacer
* ************** *********
603. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga Protospacer
* ************** *********
604. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga Protospacer
* ************** *********
605. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga Protospacer
* ************** *********
606. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga Protospacer
* ************** *********
607. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga Protospacer
* ************** *********
608. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP023065 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga Protospacer
* ************** *********
609. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP023065 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga Protospacer
* ************** *********
610. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to NC_000914 (Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga Protospacer
* ************** *********
611. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to NC_000914 (Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga Protospacer
* ************** *********
612. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
gcccgcgagatgctgcgtctcgccgaggacgc Protospacer
. *****************.* ***** *
613. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
gcccgcgagatgctgcgtctcgccgaggacgc Protospacer
. *****************.* ***** *
614. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to NZ_LR699556 (Paraburkholderia sp. Msb3 isolate PDMSB31 plasmid pII) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
ttcgcggaggcgctgcgtctcgtccaggagac Protospacer
** .. ***..****************** *
615. spacer 2.24|1121209|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
---tagacgaggcccagcgcgccctgtcggcgctg CRISPR spacer
gcctgagc---gcgcagcgcgcgctgtcggcgctg Protospacer
*...* ** ******** ************
616. spacer 2.24|1121209|32|CP023014|CRISPRCasFinder,CRT matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 8, identity: 0.75
tagacgaggcccagcgcgccctgt-cggcgctg CRISPR spacer
gggacgaggcccagcgcgtactgtccttcgcc- Protospacer
.****************. **** * ***.
617. spacer 2.24|1121209|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 8, identity: 0.75
tagacgaggcccagcgcgccctgt-cggcgctg CRISPR spacer
gggacgaggcccagcgcgtactgtccttcgcc- Protospacer
.****************. **** * ***.
618. spacer 2.30|1121575|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP054606 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgttcacttcgcgcacggcggcaacctgac CRISPR spacer
ttttgtcacttcgggcacggcggcaaactgcc Protospacer
. . ******** ************ *** *
619. spacer 2.30|1121575|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP045329 (Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgttcacttcgcgcacggcggcaacctgac CRISPR spacer
cgccttcacttcgcgcaccgcggtgaagggag Protospacer
*** ************** ****..* **
620. spacer 2.30|1121575|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP045345 (Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgttcacttcgcgcacggcggcaacctgac CRISPR spacer
cgccttcacttcgcgcaccgcggtgaagggag Protospacer
*** ************** ****..* **
621. spacer 2.30|1121575|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP045335 (Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgttcacttcgcgcacggcggcaacctgac CRISPR spacer
cgccttcacttcgcgcaccgcggtgaagggag Protospacer
*** ************** ****..* **
622. spacer 2.30|1121575|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgttcacttcgcgcacggcggcaacctgac CRISPR spacer
cgccttcacttcgcgcaccgcggtgaagggag Protospacer
*** ************** ****..* **
623. spacer 2.30|1121575|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgttcacttcgcgcacggcggcaacctgac CRISPR spacer
cgccttcacttcgcgcaccgcggtgaagggag Protospacer
*** ************** ****..* **
624. spacer 2.32|1121698|32|CP023014|CRISPRCasFinder,CRT matches to NZ_LT969519 (Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1) position: , mismatch: 8, identity: 0.75
aagagccaggccgctcctggcgcac-cgaactt CRISPR spacer
gcgagccagcccgctgctggcgcacatgcaca- Protospacer
. ******* ***** ********* .* **
625. spacer 2.32|1121698|32|CP023014|CRISPRCasFinder,CRT matches to NZ_LT969519 (Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1) position: , mismatch: 8, identity: 0.75
aagagccaggccgctcctggcgcac-cgaactt CRISPR spacer
gcgagccagcccgctgctggcgcacatgcaca- Protospacer
. ******* ***** ********* .* **
626. spacer 2.33|1121759|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
attgaccagcaggaagaggtcatcaagcgcgc CRISPR spacer
cgcggcgcgcaggaagagttcgtcaagcgcgc Protospacer
.*.* ********** **.**********
627. spacer 2.33|1121759|32|CP023014|CRISPRCasFinder,CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
attgaccagcaggaagaggtcatcaagcgcgc CRISPR spacer
cgcggcgcgcaggaagagttcgtcaagcgcgc Protospacer
.*.* ********** **.**********
628. spacer 2.33|1121759|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75
attgaccagcaggaagaggtcatcaagcgcgc CRISPR spacer
attgacccgcaggaagcggtcatgatggtatc Protospacer
******* ******** ****** * * *
629. spacer 2.37|1122003|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 8, identity: 0.75
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
ttctgcggcaccacgaccagcggcatccccat Protospacer
************ ****** ***** ..*. .
630. spacer 2.38|1122064|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP013109 (Sinorhizobium americanum strain CFNEI 73 plasmid B, complete sequence) position: , mismatch: 8, identity: 0.75
-gtggtgttcggcgccttcaccagcacgttcgc CRISPR spacer
cgtaata-tcggcgccttcaccaccatgttccg Protospacer
**..*. *************** **.****
631. spacer 2.38|1122064|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP013053 (Sinorhizobium americanum CCGM7 plasmid B, complete sequence) position: , mismatch: 8, identity: 0.75
-gtggtgttcggcgccttcaccagcacgttcgc CRISPR spacer
cgtaata-tcggcgccttcaccaccatgttccg Protospacer
**..*. *************** **.****
632. spacer 2.38|1122064|32|CP023014|CRISPRCasFinder,CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 8, identity: 0.75
gtggtgttcggcgccttcaccagcacgttcgc--- CRISPR spacer
atggtggtcggccccttcaccagc---cttgccca Protospacer
.***** ***** *********** .*.**
633. spacer 2.40|1122187|32|CP023014|CRISPRCasFinder,CRT matches to NZ_LR594692 (Variovorax sp. WDL1 plasmid 4) position: , mismatch: 8, identity: 0.75
ccattgtc--gggcaagcccgacgtgagccatcc CRISPR spacer
--gctgccgagggcatgcacgacgtgagccatca Protospacer
..**.* ***** ** **************
634. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022767 (Ralstonia solanacearum strain T78 plasmid pRsT78, complete sequence) position: , mismatch: 8, identity: 0.75
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
tgcgtcacgagaacgcgctggcgctgctggcg Protospacer
.* . **************** *******.
635. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022483 (Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence) position: , mismatch: 8, identity: 0.75
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
tgcgtcacgagaacgcgctggcgctgctggcg Protospacer
.* . **************** *******.
636. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP016593 (Ketogulonicigenium vulgare strain SKV plasmid pKvSKV1, complete sequence) position: , mismatch: 8, identity: 0.75
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
atgagaccgaggacgcgctggcgacgctggcg Protospacer
* *.****.************.******.
637. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NC_017386 (Ketogulonicigenium vulgare WSH-001 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
atgagaccgaggacgcgctggcgacgctggcg Protospacer
* *.****.************.******.
638. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NC_014621 (Ketogulonicigenium vulgare Y25 plasmid pYP1, complete sequence) position: , mismatch: 8, identity: 0.75
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
atgagaccgaggacgcgctggcgacgctggcg Protospacer
* *.****.************.******.
639. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP012909 (Ketogulonicigenium vulgare strain Hbe602 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
atgagaccgaggacgcgctggcgacgctggcg Protospacer
* *.****.************.******.
640. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 8, identity: 0.75
cggccatcgagaacgcgctggcgatgctggca- CRISPR spacer
cggccagcgagaccgcgctggcg-cattgacgt Protospacer
****** ***** ********** ...**.*.
641. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 8, identity: 0.75
cggccatcgagaacgcgctggcgatgctggca- CRISPR spacer
cggccagcgagaccgcgctggcg-cattgacgt Protospacer
****** ***** ********** ...**.*.
642. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 8, identity: 0.75
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
cggccatcgaggccgcgctggcgcgcgcggga Protospacer
***********. ********** .** *
643. spacer 2.45|1122492|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
tcgcagatcatcgaggccggcccggcgctggt Protospacer
**************** ******* . * .
644. spacer 2.45|1122492|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
tcgcagatcatcgaggccggcccggcgctggt Protospacer
**************** ******* . * .
645. spacer 2.46|1122553|31|CP023014|CRISPRCasFinder,CRT matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 8, identity: 0.742
gggatggtgaggaccttgccccc----cggcgcca CRISPR spacer
gggttggtgacgaccttgcccccatagctgt---- Protospacer
*** ****** ************ * *.
646. spacer 2.49|1122731|32|CP023014|CRISPRCasFinder,CRT matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 8, identity: 0.75
ttgatgcgggtcaggaaatcgctcgactcctg CRISPR spacer
gccaggcgcggcaggaaatcgctcgactccga Protospacer
. * *** * ******************* .
647. spacer 2.50|1122792|32|CP023014|CRISPRCasFinder,CRT matches to CP047390 (Agrobacterium sp. CGMCC 11546 plasmid pB) position: , mismatch: 8, identity: 0.75
tccatcaccatggcctgctggtcgagcagctt CRISPR spacer
accatcaccatggcatcctggtcgagtgaccg Protospacer
************* * *********...*.
648. spacer 2.50|1122792|32|CP023014|CRISPRCasFinder,CRT matches to MN694285 (Marine virus AFVG_250M134, complete genome) position: , mismatch: 8, identity: 0.75
tccatcaccatggcctgctggtcgagcagctt CRISPR spacer
tctatcgccatggcctgctggtcgaaggcatc Protospacer
**.***.******************. . *.
649. spacer 2.50|1122792|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP025410 (Paracoccus sp. BM15 plasmid pBM152, complete sequence) position: , mismatch: 8, identity: 0.75
tccatcaccatggcctgctggtcgagcagctt CRISPR spacer
tggtccgccatggcctgatggtcgatcagctc Protospacer
* .*.********** ******* *****.
650. spacer 2.50|1122792|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP025410 (Paracoccus sp. BM15 plasmid pBM152, complete sequence) position: , mismatch: 8, identity: 0.75
tccatcaccatggcctgctggtcgagcagctt CRISPR spacer
tggtccgccatggcctgatggtcgatcagctc Protospacer
* .*.********** ******* *****.
651. spacer 2.50|1122792|32|CP023014|CRISPRCasFinder,CRT matches to NZ_AP017657 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_3, complete sequence) position: , mismatch: 8, identity: 0.75
tccatcaccatggcctgctggtcgagcagctt CRISPR spacer
gccgcgagcatggcctgctgctcgagctgctg Protospacer
**.. * ************ ****** ***
652. spacer 2.50|1122792|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP005191 (Sphingobium sp. MI1205 plasmid pMI2, complete sequence) position: , mismatch: 8, identity: 0.75
tccatcaccatggcctgctggtcgagcagctt CRISPR spacer
gccgcgagcatggcctgctgctcgagctgctg Protospacer
**.. * ************ ****** ***
653. spacer 2.52|1122914|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_031122 (Gordonia phage Eyre, complete genome) position: , mismatch: 8, identity: 0.75
ccgcccgtggcctgccagcacgtcgccatcgg CRISPR spacer
gacctcatgccctgccagcacgtcgtcatcga Protospacer
*.*.** ***************.*****.
654. spacer 2.52|1122914|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_011879 (Pseudarthrobacter chlorophenolicus A6 plasmid pACHL01, complete sequence) position: , mismatch: 8, identity: 0.75
ccgcccgtggcctgccagcacgtcgccatcgg CRISPR spacer
gcccgcctgggcggccagcacgtcgccatcct Protospacer
* * * *** * *****************
655. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
tcgcggcggtcggcgcagttgccgcagtaccc Protospacer
*********************.**...* .
656. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023779 (Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcggcggtcggcgcagttgtcgtg-attgtg CRISPR spacer
gcgcggctgtcggcgctgttgtcgggcaccgc- Protospacer
****** ******** ******* * *..*.
657. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
tcgcggcggtcggcgcagttgccgcagtaccc Protospacer
*********************.**...* .
658. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023779 (Nocardia terpenica strain NC_YFY_NT001 plasmid p_NC_YFY_NT001, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcggcggtcggcgcagttgtcgtg-attgtg CRISPR spacer
gcgcggctgtcggcgctgttgtcgggcaccgc- Protospacer
****** ******** ******* * *..*.
659. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN010757 (Mycobacterium phage HUHilltop, complete genome) position: , mismatch: 8, identity: 0.75
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctgaacatcgacgcctg Protospacer
***** ***************** . * *..
660. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK524508 (Mycobacterium phage Zilizebeth, complete genome) position: , mismatch: 8, identity: 0.75
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctgaacatcgacgcctg Protospacer
***** ***************** . * *..
661. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK820639 (Mycobacterium phage Phineas, complete genome) position: , mismatch: 8, identity: 0.75
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctgaacatcgacgcctg Protospacer
***** ***************** . * *..
662. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF133446 (Mycobacterium phage Bogie, complete genome) position: , mismatch: 8, identity: 0.75
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctgaacatcgacgcctg Protospacer
***** ***************** . * *..
663. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK937604 (Mycobacterium phage Necropolis, complete genome) position: , mismatch: 8, identity: 0.75
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctgaacatcgacgcctg Protospacer
***** ***************** . * *..
664. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_041969 (Mycobacterium phage Jebeks, complete genome) position: , mismatch: 8, identity: 0.75
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctgaacatcgacgcctg Protospacer
***** ***************** . * *..
665. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_026605 (Mycobacterium phage Malithi, complete genome) position: , mismatch: 8, identity: 0.75
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctgaacatcgacgcctg Protospacer
***** ***************** . * *..
666. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KU985090 (Mycobacterium phage Shipwreck, complete genome) position: , mismatch: 8, identity: 0.75
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctgaacatcgacgcctg Protospacer
***** ***************** . * *..
667. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_031067 (Mycobacterium phage Makemake, complete genome) position: , mismatch: 8, identity: 0.75
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgccgcctg Protospacer
***** *********** ***** .** *..
668. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH651190 (Streptomyces phage Thestral, complete genome) position: , mismatch: 8, identity: 0.75
cacg-ggaccggcgcgctgaacatgacccgcca CRISPR spacer
-acgctgaccggcccgctgaacatcaccccggc Protospacer
*** ******* ********** ****
669. spacer 2.63|1123585|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gcaagaaggttaaaactggaattgtcattccg CRISPR spacer
tccggaaggttaaaaccggaatggtcatcgcc Protospacer
* .************.***** *****. *
670. spacer 2.64|1123646|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 8, identity: 0.75
aaaccggaggaaggcaagggcatggacgccaa CRISPR spacer
gtgatcgacgaaggcgagggcatggacgccaa Protospacer
. . . ** ******.****************
671. spacer 2.64|1123646|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014142 (Thermus parvatiensis strain RL plasmid pTP143, complete sequence) position: , mismatch: 8, identity: 0.75
aaaccggaggaaggcaagggcatggacgccaa CRISPR spacer
gaaggcgaggaaggcgagggcatggaagcccg Protospacer
.** *********.********** *** .
672. spacer 2.64|1123646|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR027520 (Thermus thermophilus isolate TTHNAR1 plasmid 4, complete sequence) position: , mismatch: 8, identity: 0.75
aaaccggaggaaggcaagggcatggacgccaa CRISPR spacer
gaaggcgaggaaggcgagggcatggaagcccg Protospacer
.** *********.********** *** .
673. spacer 2.64|1123646|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.75
aaaccggaggaaggcaagggcatggacgccaa CRISPR spacer
aagccggaggacggcaagggcatcaagggctg Protospacer
**.******** *********** .* * * .
674. spacer 2.64|1123646|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.75
aaaccggaggaaggcaagggcatggacgccaa CRISPR spacer
aagccggaggacggcaagggcatcaagggctg Protospacer
**.******** *********** .* * * .
675. spacer 2.64|1123646|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
aaaccggaggaaggcaagggcatggacgccaa CRISPR spacer
aagccggaggacggcaagggcatcaagggctg Protospacer
**.******** *********** .* * * .
676. spacer 2.68|1120480|31|CP023014|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.742
ttgggcatcagcaggtcgagccgggggcgga CRISPR spacer
cgcgcggtcagcaggtcgaccagggggcgga Protospacer
. * .************ * *********
677. spacer 2.73|1121032|32|CP023014|PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga Protospacer
* ************** *********
678. spacer 2.73|1121032|32|CP023014|PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga Protospacer
* ************** *********
679. spacer 2.73|1121032|32|CP023014|PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga Protospacer
* ************** *********
680. spacer 2.73|1121032|32|CP023014|PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga Protospacer
* ************** *********
681. spacer 2.73|1121032|32|CP023014|PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga Protospacer
* ************** *********
682. spacer 2.73|1121032|32|CP023014|PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga Protospacer
* ************** *********
683. spacer 2.73|1121032|32|CP023014|PILER-CR matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga Protospacer
* ************** *********
684. spacer 2.73|1121032|32|CP023014|PILER-CR matches to NZ_CP023065 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga Protospacer
* ************** *********
685. spacer 2.73|1121032|32|CP023014|PILER-CR matches to NZ_CP023065 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga Protospacer
* ************** *********
686. spacer 2.73|1121032|32|CP023014|PILER-CR matches to NC_000914 (Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga Protospacer
* ************** *********
687. spacer 2.73|1121032|32|CP023014|PILER-CR matches to NC_000914 (Sinorhizobium fredii NGR234 plasmid pNGR234a, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
aagtacgagatgctgcgtcacgtccaggagga Protospacer
* ************** *********
688. spacer 2.73|1121032|32|CP023014|PILER-CR matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
gcccgcgagatgctgcgtctcgccgaggacgc Protospacer
. *****************.* ***** *
689. spacer 2.73|1121032|32|CP023014|PILER-CR matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
gcccgcgagatgctgcgtctcgccgaggacgc Protospacer
. *****************.* ***** *
690. spacer 2.73|1121032|32|CP023014|PILER-CR matches to NZ_LR699556 (Paraburkholderia sp. Msb3 isolate PDMSB31 plasmid pII) position: , mismatch: 8, identity: 0.75
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
ttcgcggaggcgctgcgtctcgtccaggagac Protospacer
** .. ***..****************** *
691. spacer 2.76|1121215|32|CP023014|PILER-CR matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
---tagacgaggcccagcgcgccctgtcggcgctg CRISPR spacer
gcctgagc---gcgcagcgcgcgctgtcggcgctg Protospacer
*...* ** ******** ************
692. spacer 2.76|1121215|32|CP023014|PILER-CR matches to NC_005241 (Cupriavidus necator H16 megaplasmid pHG1, complete sequence) position: , mismatch: 8, identity: 0.75
tagacgaggcccagcgcgccctgt-cggcgctg CRISPR spacer
gggacgaggcccagcgcgtactgtccttcgcc- Protospacer
.****************. **** * ***.
693. spacer 2.76|1121215|32|CP023014|PILER-CR matches to NZ_CP039289 (Cupriavidus necator H16 plasmid pHG1, complete sequence) position: , mismatch: 8, identity: 0.75
tagacgaggcccagcgcgccctgt-cggcgctg CRISPR spacer
gggacgaggcccagcgcgtactgtccttcgcc- Protospacer
.****************. **** * ***.
694. spacer 2.82|1121581|32|CP023014|PILER-CR matches to NZ_CP054606 (Sulfitobacter pseudonitzschiae strain H46 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgttcacttcgcgcacggcggcaacctgac CRISPR spacer
ttttgtcacttcgggcacggcggcaaactgcc Protospacer
. . ******** ************ *** *
695. spacer 2.82|1121581|32|CP023014|PILER-CR matches to NZ_CP045329 (Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgttcacttcgcgcacggcggcaacctgac CRISPR spacer
cgccttcacttcgcgcaccgcggtgaagggag Protospacer
*** ************** ****..* **
696. spacer 2.82|1121581|32|CP023014|PILER-CR matches to NZ_CP045345 (Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgttcacttcgcgcacggcggcaacctgac CRISPR spacer
cgccttcacttcgcgcaccgcggtgaagggag Protospacer
*** ************** ****..* **
697. spacer 2.82|1121581|32|CP023014|PILER-CR matches to NZ_CP045335 (Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgttcacttcgcgcacggcggcaacctgac CRISPR spacer
cgccttcacttcgcgcaccgcggtgaagggag Protospacer
*** ************** ****..* **
698. spacer 2.82|1121581|32|CP023014|PILER-CR matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgttcacttcgcgcacggcggcaacctgac CRISPR spacer
cgccttcacttcgcgcaccgcggtgaagggag Protospacer
*** ************** ****..* **
699. spacer 2.82|1121581|32|CP023014|PILER-CR matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cgcgttcacttcgcgcacggcggcaacctgac CRISPR spacer
cgccttcacttcgcgcaccgcggtgaagggag Protospacer
*** ************** ****..* **
700. spacer 2.84|1121704|32|CP023014|PILER-CR matches to NZ_LT969519 (Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1) position: , mismatch: 8, identity: 0.75
aagagccaggccgctcctggcgcac-cgaactt CRISPR spacer
gcgagccagcccgctgctggcgcacatgcaca- Protospacer
. ******* ***** ********* .* **
701. spacer 2.84|1121704|32|CP023014|PILER-CR matches to NZ_LT969519 (Pseudomonas aeruginosa isolate RW109 genome assembly, plasmid: RW109 plasmid 1) position: , mismatch: 8, identity: 0.75
aagagccaggccgctcctggcgcac-cgaactt CRISPR spacer
gcgagccagcccgctgctggcgcacatgcaca- Protospacer
. ******* ***** ********* .* **
702. spacer 2.85|1121765|32|CP023014|PILER-CR matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
attgaccagcaggaagaggtcatcaagcgcgc CRISPR spacer
cgcggcgcgcaggaagagttcgtcaagcgcgc Protospacer
.*.* ********** **.**********
703. spacer 2.85|1121765|32|CP023014|PILER-CR matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
attgaccagcaggaagaggtcatcaagcgcgc CRISPR spacer
cgcggcgcgcaggaagagttcgtcaagcgcgc Protospacer
.*.* ********** **.**********
704. spacer 2.85|1121765|32|CP023014|PILER-CR matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75
attgaccagcaggaagaggtcatcaagcgcgc CRISPR spacer
attgacccgcaggaagcggtcatgatggtatc Protospacer
******* ******** ****** * * *
705. spacer 2.89|1122009|32|CP023014|PILER-CR matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 8, identity: 0.75
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
ttctgcggcaccacgaccagcggcatccccat Protospacer
************ ****** ***** ..*. .
706. spacer 2.90|1122070|32|CP023014|PILER-CR matches to NZ_CP013109 (Sinorhizobium americanum strain CFNEI 73 plasmid B, complete sequence) position: , mismatch: 8, identity: 0.75
-gtggtgttcggcgccttcaccagcacgttcgc CRISPR spacer
cgtaata-tcggcgccttcaccaccatgttccg Protospacer
**..*. *************** **.****
707. spacer 2.90|1122070|32|CP023014|PILER-CR matches to NZ_CP013053 (Sinorhizobium americanum CCGM7 plasmid B, complete sequence) position: , mismatch: 8, identity: 0.75
-gtggtgttcggcgccttcaccagcacgttcgc CRISPR spacer
cgtaata-tcggcgccttcaccaccatgttccg Protospacer
**..*. *************** **.****
708. spacer 2.90|1122070|32|CP023014|PILER-CR matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 8, identity: 0.75
gtggtgttcggcgccttcaccagcacgttcgc--- CRISPR spacer
atggtggtcggccccttcaccagc---cttgccca Protospacer
.***** ***** *********** .*.**
709. spacer 2.92|1122193|32|CP023014|PILER-CR matches to NZ_LR594692 (Variovorax sp. WDL1 plasmid 4) position: , mismatch: 8, identity: 0.75
ccattgtc--gggcaagcccgacgtgagccatcc CRISPR spacer
--gctgccgagggcatgcacgacgtgagccatca Protospacer
..**.* ***** ** **************
710. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP022767 (Ralstonia solanacearum strain T78 plasmid pRsT78, complete sequence) position: , mismatch: 8, identity: 0.75
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
tgcgtcacgagaacgcgctggcgctgctggcg Protospacer
.* . **************** *******.
711. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP022483 (Ralstonia solanacearum strain HA4-1 plasmid pHA4-1, complete sequence) position: , mismatch: 8, identity: 0.75
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
tgcgtcacgagaacgcgctggcgctgctggcg Protospacer
.* . **************** *******.
712. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP016593 (Ketogulonicigenium vulgare strain SKV plasmid pKvSKV1, complete sequence) position: , mismatch: 8, identity: 0.75
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
atgagaccgaggacgcgctggcgacgctggcg Protospacer
* *.****.************.******.
713. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NC_017386 (Ketogulonicigenium vulgare WSH-001 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
atgagaccgaggacgcgctggcgacgctggcg Protospacer
* *.****.************.******.
714. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NC_014621 (Ketogulonicigenium vulgare Y25 plasmid pYP1, complete sequence) position: , mismatch: 8, identity: 0.75
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
atgagaccgaggacgcgctggcgacgctggcg Protospacer
* *.****.************.******.
715. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP012909 (Ketogulonicigenium vulgare strain Hbe602 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
atgagaccgaggacgcgctggcgacgctggcg Protospacer
* *.****.************.******.
716. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 8, identity: 0.75
cggccatcgagaacgcgctggcgatgctggca- CRISPR spacer
cggccagcgagaccgcgctggcg-cattgacgt Protospacer
****** ***** ********** ...**.*.
717. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 8, identity: 0.75
cggccatcgagaacgcgctggcgatgctggca- CRISPR spacer
cggccagcgagaccgcgctggcg-cattgacgt Protospacer
****** ***** ********** ...**.*.
718. spacer 2.95|1122376|32|CP023014|PILER-CR matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 8, identity: 0.75
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
cggccatcgaggccgcgctggcgcgcgcggga Protospacer
***********. ********** .** *
719. spacer 2.97|1122498|32|CP023014|PILER-CR matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
tcgcagatcatcgaggccggcccggcgctggt Protospacer
**************** ******* . * .
720. spacer 2.97|1122498|32|CP023014|PILER-CR matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
tcgcagatcatcgaggccggcccggcgctggt Protospacer
**************** ******* . * .
721. spacer 2.98|1122559|31|CP023014|PILER-CR matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 8, identity: 0.742
gggatggtgaggaccttgccccc----cggcgcca CRISPR spacer
gggttggtgacgaccttgcccccatagctgt---- Protospacer
*** ****** ************ * *.
722. spacer 2.101|1122737|32|CP023014|PILER-CR matches to JN698995 (Mycobacterium phage Dori, complete genome) position: , mismatch: 8, identity: 0.75
ttgatgcgggtcaggaaatcgctcgactcctg CRISPR spacer
gccaggcgcggcaggaaatcgctcgactccga Protospacer
. * *** * ******************* .
723. spacer 2.102|1122798|32|CP023014|PILER-CR matches to CP047390 (Agrobacterium sp. CGMCC 11546 plasmid pB) position: , mismatch: 8, identity: 0.75
tccatcaccatggcctgctggtcgagcagctt CRISPR spacer
accatcaccatggcatcctggtcgagtgaccg Protospacer
************* * *********...*.
724. spacer 2.102|1122798|32|CP023014|PILER-CR matches to MN694285 (Marine virus AFVG_250M134, complete genome) position: , mismatch: 8, identity: 0.75
tccatcaccatggcctgctggtcgagcagctt CRISPR spacer
tctatcgccatggcctgctggtcgaaggcatc Protospacer
**.***.******************. . *.
725. spacer 2.102|1122798|32|CP023014|PILER-CR matches to NZ_CP025410 (Paracoccus sp. BM15 plasmid pBM152, complete sequence) position: , mismatch: 8, identity: 0.75
tccatcaccatggcctgctggtcgagcagctt CRISPR spacer
tggtccgccatggcctgatggtcgatcagctc Protospacer
* .*.********** ******* *****.
726. spacer 2.102|1122798|32|CP023014|PILER-CR matches to NZ_CP025410 (Paracoccus sp. BM15 plasmid pBM152, complete sequence) position: , mismatch: 8, identity: 0.75
tccatcaccatggcctgctggtcgagcagctt CRISPR spacer
tggtccgccatggcctgatggtcgatcagctc Protospacer
* .*.********** ******* *****.
727. spacer 2.102|1122798|32|CP023014|PILER-CR matches to NZ_AP017657 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_3, complete sequence) position: , mismatch: 8, identity: 0.75
tccatcaccatggcctgctggtcgagcagctt CRISPR spacer
gccgcgagcatggcctgctgctcgagctgctg Protospacer
**.. * ************ ****** ***
728. spacer 2.102|1122798|32|CP023014|PILER-CR matches to NZ_CP005191 (Sphingobium sp. MI1205 plasmid pMI2, complete sequence) position: , mismatch: 8, identity: 0.75
tccatcaccatggcctgctggtcgagcagctt CRISPR spacer
gccgcgagcatggcctgctgctcgagctgctg Protospacer
**.. * ************ ****** ***
729. spacer 1.2|1109378|33|CP023014|CRISPRCasFinder,CRT matches to NZ_CP015744 (Shinella sp. HZN7 plasmid pShin-08, complete sequence) position: , mismatch: 9, identity: 0.727
gttggtgcggggcttgcgcctattgcctctgat CRISPR spacer
ggccctgcggggcttgcgactattgcctcaagg Protospacer
* . ************* ********** ..
730. spacer 1.6|1109623|31|CP023014|CRT matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71
cggtgtgcctggcgggcgtcagcttcgttgt CRISPR spacer
accgatgccgggcggccgtcagcttcgtcat Protospacer
.**** ***** ************..*
731. spacer 1.6|1109623|31|CP023014|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 9, identity: 0.71
cggtgtgcctggcgggcgtcagcttcgttgt CRISPR spacer
tcgtgtgcttgtcgggcgtcagcttgagggc Protospacer
. ******.** ************* . *.
732. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP015089 (Pelagibaca abyssi strain JLT2014 plasmid pPABY5, complete sequence) position: , mismatch: 9, identity: 0.727
ggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
cgagctggcggcgctggtcgcgcgccccacgga Protospacer
************ * ********* **.
733. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 9, identity: 0.727
ggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
gacgacatcggcggtcgtcgcgcccgagacgaa Protospacer
*. * .. *************** **** ***
734. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 9, identity: 0.727
ggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
ggaacaggcggcggtcgtcgcgcgagtctccgc Protospacer
***.* ****************** * .* ..
735. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to KY471269 (Gordonia phage DinoDaryn, complete genome) position: , mismatch: 9, identity: 0.727
ggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
ggagctggcggcggtcgtgtcgcggatgctccg Protospacer
****************** **** . **.
736. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to MT553344 (Gordonia phage TZGordon, complete genome) position: , mismatch: 9, identity: 0.727
ggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
ggagctggcggcggtcgtgtcgcggatgctccg Protospacer
****************** **** . **.
737. spacer 1.9|1109804|33|CP023014|CRT,CRISPRCasFinder matches to KY471268 (Gordonia phage Huffy, complete genome) position: , mismatch: 9, identity: 0.727
ggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
ggagctggcggcggtcgtgtcgcggatgctccg Protospacer
****************** **** . **.
738. spacer 1.10|1109866|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
atttccgggatctgctgcatggcgttgttgac CRISPR spacer
acttcctgcatctgctgcatggcgtggagccg Protospacer
*.**** * **************** *
739. spacer 1.10|1109866|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
atttccgggatctgctgcatggcgttgttgac CRISPR spacer
acttcctgcatctgctgcatggcgtggagccg Protospacer
*.**** * **************** *
740. spacer 1.12|1109987|32|CP023014|CRT,CRISPRCasFinder matches to NC_020542 (Sphingomonas sp. MM-1 plasmid pISP0, complete sequence) position: , mismatch: 9, identity: 0.719
ctttccaatcatccgaacggcagagattggtg CRISPR spacer
caagtcaatcatgcgaacggcagagagtgtga Protospacer
* .******* ************* ** .
741. spacer 1.12|1109987|32|CP023014|CRT,CRISPRCasFinder matches to MN034519 (Leviviridae sp. isolate H2_Rhizo_Litter_49_scaffold_19647 sequence) position: , mismatch: 9, identity: 0.719
ctttccaatcatccgaacggcagagattggtg CRISPR spacer
ccatccaatcagccgaacgccagagaccagcc Protospacer
*. ******** ******* ******...*.
742. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 9, identity: 0.719
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
gcgcttgcgcctgcgccgcgcgaacgaggttc Protospacer
****.***** *************. * .
743. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP026518 (Deinococcus sp. NW-56 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
cgagggactccagcgccgcgcgttcacgtcga Protospacer
* . .* ************* ********
744. spacer 1.14|1110109|32|CP023014|CRT,CRISPRCasFinder matches to NC_009339 (Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence) position: , mismatch: 9, identity: 0.719
cggctcggcaaaggcaacgcccgcctggtcct CRISPR spacer
caatgcgacaaaggcaacgcctgcctgggctg Protospacer
*... **.*************.****** *.
745. spacer 1.15|1110170|32|CP023014|CRT,CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.719
gatgaggcgctggcccgccagctccggccgct CRISPR spacer
gtggcggcgctggcccgcgcgctccggctcac Protospacer
* * ************* ********. .
746. spacer 1.15|1110170|32|CP023014|CRT,CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.719
gatgaggcgctggcccgccagctccggccgct CRISPR spacer
gtggcggcgctggcccgcgcgctccggctcac Protospacer
* * ************* ********. .
747. spacer 1.15|1110170|32|CP023014|CRT,CRISPRCasFinder matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
gatgaggcgctggcccgccagctccggccgct CRISPR spacer
agtgaggcgcttgccggccagctccatctctt Protospacer
..********* *** *********. *. .*
748. spacer 1.15|1110170|32|CP023014|CRT,CRISPRCasFinder matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.719
gatgaggcgctggcccgccagctccggccgct CRISPR spacer
agtgaggcgcttgccggccagctccatctctt Protospacer
..********* *** *********. *. .*
749. spacer 1.15|1110170|32|CP023014|CRT,CRISPRCasFinder matches to MK059749 (Mycobacterium phage CRB2, complete genome) position: , mismatch: 9, identity: 0.719
gatgaggcgctggcccgccagctccggccgct CRISPR spacer
ggcccggcgcttgcccgccagctccagcgccc Protospacer
*.. ****** *************.** *.
750. spacer 1.15|1110170|32|CP023014|CRT,CRISPRCasFinder matches to NC_043767 (Mycobacterium virus TA17a, complete genome) position: , mismatch: 9, identity: 0.719
gatgaggcgctggcccgccagctccggccgct CRISPR spacer
acggcggcgcttgcccgccagctccagcgccc Protospacer
. * ****** *************.** *.
751. spacer 1.15|1110170|32|CP023014|CRT,CRISPRCasFinder matches to NC_019410 (Caulobacter phage CcrKarma, complete genome) position: , mismatch: 9, identity: 0.719
gatgaggcgctggcccgccagctccggccgct CRISPR spacer
cagcaacggctggcacgccagcgccggccgcc Protospacer
* *. ****** ******* ********.
752. spacer 1.15|1110170|32|CP023014|CRT,CRISPRCasFinder matches to KR997932 (Mycobacterium phage Godines, complete genome) position: , mismatch: 9, identity: 0.719
gatgaggcgctggcccgccagctccggccgct CRISPR spacer
acggcggcgcttgcccgccagctccagcgccc Protospacer
. * ****** *************.** *.
753. spacer 1.16|1110231|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP043960 (Streptomyces tendae strain 139 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cagcttgtcgcgcgcgtcatcgtccagactgt CRISPR spacer
gcggacgtcgagcgcgtcatcgtcaagacgct Protospacer
* .**** ************* **** *
754. spacer 1.19|1110414|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gccattgcacatggccgagcggccccgccgct CRISPR spacer
gacatggcacatgggcgagcggcccgaacaag Protospacer
* *** ******** ********** . *.
755. spacer 1.19|1110414|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 9, identity: 0.719
gccattgcacatggccgagcggccccgccgct CRISPR spacer
gcaattgcgcatggccgagcggctcaagattt Protospacer
** *****.**************.* . .*
756. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
ctgcccggcgacggcacggaggccttcctgcg Protospacer
..******** ******** ****** .*
757. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
ctgcccggcgacggcacggaggccttcctgcg Protospacer
..******** ******** ****** .*
758. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP012575 (Clavibacter michiganensis subsp. capsici strain PF008 plasmid pCM2, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
acgtccggcgccggcacggcggccggcgcgga Protospacer
**.******.************* .**.
759. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
tcgcccgccgtcgtcacggcggcggatgggaa Protospacer
******* ***** ********* . **
760. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to CP048046 (Clavibacter michiganensis subsp. capsici strain 1207 plasmid pCM2_1207, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
acgtccggcgccggcacggcggccggcgcgga Protospacer
**.******.************* .**.
761. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP048050 (Clavibacter michiganensis subsp. capsici strain 1101 plasmid pCM2_1101, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
acgtccggcgccggcacggcggccggcgcgga Protospacer
**.******.************* .**.
762. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP048048 (Clavibacter michiganensis subsp. capsici strain 1106 plasmid pCM2_1106, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
acgtccggcgccggcacggcggccggcgcgga Protospacer
**.******.************* .**.
763. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to MN234182 (Mycobacterium phage Geraldini, complete genome) position: , mismatch: 9, identity: 0.719
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
cggcccggcgtcggctcgtcggcctggcgcac Protospacer
. ************* ** ****** * *.
764. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to MN284895 (Mycobacterium phage Marshawn, complete genome) position: , mismatch: 9, identity: 0.719
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
aagcccggcgtcggcccggcgggctcgctgtc Protospacer
************* ****** **.* .* .
765. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NC_014458 (Mycobacterium phage Angelica, complete genome) position: , mismatch: 9, identity: 0.719
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
cggcccggcgtcggctcgtcggcctggcgcac Protospacer
. ************* ** ****** * *.
766. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to NC_042031 (Mycobacterium phage Anaya, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
cggcccggcgtcggctcgtcggcctggcgcac Protospacer
. ************* ** ****** * *.
767. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to MG962364 (Mycobacterium phage Deby, complete genome) position: , mismatch: 9, identity: 0.719
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
cggcccggcgtcggctcgtcggcctggcgcac Protospacer
. ************* ** ****** * *.
768. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to MF919532 (Mycobacterium phage Sulley, complete genome) position: , mismatch: 9, identity: 0.719
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
cggcccggcgtcggctcgtcggcctggcgcac Protospacer
. ************* ** ****** * *.
769. spacer 1.20|1110475|32|CP023014|CRT,CRISPRCasFinder matches to MH371113 (Mycobacterium phage Beezoo, complete genome) position: , mismatch: 9, identity: 0.719
tcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
cggcccggcgtcggctcgtcggcctggcgcac Protospacer
. ************* ** ****** * *.
770. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP010590 (Phaeobacter gallaeciensis strain P11 plasmid pP11_b, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcagccatcctcgccttgccggtctttttg Protospacer
. .* ************* ****** ** *
771. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP010611 (Phaeobacter inhibens strain P92 plasmid pP92_a, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcagccatcctcgccttgccggtctttttg Protospacer
. .* ************* ****** ** *
772. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP035422 (Leisingera sp. NJS204 plasmid unnamed5, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcagccatcctcgccttgccggtctttttg Protospacer
. .* ************* ****** ** *
773. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP021042 (Phaeobacter gallaeciensis strain P129 plasmid pP129_b, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcggccatcctcgccttgccggtcttcctg Protospacer
. .* ************* ****** ** *
774. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP038240 (Leisingera sp. NJS201 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcagccatcctcgccttgccggtctttttg Protospacer
. .* ************* ****** ** *
775. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP010675 (Phaeobacter gallaeciensis strain P75 plasmid pP75_b, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcagccatcctcgccttgccggtctttttg Protospacer
. .* ************* ****** ** *
776. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NC_023148 (Phaeobacter gallaeciensis DSM 26640 plasmid pGal_B134, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcagccatcctcgccttgccggtctttttg Protospacer
. .* ************* ****** ** *
777. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP021916 (Sagittula sp. P11 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcggccatcctcgccttgccggtcttcctg Protospacer
. .* ************* ****** ** *
778. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP010791 (Phaeobacter gallaeciensis strain P63 plasmid pP63_x_draft, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcagccatcctcgccttgccggtctttttg Protospacer
. .* ************* ****** ** *
779. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP010870 (Confluentimicrobium sp. EMB200-NS6 strain EMBL200_NS6 plasmid pNS6001, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcggccatcctcgccttgccggtcttcctg Protospacer
. .* ************* ****** ** *
780. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP010631 (Phaeobacter inhibens strain P78 plasmid pP78_b, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcagccatcctcgccttgccggtctttttg Protospacer
. .* ************* ****** ** *
781. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP010716 (Phaeobacter piscinae strain P18 plasmid pP18_a, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcagccatcctcgccttgccggtctttttg Protospacer
. .* ************* ****** ** *
782. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP010658 (Phaeobacter piscinae strain P71 plasmid pP71_b, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcggccatcctcgccttgccggtcttcctg Protospacer
. .* ************* ****** ** *
783. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP043619 (Rhodobacteraceae bacterium SH-1 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcggccatcctcgccttgccggtcttcctg Protospacer
. .* ************* ****** ** *
784. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP010601 (Phaeobacter inhibens strain P83 plasmid pP83_b, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcagccatcctcgccttgccggtctttttg Protospacer
. .* ************* ****** ** *
785. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP010619 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_b, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcagccatcctcgccttgccggtctttttg Protospacer
. .* ************* ****** ** *
786. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NC_009957 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI03, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcggccatcctcgccttgccggtcttcctg Protospacer
. .* ************* ****** ** *
787. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP010727 (Phaeobacter inhibens strain P88 plasmid pP88_b, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcagccatcctcgccttgccggtctttttg Protospacer
. .* ************* ****** ** *
788. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NC_009955 (Dinoroseobacter shibae DFL 12 = DSM 16493 plasmid pDSHI01, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcggccatcctcgccttgccggtcttcctg Protospacer
. .* ************* ****** ** *
789. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP010638 (Phaeobacter gallaeciensis strain P73 plasmid pP73_b, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcagccatcctcgccttgccggtctttttg Protospacer
. .* ************* ****** ** *
790. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP010770 (Phaeobacter piscinae strain P13 plasmid pP13_c, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcagccatcctcgccttgccggtctttttg Protospacer
. .* ************* ****** ** *
791. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP010707 (Phaeobacter inhibens strain P66 plasmid pP66_b, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcagccatcctcgccttgccggtctttttg Protospacer
. .* ************* ****** ** *
792. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP014798 (Salipiger profundus strain JLT2016 plasmid pTPRO2, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcggccatcctcgccttgccggtcttcctg Protospacer
. .* ************* ****** ** *
793. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP010662 (Phaeobacter inhibens strain P74 plasmid pP74_a, complete sequence) position: , mismatch: 9, identity: 0.719
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
ttgcagccatcctcgccttgccggtctttttg Protospacer
. .* ************* ****** ** *
794. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_LR594668 (Variovorax sp. SRS16 plasmid 3) position: , mismatch: 9, identity: 0.735
aggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
ccgcggcagcggcgcgcgtcgcgcgcgagccgac Protospacer
* * ..****** *****************.
795. spacer 1.28|1109803|34|CP023014|PILER-CR matches to KU998238 (Gordonia phage Splinter, complete genome) position: , mismatch: 9, identity: 0.735
aggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
cggagctggcggcggtcgtgtcgcggatgctgcg Protospacer
****************** **** . **.*
796. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NC_030911 (Gordonia phage Vendetta, complete genome) position: , mismatch: 9, identity: 0.735
aggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
cggagctggcggcggtcgtgtcgcggatgctgcg Protospacer
****************** **** . **.*
797. spacer 1.29|1109865|33|CP023014|PILER-CR matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 9, identity: 0.727
gatttccgggatctgctgcatggcgttgttgac CRISPR spacer
catttcctgcatctgctgcatggcgtcgagccg Protospacer
****** * ****************.*
798. spacer 1.29|1109865|33|CP023014|PILER-CR matches to AB276040 (Ralstonia phage RSA1 DNA, complete genome) position: , mismatch: 9, identity: 0.727
gatttccgggatctgctgcatggcgttgttgac CRISPR spacer
agtatccgggagcggctgcatggcgttgtcata Protospacer
..* ******* * ***************..
799. spacer 1.29|1109865|33|CP023014|PILER-CR matches to NC_009382 (Ralstonia phage phiRSA1, complete genome) position: , mismatch: 9, identity: 0.727
gatttccgggatctgctgcatggcgttgttgac CRISPR spacer
agtatccgggagcggctgcatggcgttgtcata Protospacer
..* ******* * ***************..
800. spacer 1.32|1110047|33|CP023014|PILER-CR matches to NC_015382 (Burkholderia gladioli BSR3 plasmid bgla_1p, complete sequence) position: , mismatch: 9, identity: 0.727
gccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
cgagttcgcgacagcgccgcgcgaactcgaagg Protospacer
*.***** *************** ** *.
801. spacer 1.32|1110047|33|CP023014|PILER-CR matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 9, identity: 0.727
gccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ggcgcttgcgcctgcgccgcgcgaacgaggttc Protospacer
* ****.***** *************. * .
802. spacer 1.33|1110108|33|CP023014|PILER-CR matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 9, identity: 0.727
gcggctcggcaaaggcaacgcccgcctggtcct CRISPR spacer
cacgctcggcgaaggcatcgcccgcctgctgtc Protospacer
*******.****** ********** * ..
803. spacer 1.34|1110169|33|CP023014|PILER-CR matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.727
ggatgaggcgctggcccgccagctccggccgct CRISPR spacer
accggcggcgctggcccgccaggtcctgccggc Protospacer
. * **************** *** **** .
804. spacer 1.35|1110230|33|CP023014|PILER-CR matches to NZ_CP014688 (Acetobacter persici strain TMW2.1084 plasmid pAC1084_1, complete sequence) position: , mismatch: 9, identity: 0.727
gcagcttgtcgcgcgcgtcatcgtccagactgt CRISPR spacer
ctgtctggtcgcgcgcgtcagcgtccagcgttt Protospacer
.. ** ************* ******* * *
805. spacer 1.39|1110474|33|CP023014|PILER-CR matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gctgcccggcgacggcacggaggccttcctgcg Protospacer
*..******** ******** ****** .*
806. spacer 1.39|1110474|33|CP023014|PILER-CR matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.727
gtcgcccggcgtcggcacggcggccttgacgat CRISPR spacer
gctgcccggcgacggcacggaggccttcctgcg Protospacer
*..******** ******** ****** .*
807. spacer 2.4|1120484|33|CP023014|PILER-CR matches to NZ_CP014690 (Gluconobacter albidus strain TMW2.1191 plasmid pGS1191_1, complete sequence) position: , mismatch: 9, identity: 0.727
gattgggcatcagcaggtcgagccgggggcgga CRISPR spacer
ccttggccatcagcaggtcgagcggggaaagac Protospacer
**** **************** ***.. *.
808. spacer 2.4|1120484|33|CP023014|PILER-CR matches to NZ_CP035514 (Haematobacter massiliensis strain OT1 plasmid pOT1-4, complete sequence) position: , mismatch: 9, identity: 0.727
gattgggcatcagcaggtcgagccgggggcgga CRISPR spacer
ccgcgcggatcagcaggccgagccgggtgcggg Protospacer
.* * *********.********* ****.
809. spacer 2.9|1120297|32|CP023014|CRISPRCasFinder,CRT matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 9, identity: 0.719
cgttcatagaccgtcaccacgtccgcgggctg CRISPR spacer
gcatcgaagaccgtcacctcgtcggcgggcgt Protospacer
**. *********** **** ******
810. spacer 2.11|1120419|31|CP023014|CRISPRCasFinder matches to MN694345 (Marine virus AFVG_250M178, complete genome) position: , mismatch: 9, identity: 0.71
tcgattccgatgggatttgtcgacctggatg CRISPR spacer
atgcctccgatggaatttgtcgacatggtca Protospacer
.* .********.********** *** ..
811. spacer 2.11|1120419|31|CP023014|CRISPRCasFinder matches to MN694528 (Marine virus AFVG_250M165, complete genome) position: , mismatch: 9, identity: 0.71
tcgattccgatgggatttgtcgacctggatg CRISPR spacer
atgcctccgatggaatttgtcgacatggtca Protospacer
.* .********.********** *** ..
812. spacer 2.12|1120479|32|CP023014|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
attgggcatcagcaggtcgagccgggggcgga CRISPR spacer
gcgcgcggtcagcaggtcgaccagggggcgga Protospacer
.. * .************ * *********
813. spacer 2.12|1120479|32|CP023014|CRISPRCasFinder matches to NZ_CP053023 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-B-Sy, complete sequence) position: , mismatch: 9, identity: 0.719
attgggcatcagcaggtcgagccgggggcgga CRISPR spacer
atactgcatcagcatgtcgagccggaggaatc Protospacer
** ********* **********.** .
814. spacer 2.14|1120601|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP006373 (Aureimonas sp. AU20 plasmid pAU20f, complete sequence) position: , mismatch: 9, identity: 0.719
ccgttctgcccggtgctcacgatcggcgcggt CRISPR spacer
agcatcggcccggtgcgcacgatcggcgcccc Protospacer
** ********* ************ .
815. spacer 2.17|1120783|32|CP023014|CRISPRCasFinder,CRT matches to NZ_AP018723 (Thiomicrorhabdus aquaedulcis strain HaS4 plasmid pTmrp1, complete sequence) position: , mismatch: 9, identity: 0.719
tagccatgttcccactgctgggcatgctcgct CRISPR spacer
gagccatcttcccaatgctgggcaatgttaat Protospacer
****** ****** ********* *.. *
816. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP025017 (Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence) position: , mismatch: 9, identity: 0.719
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
gtgaaggagatgctgcgtctcgtcaggctcga Protospacer
*** ****************** .* *
817. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to NC_012854 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132505, complete sequence) position: , mismatch: 9, identity: 0.719
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
gtgaaggagatgctgcgtctcgtcaggctcga Protospacer
*** ****************** .* *
818. spacer 2.22|1121087|32|CP023014|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
gactacgcggccgcgcagaggcgcatccgtga CRISPR spacer
cgaaccgttgccgcgcagaggcggatccgaga Protospacer
. **. ************** ***** **
819. spacer 2.22|1121087|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 9, identity: 0.719
gactacgcggccgcgcagaggcgcatccgtga CRISPR spacer
cgcgatgcggccccgcagcggcgcatccggct Protospacer
.* *.****** ***** **********
820. spacer 2.24|1121209|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP026546 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed2) position: , mismatch: 9, identity: 0.719
tagacgaggcccagcgcgccctgtcggcgctg CRISPR spacer
tgacttcggcccagcgcgccttctcggcgcgg Protospacer
*.. . *************.* ******* *
821. spacer 2.27|1121392|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.719
aaccgcagcgaggtgatccttgcgcacacgcc CRISPR spacer
gagcgcatcgaggtgatcctcgcgcatgagaa Protospacer
.* **** ************.*****.. *
822. spacer 2.30|1121575|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP053575 (Citrobacter sp. TSA-1 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgttcacttcgcgcacggcggcaacctgac CRISPR spacer
gtggatcagatcgcgcacggcggcaaccggct Protospacer
* *** ****************** * .
823. spacer 2.30|1121575|32|CP023014|CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgttcacttcgcgcacggcggcaacctgac CRISPR spacer
gtgggctacctcgcgaacggcggcaacctggc Protospacer
* ..**.***** **************.*
824. spacer 2.31|1121636|33|CP023014|CRISPRCasFinder,CRT matches to NC_011892 (Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence) position: , mismatch: 9, identity: 0.727
gacgtgagcgagggcgaggacgtgacctacctg CRISPR spacer
gacgtgagcaaggccgaggacgtgaaggcggcg Protospacer
*********.*** *********** .*
825. spacer 2.32|1121698|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP023066 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631d, complete sequence) position: , mismatch: 9, identity: 0.719
aagagccaggccgctcctggcgcaccgaactt CRISPR spacer
aagagccaggccgctcacggcgcaaattgcca Protospacer
**************** .****** .*.
826. spacer 2.32|1121698|32|CP023014|CRISPRCasFinder,CRT matches to NC_008712 (Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence) position: , mismatch: 9, identity: 0.719
aagagccaggccgctcctggcgcaccgaactt CRISPR spacer
atgcaccaggccgctcctggcgccctgatgca Protospacer
* * .****************** *.** .
827. spacer 2.33|1121759|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 9, identity: 0.719
attgaccagcaggaagaggtcatcaagcgcgc CRISPR spacer
ccgggtcggcaggaagagctgatcaagcgcgt Protospacer
. *..*.********** * **********.
828. spacer 2.33|1121759|32|CP023014|CRISPRCasFinder,CRT matches to NC_007901 (Rhodoferax ferrireducens T118 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
attgaccagcaggaagaggtcatcaagcgcgc CRISPR spacer
ccggaccagcaggacgtggtcatcaaaaacgt Protospacer
. *********** * *********. .**.
829. spacer 2.37|1122003|32|CP023014|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
gcgcccggcaccacgaccaccggcagttcctg Protospacer
. . ******* ******.*********.*
830. spacer 2.37|1122003|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.719
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
gcgcccggcaccacgaccaccggcagttcctg Protospacer
. . ******* ******.*********.*
831. spacer 2.40|1122187|32|CP023014|CRISPRCasFinder,CRT matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 9, identity: 0.719
ccattgtcgggcaagcccgacgtgagccatcc CRISPR spacer
gacgagtcgggcaagcccgacgtcacccagca Protospacer
****************** * *** *
832. spacer 2.42|1122309|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
ccaggcggtgcagctgacgggatcggtggtgc CRISPR spacer
ctgggcggtgcaactgacgcgatcggccgaca Protospacer
*..*********.****** ******. *
833. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
834. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
835. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_KR997898 (Mycobacterium avium subsp. hominissuis strain 88Br plasmid pMA100, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
aggaacatgaggacgcgctggcgatgatggcg Protospacer
** .***.************** ****.
836. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
837. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
838. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
839. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
840. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
841. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
842. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
tggcgatcgacaacgcgctggcgacccagtgc Protospacer
.*** ***** *************. * *
843. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
844. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
845. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
846. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
847. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
848. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
849. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
850. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
851. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
852. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
cggccatcgagatcgcgctcgcggagcccaac Protospacer
************ ****** ***. **. .
853. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
854. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
855. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
856. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
cgcggcgcgagaaggcgatggcgatgctggtg Protospacer
** ****** *** ************..
857. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
agcgccgcgagaaggcgatggcgatgctggtg Protospacer
* * ****** *** ************..
858. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
859. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
860. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
861. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
862. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
863. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
864. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
865. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
866. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
867. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
868. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
869. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
870. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
871. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
872. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
873. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
874. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
875. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
876. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
877. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
878. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
879. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
aggaacatgaggacgcgctggcgatgatggcc Protospacer
** .***.************** ****
880. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
881. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
882. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
883. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
884. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
885. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
886. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
887. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
888. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
889. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
890. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
891. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
892. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
893. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
894. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
895. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
896. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
897. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
898. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
899. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
900. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to MF140403 (Mycobacterium phage Changeling, complete genome) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
aggccatcgcgaacgcggtggcgaccttcgtc Protospacer
******** ******* ******. .* *.
901. spacer 2.44|1122431|32|CP023014|CRISPRCasFinder,CRT matches to MN694546 (Marine virus AFVG_250M837, complete genome) position: , mismatch: 9, identity: 0.719
cggctttatatgccggccggcagctgctacat CRISPR spacer
ccgctttatttgccggacggcagctctaccgc Protospacer
* ******* ****** ******** . *..
902. spacer 2.45|1122492|32|CP023014|CRISPRCasFinder,CRT matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
gttctgatcatcgaggacgatccgctccatcg Protospacer
. * **************..********. .
903. spacer 2.45|1122492|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
accgagatgatcgaggacggcctgctcgaact Protospacer
* **** *************.**** *
904. spacer 2.45|1122492|32|CP023014|CRISPRCasFinder,CRT matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
gagcagatcatcgacgacggaccgccacgccg Protospacer
************ ***** ****. *.* .
905. spacer 2.49|1122731|32|CP023014|CRISPRCasFinder,CRT matches to NC_015383 (Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence) position: , mismatch: 9, identity: 0.719
ttgatgcgggtcaggaaatcgctcgactcctg CRISPR spacer
aatacgtggttcaggaaatcgctcgacgccgt Protospacer
*.*.** ***************** **
906. spacer 2.50|1122792|32|CP023014|CRISPRCasFinder,CRT matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719
tccatcaccatggcctgctggtcgagcagctt------- CRISPR spacer
tccatctccagggcctgctggt-------cttcgcccac Protospacer
****** *** *********** ***
907. spacer 2.51|1122853|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
cgtgcagcgcgccaggcgcggtagatagcatc CRISPR spacer
actgcatcgcgccaggcgctgtagagacgaga Protospacer
**** ************ ***** * *
908. spacer 2.52|1122914|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
ccgcccgtggcctgccagcacgtcgccatcgg CRISPR spacer
gggcccgtggccggccagaacgtcgggcgcag Protospacer
********** ***** ****** *.*
909. spacer 2.54|1123036|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.719
actcggagatcgaacgattcatcgaggcatcc CRISPR spacer
acgaggagatcgaaggcttcatcgaggaggtg Protospacer
** ********** * ********** . .
910. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc Protospacer
***************** **.** *.. *
911. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc Protospacer
***************** **.** *.. *
912. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc Protospacer
***************** **.** *.. *
913. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc Protospacer
***************** **.** *.. *
914. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc Protospacer
***************** **.** *.. *
915. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc Protospacer
***************** **.** *.. *
916. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc Protospacer
***************** **.** *.. *
917. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc Protospacer
***************** **.** *.. *
918. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc Protospacer
***************** **.** *.. *
919. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc Protospacer
***************** **.** *.. *
920. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc Protospacer
***************** **.** *.. *
921. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc Protospacer
***************** **.** *.. *
922. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc Protospacer
***************** **.** *.. *
923. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggcggtcggcgcaggtgccgaggcgggc Protospacer
***************** **.** *.. *
924. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg Protospacer
***** *********** ***** . * *..
925. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK016499 (Mycobacterium phage Mangethe, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg Protospacer
***** *********** ***** . * *..
926. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK919480 (Mycobacterium phage Techage, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg Protospacer
***** *********** ***** . * *..
927. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT024866 (Mycobacterium phage Willsammy, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg Protospacer
***** *********** ***** . * *..
928. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN892486 (Mycobacterium phage KilKor, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg Protospacer
***** *********** ***** . * *..
929. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN234172 (Mycobacterium phage ThulaThula, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggaaccggcgcgctcaacatcgacgcctg Protospacer
*****.*********** ***** . * *..
930. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK494122 (Mycobacterium phage GreaseLightnin, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg Protospacer
***** *********** ***** . * *..
931. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX641262 (Mycobacterium phage Nazo, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
catggcaccggcgcgctgaacatcgacgcctg Protospacer
**.** ***************** . * *..
932. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT897904 (Mycobacterium phage Royals2015, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgacgggtg Protospacer
***** *********** ***** . * * ..
933. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG920060 (Mycobacterium phage Bob3, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg Protospacer
***** *********** ***** . * *..
934. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to EU816588 (Mycobacterium phage Porky, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg Protospacer
***** *********** ***** . * *..
935. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgacgggtg Protospacer
***** *********** ***** . * * ..
936. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN096356 (Mycobacterium phage Bunnies, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg Protospacer
***** *********** ***** . * *..
937. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT771343 (Gordonia phage Clown, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgtgctgaacatcgacgggtg Protospacer
***** *******.********* . * * ..
938. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK820638 (Mycobacterium phage HermioneGrange, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg Protospacer
***** *********** ***** . * *..
939. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX522649 (Mycobacterium phage Bircsak, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
catggcaccggcgcgctgaacatcgacgcctg Protospacer
**.** ***************** . * *..
940. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT310893 (Mycobacterium phage DRBy19, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgacgggtg Protospacer
***** *********** ***** . * * ..
941. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF919492 (Mycobacterium phage Arib1, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg Protospacer
***** *********** ***** . * *..
942. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX522943 (Mycobacterium phage Gompeii16, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
catggcaccggcgcgctgaacatcgacgcctg Protospacer
**.** ***************** . * *..
943. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN807249 (Mycobacterium phage Megiddo, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgacgactg Protospacer
***** *********** ***** . * .*..
944. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JF412297 (EBPR siphovirus 2, partial sequence) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacgggaccggcgcgatcaacatcgacgcctg Protospacer
*************** * ***** . * *..
945. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT639654 (Mycobacterium phage Jerm2, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg Protospacer
***** *********** ***** . * *..
946. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KC691256 (Mycobacterium phage Fishburne, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg Protospacer
***** *********** ***** . * *..
947. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JN382248 (Mycobacterium phage Lilac, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggaaccggcgcgctcaacatcgacgcctg Protospacer
*****.*********** ***** . * *..
948. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF472894 (Mycobacterium phage Majeke, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg Protospacer
***** *********** ***** . * *..
949. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH450113 (Mycobacterium phage BigMau, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg Protospacer
***** *********** ***** . * *..
950. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_023692 (Mycobacterium phage BigNuz, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
catggcaccggcgcgctgaacatcgacgcctg Protospacer
**.** ***************** . * *..
951. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF281061 (Mycobacterium phage Ksquared, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg Protospacer
***** *********** ***** . * *..
952. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KC691255 (Mycobacterium phage Dumbo, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg Protospacer
***** *********** ***** . * *..
953. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH450130 (Mycobacterium phage Rohr, complete genome) position: , mismatch: 9, identity: 0.719
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
cacggcaccggcgcgctcaacatcgacgcctg Protospacer
***** *********** ***** . * *..
954. spacer 2.65|1123707|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031947 (Ruegeria sp. AD91A plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gaaggcgataccctgctgctgaacctgccgga CRISPR spacer
atcggctttaccctgctgctgaacctgatcgg Protospacer
. *** ******************* . *.
955. spacer 2.65|1123707|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_006362 (Nocardia farcinica IFM 10152 plasmid pNF1, complete sequence) position: , mismatch: 9, identity: 0.719
gaaggcgataccctgctgctgaacctgccgga CRISPR spacer
aactgcgagatcctgctgctgaacctggctcc Protospacer
.* **** *.**************** *
956. spacer 2.65|1123707|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 9, identity: 0.719
gaaggcgataccctgctgctgaacctgccgga CRISPR spacer
ctggacgataccctgcggctgagcctgctgcc Protospacer
.*.*********** *****.*****.*
957. spacer 2.65|1123707|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022751 (Sphingobium hydrophobicum strain C1 plasmid p5, complete sequence) position: , mismatch: 9, identity: 0.719
gaaggcgataccctgctgctgaacctgccgga CRISPR spacer
ggcgatgataacccgctgctgaacctgccaac Protospacer
*. *..**** **.***************..
958. spacer 2.65|1123707|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gaaggcgataccctgctgctgaacctgccgga CRISPR spacer
gcgcgcggcaccctgctgctgaacctgtgcaa Protospacer
* . ***..******************. .*
959. spacer 2.66|1123768|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 9, identity: 0.719
ccgcgcgaggtctgggcggccgagttccgcga CRISPR spacer
gcgcgcgaggtctcggtggccgaggactaccg Protospacer
************ **.******* *..* .
960. spacer 2.68|1120480|31|CP023014|CRT matches to NZ_CP053023 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-B-Sy, complete sequence) position: , mismatch: 9, identity: 0.71
ttgggcatcagcaggtcgagccgggggcgga CRISPR spacer
tactgcatcagcatgtcgagccggaggaatc Protospacer
* ********* **********.** .
961. spacer 2.70|1120966|31|CP023014|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 9, identity: 0.71
aattgggcgcactgagcaacggcctgcacgc CRISPR spacer
tcaccaacgcactgatcaacgacctgcacgc Protospacer
. ..******** *****.*********
962. spacer 2.73|1121032|32|CP023014|PILER-CR matches to NZ_CP025017 (Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence) position: , mismatch: 9, identity: 0.719
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
gtgaaggagatgctgcgtctcgtcaggctcga Protospacer
*** ****************** .* *
963. spacer 2.73|1121032|32|CP023014|PILER-CR matches to NC_012854 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132505, complete sequence) position: , mismatch: 9, identity: 0.719
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
gtgaaggagatgctgcgtctcgtcaggctcga Protospacer
*** ****************** .* *
964. spacer 2.74|1121093|32|CP023014|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
gactacgcggccgcgcagaggcgcatccgtga CRISPR spacer
cgaaccgttgccgcgcagaggcggatccgaga Protospacer
. **. ************** ***** **
965. spacer 2.74|1121093|32|CP023014|PILER-CR matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 9, identity: 0.719
gactacgcggccgcgcagaggcgcatccgtga CRISPR spacer
cgcgatgcggccccgcagcggcgcatccggct Protospacer
.* *.****** ***** **********
966. spacer 2.76|1121215|32|CP023014|PILER-CR matches to NZ_CP026546 (Cupriavidus metallidurans strain Ni-2 plasmid unnamed2) position: , mismatch: 9, identity: 0.719
tagacgaggcccagcgcgccctgtcggcgctg CRISPR spacer
tgacttcggcccagcgcgccttctcggcgcgg Protospacer
*.. . *************.* ******* *
967. spacer 2.79|1121398|32|CP023014|PILER-CR matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 9, identity: 0.719
aaccgcagcgaggtgatccttgcgcacacgcc CRISPR spacer
gagcgcatcgaggtgatcctcgcgcatgagaa Protospacer
.* **** ************.*****.. *
968. spacer 2.82|1121581|32|CP023014|PILER-CR matches to NZ_CP053575 (Citrobacter sp. TSA-1 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgttcacttcgcgcacggcggcaacctgac CRISPR spacer
gtggatcagatcgcgcacggcggcaaccggct Protospacer
* *** ****************** * .
969. spacer 2.82|1121581|32|CP023014|PILER-CR matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgcgttcacttcgcgcacggcggcaacctgac CRISPR spacer
gtgggctacctcgcgaacggcggcaacctggc Protospacer
* ..**.***** **************.*
970. spacer 2.83|1121642|33|CP023014|PILER-CR matches to NC_011892 (Methylobacterium nodulans ORS 2060 plasmid pMNOD01, complete sequence) position: , mismatch: 9, identity: 0.727
gacgtgagcgagggcgaggacgtgacctacctg CRISPR spacer
gacgtgagcaaggccgaggacgtgaaggcggcg Protospacer
*********.*** *********** .*
971. spacer 2.84|1121704|32|CP023014|PILER-CR matches to NZ_CP023066 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631d, complete sequence) position: , mismatch: 9, identity: 0.719
aagagccaggccgctcctggcgcaccgaactt CRISPR spacer
aagagccaggccgctcacggcgcaaattgcca Protospacer
**************** .****** .*.
972. spacer 2.84|1121704|32|CP023014|PILER-CR matches to NC_008712 (Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence) position: , mismatch: 9, identity: 0.719
aagagccaggccgctcctggcgcaccgaactt CRISPR spacer
atgcaccaggccgctcctggcgccctgatgca Protospacer
* * .****************** *.** .
973. spacer 2.85|1121765|32|CP023014|PILER-CR matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 9, identity: 0.719
attgaccagcaggaagaggtcatcaagcgcgc CRISPR spacer
ccgggtcggcaggaagagctgatcaagcgcgt Protospacer
. *..*.********** * **********.
974. spacer 2.85|1121765|32|CP023014|PILER-CR matches to NC_007901 (Rhodoferax ferrireducens T118 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
attgaccagcaggaagaggtcatcaagcgcgc CRISPR spacer
ccggaccagcaggacgtggtcatcaaaaacgt Protospacer
. *********** * *********. .**.
975. spacer 2.89|1122009|32|CP023014|PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
gcgcccggcaccacgaccaccggcagttcctg Protospacer
. . ******* ******.*********.*
976. spacer 2.89|1122009|32|CP023014|PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.719
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
gcgcccggcaccacgaccaccggcagttcctg Protospacer
. . ******* ******.*********.*
977. spacer 2.92|1122193|32|CP023014|PILER-CR matches to MH536818 (Gordonia phage Frokostdame, complete genome) position: , mismatch: 9, identity: 0.719
ccattgtcgggcaagcccgacgtgagccatcc CRISPR spacer
gacgagtcgggcaagcccgacgtcacccagca Protospacer
****************** * *** *
978. spacer 2.94|1122315|32|CP023014|PILER-CR matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
ccaggcggtgcagctgacgggatcggtggtgc CRISPR spacer
ctgggcggtgcaactgacgcgatcggccgaca Protospacer
*..*********.****** ******. *
979. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
980. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
981. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_KR997898 (Mycobacterium avium subsp. hominissuis strain 88Br plasmid pMA100, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
aggaacatgaggacgcgctggcgatgatggcg Protospacer
** .***.************** ****.
982. spacer 2.95|1122376|32|CP023014|PILER-CR matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
983. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
984. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
985. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
986. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
987. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
988. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
tggcgatcgacaacgcgctggcgacccagtgc Protospacer
.*** ***** *************. * *
989. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
990. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
991. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
992. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
993. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
994. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
995. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
996. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
997. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
998. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
cggccatcgagatcgcgctcgcggagcccaac Protospacer
************ ****** ***. **. .
999. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1000. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1001. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1002. spacer 2.95|1122376|32|CP023014|PILER-CR matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
cgcggcgcgagaaggcgatggcgatgctggtg Protospacer
** ****** *** ************..
1003. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
agcgccgcgagaaggcgatggcgatgctggtg Protospacer
* * ****** *** ************..
1004. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1005. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1006. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1007. spacer 2.95|1122376|32|CP023014|PILER-CR matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1008. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1009. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1010. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1011. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1012. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1013. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1014. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1015. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1016. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1017. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1018. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1019. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1020. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1021. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1022. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1023. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1024. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1025. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
aggaacatgaggacgcgctggcgatgatggcc Protospacer
** .***.************** ****
1026. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1027. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1028. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1029. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1030. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1031. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1032. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1033. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1034. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1035. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1036. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1037. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1038. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1039. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1040. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1041. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1042. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1043. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1044. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1045. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
ccatctgcgagaacgcgctggccaagctggac Protospacer
* ..* *************** * *****
1046. spacer 2.95|1122376|32|CP023014|PILER-CR matches to MF140403 (Mycobacterium phage Changeling, complete genome) position: , mismatch: 9, identity: 0.719
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
aggccatcgcgaacgcggtggcgaccttcgtc Protospacer
******** ******* ******. .* *.
1047. spacer 2.96|1122437|32|CP023014|PILER-CR matches to MN694546 (Marine virus AFVG_250M837, complete genome) position: , mismatch: 9, identity: 0.719
cggctttatatgccggccggcagctgctacat CRISPR spacer
ccgctttatttgccggacggcagctctaccgc Protospacer
* ******* ****** ******** . *..
1048. spacer 2.97|1122498|32|CP023014|PILER-CR matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
gttctgatcatcgaggacgatccgctccatcg Protospacer
. * **************..********. .
1049. spacer 2.97|1122498|32|CP023014|PILER-CR matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
accgagatgatcgaggacggcctgctcgaact Protospacer
* **** *************.**** *
1050. spacer 2.97|1122498|32|CP023014|PILER-CR matches to NZ_LT960615 (Hartmannibacter diazotrophicus strain E19T plasmid HDIAp1, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
gagcagatcatcgacgacggaccgccacgccg Protospacer
************ ***** ****. *.* .
1051. spacer 2.101|1122737|32|CP023014|PILER-CR matches to NC_015383 (Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence) position: , mismatch: 9, identity: 0.719
ttgatgcgggtcaggaaatcgctcgactcctg CRISPR spacer
aatacgtggttcaggaaatcgctcgacgccgt Protospacer
*.*.** ***************** **
1052. spacer 2.102|1122798|32|CP023014|PILER-CR matches to LT599585 (Pseudomonas veronii 1YdBTEX2 genome assembly, plasmid: PVE_plasmid) position: , mismatch: 9, identity: 0.719
tccatcaccatggcctgctggtcgagcagctt------- CRISPR spacer
tccatctccagggcctgctggt-------cttcgcccac Protospacer
****** *** *********** ***
1053. spacer 1.12|1109987|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP017079 (Novosphingobium resinovorum strain SA1 plasmid pSA4, complete sequence) position: , mismatch: 10, identity: 0.688
ctttccaatcatccgaacggcagagattggtg CRISPR spacer
aaagtcaatcatgcgaacggcagagagtgtga Protospacer
.******* ************* ** .
1054. spacer 1.12|1109987|32|CP023014|CRT,CRISPRCasFinder matches to NZ_AP017660 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_6) position: , mismatch: 10, identity: 0.688
ctttccaatcatccgaacggcagagattggtg CRISPR spacer
aaagtcaatcatgcgaacggcagagagtgtga Protospacer
.******* ************* ** .
1055. spacer 1.12|1109987|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP010958 (Sphingobium sp. YBL2 plasmid 4pYBL2-4, complete sequence) position: , mismatch: 10, identity: 0.688
ctttccaatcatccgaacggcagagattggtg CRISPR spacer
gaagtcaatcatgcgaacggcagagagtgtga Protospacer
.******* ************* ** .
1056. spacer 1.12|1109987|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP013073 (Sphingobium indicum B90A plasmid pSRL3, complete sequence) position: , mismatch: 10, identity: 0.688
ctttccaatcatccgaacggcagagattggtg CRISPR spacer
aaagtcaatcatgcgaacggcagagagtgtga Protospacer
.******* ************* ** .
1057. spacer 1.12|1109987|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP012703 (Sphingopyxis macrogoltabida strain EY-1 isolate activated sludge plasmid 3, complete sequence) position: , mismatch: 10, identity: 0.688
ctttccaatcatccgaacggcagagattggtg CRISPR spacer
aaagtcaatcatgcgaacggcagagagtgtga Protospacer
.******* ************* ** .
1058. spacer 1.12|1109987|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP005090 (Sphingobium sp. TKS plasmid pTK6, complete sequence) position: , mismatch: 10, identity: 0.688
ctttccaatcatccgaacggcagagattggtg CRISPR spacer
aaagtcaatcatgcgaacggcagagagtgtga Protospacer
.******* ************* ** .
1059. spacer 1.12|1109987|32|CP023014|CRT,CRISPRCasFinder matches to NC_020544 (Sphingomonas sp. MM-1 plasmid pISP3, complete sequence) position: , mismatch: 10, identity: 0.688
ctttccaatcatccgaacggcagagattggtg CRISPR spacer
aaagtcaatcatgcgaacggcagagagtgtga Protospacer
.******* ************* ** .
1060. spacer 1.12|1109987|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP047220 (Sphingobium yanoikuyae strain YC-JY1 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
ctttccaatcatccgaacggcagagattggtg CRISPR spacer
gaagtcaatcatgcgaacggcagagagtgtga Protospacer
.******* ************* ** .
1061. spacer 1.14|1110109|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
cggctcggcaaaggcaacgcccgcctggtcct CRISPR spacer
tttctgggcaaaggcaacgccagcctgcctga Protospacer
. ** *************** ***** ..
1062. spacer 1.16|1110231|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP028971 (Aminobacter sp. MSH1 plasmid pUSP3, complete sequence) position: , mismatch: 10, identity: 0.688
cagcttgtcgcgcgcgtcatcgtccagactgt CRISPR spacer
aagcttgtcgagcgcggcatcgtcggagaggg Protospacer
********* ***** ******* ... *
1063. spacer 1.16|1110231|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP030363 (Salinibacter ruber strain SP73 plasmid pSR118, complete sequence) position: , mismatch: 10, identity: 0.688
cagcttgtcgcgcgcgtcatcgtccagactgt CRISPR spacer
ggtcgcatcgcgggcgtcaacgtccagactaa Protospacer
. * ..***** ****** **********.
1064. spacer 1.19|1110414|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gccattgcacatggccgagcggccccgccgct CRISPR spacer
ttttgaggacatggcccagcggccccgacgcg Protospacer
.. * ******** ********** ***
1065. spacer 1.21|1110536|32|CP023014|CRT,CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688
caaccgccatcctcgcctagccggtattggtt CRISPR spacer
cacccgccatcctcgcctcgccgtggccgtcg Protospacer
** *************** **** ...* .
1066. spacer 1.23|1110658|32|CP023014|CRT,CRISPRCasFinder matches to NZ_CP049751 (Rhodococcus fascians A21d2 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
aacgggatcgtcatccacgacaacatcatgca CRISPR spacer
cagtggatcgtcatcgaccacaacatcgacgg Protospacer
* *********** ** ********. .
1067. spacer 1.23|1110658|32|CP023014|CRT,CRISPRCasFinder matches to CP000385 (Mycobacterium sp. MCS Plasmid1, complete sequence) position: , mismatch: 10, identity: 0.688
aacgggatcgtcatccacgacaacatcatgca CRISPR spacer
tcggcagccgtcctccacgaccacatcatgcg Protospacer
* ...**** ******** *********.
1068. spacer 1.23|1110658|32|CP023014|CRT,CRISPRCasFinder matches to NC_008704 (Mycobacterium sp. KMS plasmid pMKMS02, complete sequence) position: , mismatch: 10, identity: 0.688
aacgggatcgtcatccacgacaacatcatgca CRISPR spacer
tcggcagccgtcctccacgaccacatcatgcg Protospacer
* ...**** ******** *********.
1069. spacer 1.28|1109803|34|CP023014|PILER-CR matches to KY471269 (Gordonia phage DinoDaryn, complete genome) position: , mismatch: 10, identity: 0.706
aggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
cggagctggcggcggtcgtgtcgcggatgctccg Protospacer
****************** **** . **.
1070. spacer 1.28|1109803|34|CP023014|PILER-CR matches to MT553344 (Gordonia phage TZGordon, complete genome) position: , mismatch: 10, identity: 0.706
aggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
cggagctggcggcggtcgtgtcgcggatgctccg Protospacer
****************** **** . **.
1071. spacer 1.28|1109803|34|CP023014|PILER-CR matches to KY471268 (Gordonia phage Huffy, complete genome) position: , mismatch: 10, identity: 0.706
aggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
cggagctggcggcggtcgtgtcgcggatgctccg Protospacer
****************** **** . **.
1072. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP015089 (Pelagibaca abyssi strain JLT2014 plasmid pPABY5, complete sequence) position: , mismatch: 10, identity: 0.706
aggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
ccgagctggcggcgctggtcgcgcgccccacgga Protospacer
************ * ********* **.
1073. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_CP010990 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-1, complete sequence) position: , mismatch: 10, identity: 0.706
aggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
cgacgacatcggcggtcgtcgcgcccgagacgaa Protospacer
*. * .. *************** **** ***
1074. spacer 1.28|1109803|34|CP023014|PILER-CR matches to NZ_AP022333 (Methylosinus sp. C49 isolate Methylosinus sp. C49 plasmid pMSC49a, complete sequence) position: , mismatch: 10, identity: 0.706
aggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
tggaacaggcggcggtcgtcgcgcgagtctccgc Protospacer
***.* ****************** * .* ..
1075. spacer 1.28|1109803|34|CP023014|PILER-CR matches to MT639653 (Arthrobacter phage Elezi, complete genome) position: , mismatch: 10, identity: 0.706
aggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
aggagcgggcggaggtcgtcgcgcttgttcttca Protospacer
****** ***** *********** .* *.
1076. spacer 1.28|1109803|34|CP023014|PILER-CR matches to MT889376 (Arthrobacter phage Phives, complete genome) position: , mismatch: 10, identity: 0.706
aggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
aggagcgggcggaggtcgtcgcgcttgttcttca Protospacer
****** ***** *********** .* *.
1077. spacer 1.28|1109803|34|CP023014|PILER-CR matches to MT889366 (Arthrobacter phage London, complete genome) position: , mismatch: 10, identity: 0.706
aggagctggcggcggtcgtcgcgcgcgagccgat CRISPR spacer
aggagcgggcggaggtcgtcgcgcttgttcttca Protospacer
****** ***** *********** .* *.
1078. spacer 1.31|1109986|33|CP023014|PILER-CR matches to NC_020542 (Sphingomonas sp. MM-1 plasmid pISP0, complete sequence) position: , mismatch: 10, identity: 0.697
gctttccaatcatccgaacggcagagattggtg CRISPR spacer
ccaagtcaatcatgcgaacggcagagagtgtga Protospacer
* .******* ************* ** .
1079. spacer 2.4|1120484|33|CP023014|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.697
gattgggcatcagcaggtcgagccgggggcgga CRISPR spacer
cgcgcgcggtcagcaggtcgaccagggggcgga Protospacer
.. * .************ * *********
1080. spacer 2.10|1120358|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 10, identity: 0.688
gcttgggcattgccgacaacctgcaaccggac CRISPR spacer
ccttgggcattgcctccaacctgctcagtgct Protospacer
************* ******** * .
1081. spacer 2.14|1120601|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP036456 (Streptomonospora sp. M2 plasmid phiM2, complete sequence) position: , mismatch: 10, identity: 0.688
ccgttctgcccggtgctcacgatcggcgcggt CRISPR spacer
ggtgagcgcccggtgctcccggtcggcgcgct Protospacer
.*********** **.******** *
1082. spacer 2.14|1120601|32|CP023014|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688
ccgttctg-------cccggtgctcacgatcggcgcggt CRISPR spacer
-------ggtggagccccgatgctcccgatcggcgcggc Protospacer
* ****.***** ************.
1083. spacer 2.14|1120601|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.688
ccgttctg-------cccggtgctcacgatcggcgcggt CRISPR spacer
-------ggtggagccccgatgctcccgatcggcgcggc Protospacer
* ****.***** ************.
1084. spacer 2.17|1120783|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP045351 (Vibrio sp. THAF100 plasmid pTHAF100_a, complete sequence) position: , mismatch: 10, identity: 0.688
tagccatgttcccactgctgggcatgctcgct CRISPR spacer
cggccatcttcccattgctgggcattttttgc Protospacer
..***** ******.********** .*. .
1085. spacer 2.17|1120783|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP046163 (Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence) position: , mismatch: 10, identity: 0.688
tagccatgttcccactgctgggcatgctcgct CRISPR spacer
cggccatcttcccattgctgggcattttttgc Protospacer
..***** ******.********** .*. .
1086. spacer 2.17|1120783|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP046066 (Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence) position: , mismatch: 10, identity: 0.688
tagccatgttcccactgctgggcatgctcgct CRISPR spacer
cggccatcttcccattgctgggcattttttgc Protospacer
..***** ******.********** .*. .
1087. spacer 2.17|1120783|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP045356 (Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence) position: , mismatch: 10, identity: 0.688
tagccatgttcccactgctgggcatgctcgct CRISPR spacer
cggccatcttcccattgctgggcattttttgc Protospacer
..***** ******.********** .*. .
1088. spacer 2.20|1120965|32|CP023014|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.688
gaattgggcgcactgagcaacggcctgcacgc CRISPR spacer
atcaccaacgcactgatcaacgacctgcacgc Protospacer
. . ..******** *****.*********
1089. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to NC_022125 (Rhodococcus erythropolis CCM2595 plasmid pRECF1, complete sequence) position: , mismatch: 10, identity: 0.688
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
cagatcgcgatgctgcgcctcgtcctcggatg Protospacer
. ***** *********.******* *. .
1090. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP015205 (Rhodococcus sp. 008 plasmid pR8C2, complete sequence) position: , mismatch: 10, identity: 0.688
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
cagatcgcgatgctgcgcctcgtcctcggatg Protospacer
. ***** *********.******* *. .
1091. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP025960 (Rhodococcus qingshengii strain djl-6-2 plasmid pDJL1, complete sequence) position: , mismatch: 10, identity: 0.688
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
cagatcgcgatgctgcgcctcgtcctcggatg Protospacer
. ***** *********.******* *. .
1092. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP011297 (Rhodococcus erythropolis strain BG43 plasmid pRLLBG43, complete sequence) position: , mismatch: 10, identity: 0.688
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
cagatcgcgatgctgcgcctcgtcctcggatg Protospacer
. ***** *********.******* *. .
1093. spacer 2.24|1121209|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
tagacgaggcccagcgcgccctgtcggcgctg CRISPR spacer
cttcaaaggcccagtccgccctgtcggcgcct Protospacer
. .********. **************.
1094. spacer 2.24|1121209|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
tagacgaggcccagcgcgccctgtcggcgctg CRISPR spacer
gccgcattgcccagcgcgacctggcggcgctt Protospacer
.*. ********** **** *******
1095. spacer 2.30|1121575|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP015441 (Erythrobacter atlanticus strain s21-N3 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgttcacttcgcgcacggcggcaacctgac CRISPR spacer
cgcgatcacttcgcgcgcggcggtggcgatgg Protospacer
**** ***********.******...* .
1096. spacer 2.32|1121698|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 10, identity: 0.688
aagagccaggccgctcctggcgcaccgaactt CRISPR spacer
ctgagccagggcgatcctggcgcactgctggc Protospacer
******** ** ***********.* .
1097. spacer 2.33|1121759|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
attgaccagcaggaagaggtcatcaagcgcgc CRISPR spacer
cttgaccagcaggaagacgacatcgtcgatga Protospacer
**************** * ****. ..*
1098. spacer 2.33|1121759|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
attgaccagcaggaagaggtcatcaagcgcgc CRISPR spacer
cttgaccagcaggaagacgacatcgtcgatga Protospacer
**************** * ****. ..*
1099. spacer 2.35|1121881|32|CP023014|CRISPRCasFinder,CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688
taatcggaggccgcaatggggctcttcgacta CRISPR spacer
gtgctggaggccgcaatggcactcttcggcct Protospacer
...************** .*******.*.
1100. spacer 2.37|1122003|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 10, identity: 0.688
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
atcttcggcacctcgaccttcggcgcacggtg Protospacer
*** ************* *****. . *
1101. spacer 2.37|1122003|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP019604 (Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence) position: , mismatch: 10, identity: 0.688
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
gtggtcggcaactcgaccatcgacagttacat Protospacer
* ***** ***********.***** . .
1102. spacer 2.37|1122003|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022419 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-4, complete sequence) position: , mismatch: 10, identity: 0.688
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
agatgcggcacctcggccatccgcagcttcat Protospacer
************.***** ****.*.. .
1103. spacer 2.41|1122248|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 10, identity: 0.688
tcggcgctccaatccccgcgatccatgccgtc CRISPR spacer
tgatgtctccaatcctcacgatccatgcctcg Protospacer
* . *********.*.*********** .
1104. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 10, identity: 0.688
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
gcagcagcgcgaacgcgctggcgatgccgtgc Protospacer
. ** ** *****************.*
1105. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_LN832560 (Paracoccus aminovorans isolate JCM7685 plasmid II, complete sequence) position: , mismatch: 10, identity: 0.688
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
atatcatcgagaccgcgctggggatgcagaac Protospacer
..******** ******** ***** *.
1106. spacer 2.43|1122370|32|CP023014|CRISPRCasFinder,CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 10, identity: 0.688
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
atatcatcgagaccgcgctggggatgcagaac Protospacer
..******** ******** ***** *.
1107. spacer 2.45|1122492|32|CP023014|CRISPRCasFinder,CRT matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 10, identity: 0.688
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
ggaaggatcatcgaggacgggccggtccagcc Protospacer
. .*************** *** ****
1108. spacer 2.45|1122492|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP035419 (Leisingera sp. NJS204 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
tatgagttcatcgaggacggcgcgctcttggt Protospacer
* ** ************** *****. .
1109. spacer 2.45|1122492|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP038239 (Leisingera sp. NJS201 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.688
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
tatgagttcatcgaggacggcgcgctcttggt Protospacer
* ** ************** *****. .
1110. spacer 2.45|1122492|32|CP023014|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
gcgcggatcatcgaggacgacccgtactggct Protospacer
***.**************.****. *..
1111. spacer 2.45|1122492|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.688
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
gcgcggatcatcgaggacgacccgtactggct Protospacer
***.**************.****. *..
1112. spacer 2.45|1122492|32|CP023014|CRISPRCasFinder,CRT matches to MH834620 (Arthrobacter phage Melons, complete genome) position: , mismatch: 10, identity: 0.688
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
agtgagagcgtcgaggacggcccgctcgagct Protospacer
*** *.***************** *
1113. spacer 2.45|1122492|32|CP023014|CRISPRCasFinder,CRT matches to MH834606 (Arthrobacter phage Coral, complete genome) position: , mismatch: 10, identity: 0.688
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
agtgagagcgtcgaggacggcccgctcgagct Protospacer
*** *.***************** *
1114. spacer 2.45|1122492|32|CP023014|CRISPRCasFinder,CRT matches to MH834616 (Arthrobacter phage Kepler, complete genome) position: , mismatch: 10, identity: 0.688
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
agtgagagcgtcgaggacggcccgctcgagct Protospacer
*** *.***************** *
1115. spacer 2.45|1122492|32|CP023014|CRISPRCasFinder,CRT matches to MH834609 (Arthrobacter phage Daob, complete genome) position: , mismatch: 10, identity: 0.688
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
agtgagagcgtcgaggacggcccgctcgagct Protospacer
*** *.***************** *
1116. spacer 2.50|1122792|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 10, identity: 0.688
tccatcaccatggcctgctggtcgagcagctt CRISPR spacer
agtttggccatggcctgccggtcgagcggcgc Protospacer
. * .***********.********.** .
1117. spacer 2.51|1122853|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP014169 (Sphingomonas panacis strain DCY99 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cgtgcagcgcgccaggcgcggtagatagcatc CRISPR spacer
acggccgcgcgccaggcgcggtcgatatttcg Protospacer
** **************** **** . .
1118. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gagcggcggccggcgaagttgtcgtagggccg Protospacer
*******.***** *********.. .*
1119. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279887 (Mycobacterium phage Timmi, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1120. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH651175 (Mycobacterium phage Gophee, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1121. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to GQ303264 (Mycobacterium phage Puhltonio, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1122. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG925339 (Mycobacterium phage Chunky, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1123. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to GU247134 (Mycobacterium phage Scoot17C, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1124. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX683293 (Mycobacterium phage Daffy, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1125. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279888 (Mycobacterium phage TomBombadil, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1126. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JF957056 (Mycobacterium phage Thora, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1127. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT316463 (Mycobacterium phage Slatt, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1128. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX576645 (Mycobacterium phage Derpp, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1129. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH651184 (Mycobacterium phage Phareon, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1130. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JN006063 (Mycobacterium phage Serendipity, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1131. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH230875 (Mycobacterium phage CheetO, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1132. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG962365 (Mycobacterium phage DoesntMatter, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1133. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF919511 (Mycobacterium phage Kailash, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1134. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279882 (Mycobacterium phage Sophia, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1135. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX670813 (Mycobacterium phage MitKao, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1136. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH576970 (Mycobacterium phage DonSanchon, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1137. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279866 (Mycobacterium phage MRabcd, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1138. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH513973 (Mycobacterium phage Kwksand96, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1139. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK524512 (Mycobacterium phage Carthage, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1140. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN945899 (Mycobacterium phage Skippy, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1141. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279908 (Mycobacterium phage Roliet, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1142. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_023727 (Mycobacterium phage Vista, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1143. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT897909 (Mycobacterium phage Maru, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1144. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KM347890 (Mycobacterium phage Vivaldi, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1145. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH727555 (Mycobacterium phage Mulan, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1146. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT776813 (Mycobacterium phage Magic8, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1147. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG757164 (Mycobacterium phage PhenghisKhan, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1148. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KY006474 (Mycobacterium phage Prann, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1149. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_027985 (Mycobacterium phage UncleHowie, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1150. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JN698990 (Mycobacterium phage IsaacEli, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1151. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KY965066 (Mycobacterium phage BlackStallion, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1152. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN703415 (Mycobacterium phage Mcshane, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1153. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX592589 (Mycobacterium phage Iridoclysis, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1154. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH051251 (Mycobacterium phage DuchessDung, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1155. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX576646 (Mycobacterium phage TyrionL, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1156. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279871 (Mycobacterium phage Plmatters, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1157. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279883 (Mycobacterium phage Struggle, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1158. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN096366 (Mycobacterium phage AbsoluteMadLad, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1159. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG757165 (Mycobacterium phage Phergie, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1160. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH371107 (Mycobacterium phage Doddsville, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1161. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_028942 (Mycobacterium phage Phipps, complete sequence) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1162. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KJ567044 (Mycobacterium phage EmpTee, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1163. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279881 (Mycobacterium phage Solosis, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1164. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG944223 (Mycobacterium phage Trypo, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1165. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT897902 (Mycobacterium phage Boehler, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1166. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279855 (Mycobacterium phage Haleema, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1167. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JX649096 (Mycobacterium phage Serpentine, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1168. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK494104 (Mycobacterium phage HenryJackson, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1169. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG944225 (Mycobacterium phage Xavier, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1170. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JX649099 (Mycobacterium phage Gyarad, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1171. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH450116 (Mycobacterium phage Buckeye, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1172. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JN638753 (Mycobacterium phage Morgushi, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1173. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG757158 (Mycobacterium phage HighStump, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1174. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK112539 (Mycobacterium phage Dione, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1175. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279873 (Mycobacterium phage QueenBeane, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1176. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF668276 (Mycobacterium phage Lulumae, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1177. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT897903 (Mycobacterium phage DirtJuice, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1178. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH513980 (Mycobacterium phage Roy17, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1179. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279879 (Mycobacterium phage SassyCat97, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1180. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN586058 (Mycobacterium phage Vaishali24, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1181. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT316460 (Mycobacterium phage Kimbrough, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1182. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JF937097 (Mycobacterium phage Hertubise, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1183. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH230874 (Mycobacterium phage Banjo, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1184. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH651186 (Mycobacterium phage Podrick, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1185. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG962362 (Mycobacterium phage AltPhacts, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1186. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JF704103 (Mycobacterium phage Vortex, complete sequence) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1187. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to FJ174694 (Mycobacterium phage Chah, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1188. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH051264 (Mycobacterium phage Cobra, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1189. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK112536 (Mycobacterium phage Cannibal, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1190. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX578071 (Mycobacterium phage Mana, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1191. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF919539 (Mycobacterium phage Virapocalypse, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1192. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KC661274 (Mycobacterium phage SDcharge11, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1193. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KJ194579 (Mycobacterium phage Swish, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1194. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH371114 (Mycobacterium phage Childish, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1195. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279910 (Mycobacterium phage Antonia, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1196. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279852 (Mycobacterium phage Fringe, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1197. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX576643 (Mycobacterium phage FriarPreacher, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1198. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KY385382 (Mycobacterium phage ImtiyazSitla, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1199. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JN699010 (Mycobacterium phage TallGrassMM, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1200. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG757159 (Mycobacterium phage JangoPhett, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1201. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279891 (Mycobacterium phage Wallhey, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1202. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF919503 (Mycobacterium phage Dingo, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1203. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KY676783 (Mycobacterium phage Chorkpop, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1204. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK112527 (Mycobacterium phage Altwerkus, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1205. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JX649100 (Mycobacterium phage Alex, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1206. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_028691 (Mycobacterium phage Apizium, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcggcc Protospacer
****** ********** ***** .. *.
1207. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JF937109 (Mycobacterium phage Yoshand, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1208. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279878 (Mycobacterium phage Samaymay, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1209. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH399786 (Mycobacterium phage PhrodoBaggins, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1210. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK112551 (Mycobacterium phage Riggan, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1211. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN945903 (Mycobacterium phage Jiminy, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1212. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KM363597 (Mycobacteriophage Zonia, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1213. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KR816508 (Mycobacterium phage Phamished, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1214. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JF937095 (Mycobacterium phage Harvey, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1215. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KF713485 (Mycobacterium phage Suffolk, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1216. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG770212 (Mycobacterium phage Haimas, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1217. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279861 (Mycobacterium phage Legolas, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1218. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279843 (Mycobacterium phage CamL, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1219. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279890 (Mycobacterium phage Veritas, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1220. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279846 (Mycobacterium phage Cosmolli16, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1221. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KM408320 (Mycobacterium phage Lasso, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1222. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KR029086 (Mycobacterium phage PDRPv, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1223. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KY385380 (Mycobacterium phage Ashraf, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1224. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH825705 (Mycobacterium phage Mesh1, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1225. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279864 (Mycobacterium phage Mag7, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1226. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT952849 (Mycobacterium phage Windsor, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcggcc Protospacer
****** ********** ***** .. *.
1227. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH576954 (Mycobacterium phage HSavage, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1228. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK112555 (Mycobacterium phage Zelda, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1229. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_028803 (Mycobacterium phage OSmaximus, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1230. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279904 (Mycobacterium phage RedMaple, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1231. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KR029087 (Mycobacterium phage PDRPxv, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1232. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JN699009 (Mycobacterium phage ThreeOh3D2, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1233. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_005259 (Mycobacterium phage PG1, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1234. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH155874 (Mycobacterium phage PhrankReynolds, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1235. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK112552 (Mycobacterium phage Spartan300, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1236. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX702319 (Mycobacterium phage Pinkman, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1237. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF919523 (Mycobacterium phage Mikota, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1238. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KU867907 (Mycobacterium phage Potter, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1239. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH590588 (Mycobacterium phage Vaticameos, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1240. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279885 (Mycobacterium phage Surely, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1241. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279870 (Mycobacterium phage Omniscient, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1242. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JN638752 (Mycobacterium phage Murdoc, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1243. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KT599441 (Mycobacterium phage Squid, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1244. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG925346 (Mycobacterium phage LeeLot, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1245. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG962375 (Mycobacterium phage ProfessorX, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1246. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH077582 (Mycobacterium phage Olive, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1247. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF155947 (Mycobacterium phage LemonSlice, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1248. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KP027209 (Mycobacterium phage Sigman, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1249. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH450122 (Mycobacterium phage KingTut, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1250. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279859 (Mycobacterium phage Kwadwo, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1251. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK112546 (Mycobacterium phage LuckyMarjie, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1252. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX620786 (Mycobacterium phage Lego3393, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1253. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK112544 (Mycobacterium phage Keitherie, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcggcc Protospacer
****** ********** ***** .. *.
1254. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KP027197 (Mycobacterium phage FluffyNinja, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1255. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH651177 (Mycobacterium phage KlimbOn, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1256. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279877 (Mycobacterium phage Roscoe, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1257. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH576958 (Mycobacterium phage MichaelPhcott, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1258. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JN698989 (Mycobacterium phage JacAttac, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1259. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH479918 (Mycobacterium phage Labeouficaum, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1260. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK112553 (Mycobacterium Phage Squiggle, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1261. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_028907 (Mycobacterium phage Kikipoo, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1262. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279850 (Mycobacterium phage Durga, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1263. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK524526 (Mycobacterium phage Robyn, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1264. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279897 (Mycobacterium phage Bishoperium, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1265. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN585965 (Mycobacterium phage Duggie, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1266. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH316568 (Mycobacterium phage Phleuron, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1267. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT310868 (Mycobacterium phage Telesworld, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1268. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279865 (Mycobacterium phage Mecca, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1269. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KC576784 (Mycobacterium phage ShiVal, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1270. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KJ595576 (Mycobacterium phage Manad, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1271. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH479916 (Mycobacterium phage GeneCoco, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1272. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN444868 (Mycobacterium phage Prickles, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1273. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KY385383 (Mycobacterium phage Maskar, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1274. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH371117 (Mycobacterium phage Kahve, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1275. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH399773 (Mycobacterium phage Craff, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1276. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to GU247133 (Mycobacterium phage Fang, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1277. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX683292 (Mycobacterium phage Held, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1278. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_008197 (Mycobacterium phage Orion, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1279. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH479921 (Mycobacterium phage Placalicious, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1280. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT897901 (Mycobacterium phage Adriana, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1281. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN369744 (Mycobacterium phage Beaglebox, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1282. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KT364588 (Mycobacterium phage Hetaeria, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1283. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF919530 (Mycobacterium phage Sheila, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1284. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG925356 (Mycobacterium phage OliverWalter, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1285. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JX649098 (Mycobacterium phage Nacho, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1286. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH926060 (Mycobacterium phage Schadenfreude, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1287. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT889369 (Mycobacterium phage Inchworm, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1288. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KP027208 (Mycobacterium phage Pipsqueak, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1289. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF919519 (Mycobacterium phage Longacauda, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1290. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JF704109 (Mycobacterium phage Oosterbaan, complete sequence) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1291. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX369585 (Mycobacterium phage PhatCats2014, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1292. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK310139 (Mycobacterium phage Emiris, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1293. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH576967 (Mycobacterium phage UAch1, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1294. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KJ194580 (Mycobacterium phage Badfish, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1295. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX576647 (Mycobacterium phage CharlieGBrown, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1296. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN369738 (Mycobacterium phage Hocus, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1297. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279889 (Mycobacterium phage Valjean, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1298. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH399775 (Mycobacterium phage Gareth, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1299. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279894 (Mycobacterium phage YouGoGlencoco, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1300. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279895 (Mycobacterium phage Zaider, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1301. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN585967 (Mycobacterium phage Kloppinator, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1302. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to GQ303259 (Mycobacterium phage Colbert, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1303. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279858 (Mycobacterium phage JakeO, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1304. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_028681 (Mycobacterium phage Pops, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1305. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH744417 (Mycobacterium phage Grand2040, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1306. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JX649097 (Mycobacterium phage Piglet, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1307. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG925350 (Mycobacterium phage Mosaic, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1308. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH479914 (Mycobacterium phage FugateOSU, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1309. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH825702 (Mycobacterium phage Hamish, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1310. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF919528 (Mycobacterium phage Phunky, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1311. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_028690 (Mycobacterium phage Eremos, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1312. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG962363 (Mycobacterium phage BatteryCK, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1313. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KJ538723 (Mycobacterium phage KingVeVeVe, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1314. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JN192463 (Mycobacterium phage Oline, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1315. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_021310 (Mycobacterium phage Newman, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1316. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK112542 (Mycobacterium phage Jillium, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1317. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT310867 (Mycobacterium phage Chaelin, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcggcc Protospacer
****** ********** ***** .. *.
1318. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KJ194583 (Mycobacterium phage Numberten, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1319. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH590594 (Mycobacterium phage PinheadLarry, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1320. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KJ174157 (Mycobacterium phage Soto, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1321. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH399780 (Mycobacterium phage Mutante, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1322. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JF704099 (Mycobacterium phage KLucky39, complete sequence) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1323. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH779516 (Mycobacterium phage Waterdiva, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1324. spacer 2.55|1123097|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF919507 (Mycobacterium phage Horchata, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1325. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gagcggcggccggcgaagttgtcgtagggccg Protospacer
*******.***** *********.. .*
1326. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279887 (Mycobacterium phage Timmi, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1327. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH651175 (Mycobacterium phage Gophee, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1328. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to GQ303264 (Mycobacterium phage Puhltonio, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1329. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG925339 (Mycobacterium phage Chunky, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1330. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to GU247134 (Mycobacterium phage Scoot17C, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1331. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX683293 (Mycobacterium phage Daffy, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1332. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279888 (Mycobacterium phage TomBombadil, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1333. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JF957056 (Mycobacterium phage Thora, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1334. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT316463 (Mycobacterium phage Slatt, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1335. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX576645 (Mycobacterium phage Derpp, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1336. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH651184 (Mycobacterium phage Phareon, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1337. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JN006063 (Mycobacterium phage Serendipity, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1338. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH230875 (Mycobacterium phage CheetO, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1339. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG962365 (Mycobacterium phage DoesntMatter, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1340. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF919511 (Mycobacterium phage Kailash, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1341. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279882 (Mycobacterium phage Sophia, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1342. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX670813 (Mycobacterium phage MitKao, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1343. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH576970 (Mycobacterium phage DonSanchon, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1344. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279866 (Mycobacterium phage MRabcd, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1345. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH513973 (Mycobacterium phage Kwksand96, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1346. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK524512 (Mycobacterium phage Carthage, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1347. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN945899 (Mycobacterium phage Skippy, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1348. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279908 (Mycobacterium phage Roliet, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1349. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_023727 (Mycobacterium phage Vista, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1350. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT897909 (Mycobacterium phage Maru, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1351. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KM347890 (Mycobacterium phage Vivaldi, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1352. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH727555 (Mycobacterium phage Mulan, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1353. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT776813 (Mycobacterium phage Magic8, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1354. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG757164 (Mycobacterium phage PhenghisKhan, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1355. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KY006474 (Mycobacterium phage Prann, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1356. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_027985 (Mycobacterium phage UncleHowie, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1357. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JN698990 (Mycobacterium phage IsaacEli, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1358. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KY965066 (Mycobacterium phage BlackStallion, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1359. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN703415 (Mycobacterium phage Mcshane, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1360. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX592589 (Mycobacterium phage Iridoclysis, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1361. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH051251 (Mycobacterium phage DuchessDung, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1362. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX576646 (Mycobacterium phage TyrionL, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1363. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279871 (Mycobacterium phage Plmatters, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1364. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279883 (Mycobacterium phage Struggle, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1365. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN096366 (Mycobacterium phage AbsoluteMadLad, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1366. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG757165 (Mycobacterium phage Phergie, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1367. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH371107 (Mycobacterium phage Doddsville, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1368. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_028942 (Mycobacterium phage Phipps, complete sequence) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1369. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KJ567044 (Mycobacterium phage EmpTee, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1370. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279881 (Mycobacterium phage Solosis, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1371. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG944223 (Mycobacterium phage Trypo, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1372. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT897902 (Mycobacterium phage Boehler, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1373. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279855 (Mycobacterium phage Haleema, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1374. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JX649096 (Mycobacterium phage Serpentine, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1375. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK494104 (Mycobacterium phage HenryJackson, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1376. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG944225 (Mycobacterium phage Xavier, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1377. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JX649099 (Mycobacterium phage Gyarad, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1378. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH450116 (Mycobacterium phage Buckeye, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1379. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JN638753 (Mycobacterium phage Morgushi, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1380. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG757158 (Mycobacterium phage HighStump, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1381. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK112539 (Mycobacterium phage Dione, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1382. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279873 (Mycobacterium phage QueenBeane, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1383. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF668276 (Mycobacterium phage Lulumae, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1384. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT897903 (Mycobacterium phage DirtJuice, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1385. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH513980 (Mycobacterium phage Roy17, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1386. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279879 (Mycobacterium phage SassyCat97, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1387. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN586058 (Mycobacterium phage Vaishali24, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1388. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT316460 (Mycobacterium phage Kimbrough, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1389. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JF937097 (Mycobacterium phage Hertubise, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1390. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH230874 (Mycobacterium phage Banjo, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1391. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH651186 (Mycobacterium phage Podrick, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1392. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG962362 (Mycobacterium phage AltPhacts, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1393. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JF704103 (Mycobacterium phage Vortex, complete sequence) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1394. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to FJ174694 (Mycobacterium phage Chah, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1395. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH051264 (Mycobacterium phage Cobra, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1396. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK112536 (Mycobacterium phage Cannibal, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1397. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX578071 (Mycobacterium phage Mana, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1398. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF919539 (Mycobacterium phage Virapocalypse, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1399. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KC661274 (Mycobacterium phage SDcharge11, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1400. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KJ194579 (Mycobacterium phage Swish, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1401. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH371114 (Mycobacterium phage Childish, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1402. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279910 (Mycobacterium phage Antonia, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1403. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279852 (Mycobacterium phage Fringe, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1404. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX576643 (Mycobacterium phage FriarPreacher, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1405. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KY385382 (Mycobacterium phage ImtiyazSitla, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1406. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JN699010 (Mycobacterium phage TallGrassMM, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1407. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG757159 (Mycobacterium phage JangoPhett, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1408. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279891 (Mycobacterium phage Wallhey, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1409. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF919503 (Mycobacterium phage Dingo, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1410. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KY676783 (Mycobacterium phage Chorkpop, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1411. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK112527 (Mycobacterium phage Altwerkus, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1412. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JX649100 (Mycobacterium phage Alex, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1413. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_028691 (Mycobacterium phage Apizium, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcggcc Protospacer
****** ********** ***** .. *.
1414. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JF937109 (Mycobacterium phage Yoshand, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1415. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279878 (Mycobacterium phage Samaymay, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1416. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH399786 (Mycobacterium phage PhrodoBaggins, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1417. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK112551 (Mycobacterium phage Riggan, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1418. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN945903 (Mycobacterium phage Jiminy, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1419. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KM363597 (Mycobacteriophage Zonia, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1420. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KR816508 (Mycobacterium phage Phamished, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1421. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JF937095 (Mycobacterium phage Harvey, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1422. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KF713485 (Mycobacterium phage Suffolk, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1423. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG770212 (Mycobacterium phage Haimas, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1424. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279861 (Mycobacterium phage Legolas, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1425. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279843 (Mycobacterium phage CamL, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1426. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279890 (Mycobacterium phage Veritas, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1427. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279846 (Mycobacterium phage Cosmolli16, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1428. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KM408320 (Mycobacterium phage Lasso, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1429. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KR029086 (Mycobacterium phage PDRPv, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1430. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KY385380 (Mycobacterium phage Ashraf, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1431. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH825705 (Mycobacterium phage Mesh1, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1432. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279864 (Mycobacterium phage Mag7, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1433. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT952849 (Mycobacterium phage Windsor, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcggcc Protospacer
****** ********** ***** .. *.
1434. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH576954 (Mycobacterium phage HSavage, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1435. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK112555 (Mycobacterium phage Zelda, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1436. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_028803 (Mycobacterium phage OSmaximus, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1437. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279904 (Mycobacterium phage RedMaple, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1438. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KR029087 (Mycobacterium phage PDRPxv, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1439. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JN699009 (Mycobacterium phage ThreeOh3D2, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1440. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_005259 (Mycobacterium phage PG1, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1441. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH155874 (Mycobacterium phage PhrankReynolds, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1442. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK112552 (Mycobacterium phage Spartan300, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1443. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX702319 (Mycobacterium phage Pinkman, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1444. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF919523 (Mycobacterium phage Mikota, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1445. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KU867907 (Mycobacterium phage Potter, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1446. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH590588 (Mycobacterium phage Vaticameos, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1447. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279885 (Mycobacterium phage Surely, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1448. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279870 (Mycobacterium phage Omniscient, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1449. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JN638752 (Mycobacterium phage Murdoc, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1450. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KT599441 (Mycobacterium phage Squid, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1451. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG925346 (Mycobacterium phage LeeLot, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1452. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG962375 (Mycobacterium phage ProfessorX, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1453. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH077582 (Mycobacterium phage Olive, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1454. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF155947 (Mycobacterium phage LemonSlice, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1455. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KP027209 (Mycobacterium phage Sigman, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1456. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH450122 (Mycobacterium phage KingTut, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1457. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279859 (Mycobacterium phage Kwadwo, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1458. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK112546 (Mycobacterium phage LuckyMarjie, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1459. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX620786 (Mycobacterium phage Lego3393, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1460. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK112544 (Mycobacterium phage Keitherie, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcggcc Protospacer
****** ********** ***** .. *.
1461. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KP027197 (Mycobacterium phage FluffyNinja, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1462. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH651177 (Mycobacterium phage KlimbOn, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1463. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279877 (Mycobacterium phage Roscoe, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1464. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH576958 (Mycobacterium phage MichaelPhcott, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1465. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JN698989 (Mycobacterium phage JacAttac, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1466. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH479918 (Mycobacterium phage Labeouficaum, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1467. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK112553 (Mycobacterium Phage Squiggle, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1468. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_028907 (Mycobacterium phage Kikipoo, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1469. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279850 (Mycobacterium phage Durga, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1470. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK524526 (Mycobacterium phage Robyn, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1471. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279897 (Mycobacterium phage Bishoperium, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1472. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN585965 (Mycobacterium phage Duggie, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1473. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH316568 (Mycobacterium phage Phleuron, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1474. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT310868 (Mycobacterium phage Telesworld, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1475. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279865 (Mycobacterium phage Mecca, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1476. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KC576784 (Mycobacterium phage ShiVal, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1477. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KJ595576 (Mycobacterium phage Manad, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1478. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH479916 (Mycobacterium phage GeneCoco, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1479. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN444868 (Mycobacterium phage Prickles, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1480. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KY385383 (Mycobacterium phage Maskar, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1481. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH371117 (Mycobacterium phage Kahve, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1482. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH399773 (Mycobacterium phage Craff, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1483. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to GU247133 (Mycobacterium phage Fang, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1484. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX683292 (Mycobacterium phage Held, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1485. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_008197 (Mycobacterium phage Orion, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1486. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH479921 (Mycobacterium phage Placalicious, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1487. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT897901 (Mycobacterium phage Adriana, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1488. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN369744 (Mycobacterium phage Beaglebox, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1489. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KT364588 (Mycobacterium phage Hetaeria, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1490. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF919530 (Mycobacterium phage Sheila, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1491. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG925356 (Mycobacterium phage OliverWalter, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1492. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JX649098 (Mycobacterium phage Nacho, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1493. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH926060 (Mycobacterium phage Schadenfreude, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1494. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT889369 (Mycobacterium phage Inchworm, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1495. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KP027208 (Mycobacterium phage Pipsqueak, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1496. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF919519 (Mycobacterium phage Longacauda, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1497. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JF704109 (Mycobacterium phage Oosterbaan, complete sequence) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1498. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX369585 (Mycobacterium phage PhatCats2014, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1499. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK310139 (Mycobacterium phage Emiris, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1500. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH576967 (Mycobacterium phage UAch1, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1501. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KJ194580 (Mycobacterium phage Badfish, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1502. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KX576647 (Mycobacterium phage CharlieGBrown, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1503. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN369738 (Mycobacterium phage Hocus, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1504. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279889 (Mycobacterium phage Valjean, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1505. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH399775 (Mycobacterium phage Gareth, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1506. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279894 (Mycobacterium phage YouGoGlencoco, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1507. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279895 (Mycobacterium phage Zaider, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1508. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MN585967 (Mycobacterium phage Kloppinator, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1509. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to GQ303259 (Mycobacterium phage Colbert, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1510. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK279858 (Mycobacterium phage JakeO, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1511. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_028681 (Mycobacterium phage Pops, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1512. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH744417 (Mycobacterium phage Grand2040, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1513. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JX649097 (Mycobacterium phage Piglet, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1514. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG925350 (Mycobacterium phage Mosaic, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1515. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH479914 (Mycobacterium phage FugateOSU, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1516. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH825702 (Mycobacterium phage Hamish, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1517. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF919528 (Mycobacterium phage Phunky, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1518. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_028690 (Mycobacterium phage Eremos, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1519. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MG962363 (Mycobacterium phage BatteryCK, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1520. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KJ538723 (Mycobacterium phage KingVeVeVe, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1521. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JN192463 (Mycobacterium phage Oline, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1522. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_021310 (Mycobacterium phage Newman, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1523. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MK112542 (Mycobacterium phage Jillium, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1524. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MT310867 (Mycobacterium phage Chaelin, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcggcc Protospacer
****** ********** ***** .. *.
1525. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KJ194583 (Mycobacterium phage Numberten, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1526. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH590594 (Mycobacterium phage PinheadLarry, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1527. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to KJ174157 (Mycobacterium phage Soto, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1528. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH399780 (Mycobacterium phage Mutante, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1529. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to JF704099 (Mycobacterium phage KLucky39, complete sequence) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1530. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MH779516 (Mycobacterium phage Waterdiva, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1531. spacer 2.58|1123280|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to MF919507 (Mycobacterium phage Horchata, complete genome) position: , mismatch: 10, identity: 0.688
tcgcggcggtcggcgcagttgtcgtgattgtg CRISPR spacer
gcgcggctgtcggcgcaggtgtcggcgcagcc Protospacer
****** ********** ***** .. *.
1532. spacer 2.59|1123341|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_013283 (Cronobacter turicensis z3032 plasmid pCTU1, complete sequence) position: , mismatch: 10, identity: 0.688
tcggcaacctttagcgccatcaaatcgtccag CRISPR spacer
ggcgcaaactttaacgccatcaaatcagaaac Protospacer
**** *****.************. *
1533. spacer 2.62|1123524|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 10, identity: 0.688
cacgggaccggcgcgctgaacatgacccgcca CRISPR spacer
gccgggatcggcgcgctgagcatgaagatcgg Protospacer
*****.***********.***** * .
1534. spacer 2.65|1123707|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgataccctgctgctgaacctgccgga CRISPR spacer
ctgcgcgagacgctgctgctgaacctgatcgc Protospacer
. **** ** *************** . *
1535. spacer 2.65|1123707|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggcgataccctgctgctgaacctgccgga CRISPR spacer
ctgcgcgagacgctgctgctgaacctgatcgc Protospacer
. **** ** *************** . *
1536. spacer 2.66|1123768|32|CP023014|CRISPRCasFinder,CRT matches to MN062720 (Microbacterium phage FuzzBuster, complete genome) position: , mismatch: 10, identity: 0.688
ccgcgcgaggtctgggcggccgagttccgcga CRISPR spacer
gccgatttcgtctgggaggccgagatccgcga Protospacer
* .. ******* ******* *******
1537. spacer 2.67|1120419|32|CP023014|CRT matches to MN694345 (Marine virus AFVG_250M178, complete genome) position: , mismatch: 10, identity: 0.688
tcgattccgatgggatttgtcgacctggatga CRISPR spacer
atgcctccgatggaatttgtcgacatggtcat Protospacer
.* .********.********** *** ..
1538. spacer 2.67|1120419|32|CP023014|CRT matches to MN694528 (Marine virus AFVG_250M165, complete genome) position: , mismatch: 10, identity: 0.688
tcgattccgatgggatttgtcgacctggatga CRISPR spacer
atgcctccgatggaatttgtcgacatggtcat Protospacer
.* .********.********** *** ..
1539. spacer 2.72|1120971|32|CP023014|PILER-CR matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.688
gaattgggcgcactgagcaacggcctgcacgc CRISPR spacer
atcaccaacgcactgatcaacgacctgcacgc Protospacer
. . ..******** *****.*********
1540. spacer 2.73|1121032|32|CP023014|PILER-CR matches to NC_022125 (Rhodococcus erythropolis CCM2595 plasmid pRECF1, complete sequence) position: , mismatch: 10, identity: 0.688
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
cagatcgcgatgctgcgcctcgtcctcggatg Protospacer
. ***** *********.******* *. .
1541. spacer 2.73|1121032|32|CP023014|PILER-CR matches to NZ_CP015205 (Rhodococcus sp. 008 plasmid pR8C2, complete sequence) position: , mismatch: 10, identity: 0.688
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
cagatcgcgatgctgcgcctcgtcctcggatg Protospacer
. ***** *********.******* *. .
1542. spacer 2.73|1121032|32|CP023014|PILER-CR matches to NZ_CP025960 (Rhodococcus qingshengii strain djl-6-2 plasmid pDJL1, complete sequence) position: , mismatch: 10, identity: 0.688
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
cagatcgcgatgctgcgcctcgtcctcggatg Protospacer
. ***** *********.******* *. .
1543. spacer 2.73|1121032|32|CP023014|PILER-CR matches to NZ_CP011297 (Rhodococcus erythropolis strain BG43 plasmid pRLLBG43, complete sequence) position: , mismatch: 10, identity: 0.688
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
cagatcgcgatgctgcgcctcgtcctcggatg Protospacer
. ***** *********.******* *. .
1544. spacer 2.76|1121215|32|CP023014|PILER-CR matches to NZ_CP017947 (Bosea sp. Tri-49 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
tagacgaggcccagcgcgccctgtcggcgctg CRISPR spacer
cttcaaaggcccagtccgccctgtcggcgcct Protospacer
. .********. **************.
1545. spacer 2.76|1121215|32|CP023014|PILER-CR matches to NZ_CP019037 (Massilia putida strain 6NM-7 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
tagacgaggcccagcgcgccctgtcggcgctg CRISPR spacer
gccgcattgcccagcgcgacctggcggcgctt Protospacer
.*. ********** **** *******
1546. spacer 2.82|1121581|32|CP023014|PILER-CR matches to NZ_CP015441 (Erythrobacter atlanticus strain s21-N3 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgttcacttcgcgcacggcggcaacctgac CRISPR spacer
cgcgatcacttcgcgcgcggcggtggcgatgg Protospacer
**** ***********.******...* .
1547. spacer 2.84|1121704|32|CP023014|PILER-CR matches to NZ_CP015269 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 2, complete sequence) position: , mismatch: 10, identity: 0.688
aagagccaggccgctcctggcgcaccgaactt CRISPR spacer
ctgagccagggcgatcctggcgcactgctggc Protospacer
******** ** ***********.* .
1548. spacer 2.85|1121765|32|CP023014|PILER-CR matches to NZ_CP040721 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
attgaccagcaggaagaggtcatcaagcgcgc CRISPR spacer
cttgaccagcaggaagacgacatcgtcgatga Protospacer
**************** * ****. ..*
1549. spacer 2.85|1121765|32|CP023014|PILER-CR matches to NZ_CP018064 (Rhodococcus sp. 2G plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
attgaccagcaggaagaggtcatcaagcgcgc CRISPR spacer
cttgaccagcaggaagacgacatcgtcgatga Protospacer
**************** * ****. ..*
1550. spacer 2.87|1121887|32|CP023014|PILER-CR matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688
taatcggaggccgcaatggggctcttcgacta CRISPR spacer
gtgctggaggccgcaatggcactcttcggcct Protospacer
...************** .*******.*.
1551. spacer 2.89|1122009|32|CP023014|PILER-CR matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 10, identity: 0.688
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
atcttcggcacctcgaccttcggcgcacggtg Protospacer
*** ************* *****. . *
1552. spacer 2.89|1122009|32|CP023014|PILER-CR matches to NZ_CP019604 (Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence) position: , mismatch: 10, identity: 0.688
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
gtggtcggcaactcgaccatcgacagttacat Protospacer
* ***** ***********.***** . .
1553. spacer 2.89|1122009|32|CP023014|PILER-CR matches to NZ_CP022419 (Sulfitobacter pseudonitzschiae strain SMR1 plasmid pSMR1-4, complete sequence) position: , mismatch: 10, identity: 0.688
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
agatgcggcacctcggccatccgcagcttcat Protospacer
************.***** ****.*.. .
1554. spacer 2.93|1122254|32|CP023014|PILER-CR matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 10, identity: 0.688
tcggcgctccaatccccgcgatccatgccgtc CRISPR spacer
tgatgtctccaatcctcacgatccatgcctcg Protospacer
* . *********.*.*********** .
1555. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NC_015314 (Pseudonocardia dioxanivorans CB1190 plasmid pPSED01, complete sequence) position: , mismatch: 10, identity: 0.688
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
gcagcagcgcgaacgcgctggcgatgccgtgc Protospacer
. ** ** *****************.*
1556. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_LN832560 (Paracoccus aminovorans isolate JCM7685 plasmid II, complete sequence) position: , mismatch: 10, identity: 0.688
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
atatcatcgagaccgcgctggggatgcagaac Protospacer
..******** ******** ***** *.
1557. spacer 2.95|1122376|32|CP023014|PILER-CR matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 10, identity: 0.688
cggccatcgagaacgcgctggcgatgctggca CRISPR spacer
atatcatcgagaccgcgctggggatgcagaac Protospacer
..******** ******** ***** *.
1558. spacer 2.97|1122498|32|CP023014|PILER-CR matches to NC_012520 (Rhodococcus opacus B4 plasmid pROB01, complete sequence) position: , mismatch: 10, identity: 0.688
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
ggaaggatcatcgaggacgggccggtccagcc Protospacer
. .*************** *** ****
1559. spacer 2.97|1122498|32|CP023014|PILER-CR matches to NZ_CP035419 (Leisingera sp. NJS204 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
tatgagttcatcgaggacggcgcgctcttggt Protospacer
* ** ************** *****. .
1560. spacer 2.97|1122498|32|CP023014|PILER-CR matches to NZ_CP038239 (Leisingera sp. NJS201 plasmid unnamed5, complete sequence) position: , mismatch: 10, identity: 0.688
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
tatgagttcatcgaggacggcgcgctcttggt Protospacer
* ** ************** *****. .
1561. spacer 2.97|1122498|32|CP023014|PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
gcgcggatcatcgaggacgacccgtactggct Protospacer
***.**************.****. *..
1562. spacer 2.97|1122498|32|CP023014|PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.688
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
gcgcggatcatcgaggacgacccgtactggct Protospacer
***.**************.****. *..
1563. spacer 2.97|1122498|32|CP023014|PILER-CR matches to MH834620 (Arthrobacter phage Melons, complete genome) position: , mismatch: 10, identity: 0.688
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
agtgagagcgtcgaggacggcccgctcgagct Protospacer
*** *.***************** *
1564. spacer 2.97|1122498|32|CP023014|PILER-CR matches to MH834606 (Arthrobacter phage Coral, complete genome) position: , mismatch: 10, identity: 0.688
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
agtgagagcgtcgaggacggcccgctcgagct Protospacer
*** *.***************** *
1565. spacer 2.97|1122498|32|CP023014|PILER-CR matches to MH834616 (Arthrobacter phage Kepler, complete genome) position: , mismatch: 10, identity: 0.688
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
agtgagagcgtcgaggacggcccgctcgagct Protospacer
*** *.***************** *
1566. spacer 2.97|1122498|32|CP023014|PILER-CR matches to MH834609 (Arthrobacter phage Daob, complete genome) position: , mismatch: 10, identity: 0.688
tcgcagatcatcgaggacggcccgctccacaa CRISPR spacer
agtgagagcgtcgaggacggcccgctcgagct Protospacer
*** *.***************** *
1567. spacer 2.102|1122798|32|CP023014|PILER-CR matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 10, identity: 0.688
tccatcaccatggcctgctggtcgagcagctt CRISPR spacer
agtttggccatggcctgccggtcgagcggcgc Protospacer
. * .***********.********.** .
1568. spacer 1.13|1110048|32|CP023014|CRT,CRISPRCasFinder matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 11, identity: 0.656
ccgctcgcgccagcgccgcgcgaacacgtcga CRISPR spacer
ttactcgtgccagcgccgcgccaacagtctct Protospacer
...****.************* **** ..
1569. spacer 1.31|1109986|33|CP023014|PILER-CR matches to NZ_CP017079 (Novosphingobium resinovorum strain SA1 plasmid pSA4, complete sequence) position: , mismatch: 11, identity: 0.667
gctttccaatcatccgaacggcagagattggtg CRISPR spacer
caaagtcaatcatgcgaacggcagagagtgtga Protospacer
.******* ************* ** .
1570. spacer 1.31|1109986|33|CP023014|PILER-CR matches to NZ_AP017660 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_6) position: , mismatch: 11, identity: 0.667
gctttccaatcatccgaacggcagagattggtg CRISPR spacer
caaagtcaatcatgcgaacggcagagagtgtga Protospacer
.******* ************* ** .
1571. spacer 1.31|1109986|33|CP023014|PILER-CR matches to NZ_CP010958 (Sphingobium sp. YBL2 plasmid 4pYBL2-4, complete sequence) position: , mismatch: 11, identity: 0.667
gctttccaatcatccgaacggcagagattggtg CRISPR spacer
cgaagtcaatcatgcgaacggcagagagtgtga Protospacer
.******* ************* ** .
1572. spacer 1.31|1109986|33|CP023014|PILER-CR matches to NZ_CP013073 (Sphingobium indicum B90A plasmid pSRL3, complete sequence) position: , mismatch: 11, identity: 0.667
gctttccaatcatccgaacggcagagattggtg CRISPR spacer
caaagtcaatcatgcgaacggcagagagtgtga Protospacer
.******* ************* ** .
1573. spacer 1.31|1109986|33|CP023014|PILER-CR matches to NZ_CP012703 (Sphingopyxis macrogoltabida strain EY-1 isolate activated sludge plasmid 3, complete sequence) position: , mismatch: 11, identity: 0.667
gctttccaatcatccgaacggcagagattggtg CRISPR spacer
caaagtcaatcatgcgaacggcagagagtgtga Protospacer
.******* ************* ** .
1574. spacer 1.31|1109986|33|CP023014|PILER-CR matches to NZ_CP005090 (Sphingobium sp. TKS plasmid pTK6, complete sequence) position: , mismatch: 11, identity: 0.667
gctttccaatcatccgaacggcagagattggtg CRISPR spacer
caaagtcaatcatgcgaacggcagagagtgtga Protospacer
.******* ************* ** .
1575. spacer 1.31|1109986|33|CP023014|PILER-CR matches to NC_020544 (Sphingomonas sp. MM-1 plasmid pISP3, complete sequence) position: , mismatch: 11, identity: 0.667
gctttccaatcatccgaacggcagagattggtg CRISPR spacer
caaagtcaatcatgcgaacggcagagagtgtga Protospacer
.******* ************* ** .
1576. spacer 1.31|1109986|33|CP023014|PILER-CR matches to NZ_CP047220 (Sphingobium yanoikuyae strain YC-JY1 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.667
gctttccaatcatccgaacggcagagattggtg CRISPR spacer
cgaagtcaatcatgcgaacggcagagagtgtga Protospacer
.******* ************* ** .
1577. spacer 1.33|1110108|33|CP023014|PILER-CR matches to NZ_CP040452 (Halomonas sp. PA16-9 plasmid p_unnamed1, complete sequence) position: , mismatch: 11, identity: 0.667
gcggctcggcaaaggcaacgcccgcctggtcct CRISPR spacer
ctttctgggcaaaggcaacgccagcctgcctga Protospacer
. ** *************** ***** ..
1578. spacer 2.21|1121026|32|CP023014|CRISPRCasFinder,CRT matches to NC_048139 (Streptomyces phage Hiyaa, complete genome) position: , mismatch: 11, identity: 0.656
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
cgcgtcgaggtgctgcgtctcggccagccggt Protospacer
. .*****.************ **** .
1579. spacer 2.24|1121209|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP010618 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_a, complete sequence) position: , mismatch: 11, identity: 0.656
tagacgaggcccagcgcgccctgtcggcgctg CRISPR spacer
gtaacgcggccccgcgcgccctgtcgtttgac Protospacer
.*** ***** ************* .
1580. spacer 2.24|1121209|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP010746 (Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_a, complete sequence) position: , mismatch: 11, identity: 0.656
tagacgaggcccagcgcgccctgtcggcgctg CRISPR spacer
gtaacgcggccccgcgcgccctgtcgtttgac Protospacer
.*** ***** ************* .
1581. spacer 2.33|1121759|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP033099 (Staphylococcus warneri strain SWO plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
attgaccagcaggaagaggtcatcaagcgcgc CRISPR spacer
taagacctgcaggaacaggtcatcaattaata Protospacer
**** ******* ********** ..
1582. spacer 2.33|1121759|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP033099 (Staphylococcus warneri strain SWO plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
attgaccagcaggaagaggtcatcaagcgcgc CRISPR spacer
taagacctgcaggaacaggtcatcaattaata Protospacer
**** ******* ********** ..
1583. spacer 2.37|1122003|32|CP023014|CRISPRCasFinder,CRT matches to NC_017385 (Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence) position: , mismatch: 11, identity: 0.656
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
gtctgcggcgcctcgaccaccggcctgatcca Protospacer
********.*********.**** ...
1584. spacer 2.37|1122003|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP012910 (Ketogulonicigenium vulgare strain Hbe602 plasmid 2, complete sequence) position: , mismatch: 11, identity: 0.656
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
gtctgcggcgcctcgaccaccggcctgatcca Protospacer
********.*********.**** ...
1585. spacer 2.37|1122003|32|CP023014|CRISPRCasFinder,CRT matches to NC_008381 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence) position: , mismatch: 11, identity: 0.656
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
aagacgggcaccttgacgatcggcagttcgcg Protospacer
*******.*** *********** .
1586. spacer 2.37|1122003|32|CP023014|CRISPRCasFinder,CRT matches to NZ_CP048285 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248a, complete sequence) position: , mismatch: 11, identity: 0.656
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
aagacgggcaccttgacgatcggcagttcgcg Protospacer
*******.*** *********** .
1587. spacer 2.37|1122003|32|CP023014|CRISPRCasFinder,CRT matches to NC_014626 (Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence) position: , mismatch: 11, identity: 0.656
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
gtctgcggcgcctcgaccaccggcctgatcca Protospacer
********.*********.**** ...
1588. spacer 2.52|1122914|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048421 (Sphingomonas insulae strain KCTC 12872 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.656
ccgcccgtggcctgccagcacgtcgccatcgg CRISPR spacer
gatgccgtggcgtgccagcaggtcgccgagct Protospacer
******* ******** ******.
1589. spacer 2.61|1123463|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 11, identity: 0.656
acgcgccgtgcgtcaagcaaacgggtatcgat CRISPR spacer
cagcgccgtgcgtccaacaaacgggggagccc Protospacer
************ *.******** . .
1590. spacer 2.61|1123463|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 11, identity: 0.656
acgcgccgtgcgtcaagcaaacgggtatcgat CRISPR spacer
cagcgccgtgcgtccaacaaacgggggagccc Protospacer
************ *.******** . .
1591. spacer 2.61|1123463|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 11, identity: 0.656
acgcgccgtgcgtcaagcaaacgggtatcgat CRISPR spacer
cagcgccgtgcgtccaacaaacgggggagccc Protospacer
************ *.******** . .
1592. spacer 2.61|1123463|32|CP023014|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 11, identity: 0.656
acgcgccgtgcgtcaagcaaacgggtatcgat CRISPR spacer
cagcgccgtgcgtccaacaaacgggggagccc Protospacer
************ *.******** . .
1593. spacer 2.73|1121032|32|CP023014|PILER-CR matches to NC_048139 (Streptomyces phage Hiyaa, complete genome) position: , mismatch: 11, identity: 0.656
ttgatcgagatgctgcgtctcgtccaggaccc CRISPR spacer
cgcgtcgaggtgctgcgtctcggccagccggt Protospacer
. .*****.************ **** .
1594. spacer 2.76|1121215|32|CP023014|PILER-CR matches to NZ_CP010618 (Phaeobacter inhibens strain P30 isolate M4-3.1A plasmid pP30_a, complete sequence) position: , mismatch: 11, identity: 0.656
tagacgaggcccagcgcgccctgtcggcgctg CRISPR spacer
gtaacgcggccccgcgcgccctgtcgtttgac Protospacer
.*** ***** ************* .
1595. spacer 2.76|1121215|32|CP023014|PILER-CR matches to NZ_CP010746 (Phaeobacter inhibens strain P48 isolate M21-2.3 plasmid pP48_a, complete sequence) position: , mismatch: 11, identity: 0.656
tagacgaggcccagcgcgccctgtcggcgctg CRISPR spacer
gtaacgcggccccgcgcgccctgtcgtttgac Protospacer
.*** ***** ************* .
1596. spacer 2.85|1121765|32|CP023014|PILER-CR matches to NZ_CP033099 (Staphylococcus warneri strain SWO plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
attgaccagcaggaagaggtcatcaagcgcgc CRISPR spacer
taagacctgcaggaacaggtcatcaattaata Protospacer
**** ******* ********** ..
1597. spacer 2.85|1121765|32|CP023014|PILER-CR matches to NZ_CP033099 (Staphylococcus warneri strain SWO plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
attgaccagcaggaagaggtcatcaagcgcgc CRISPR spacer
taagacctgcaggaacaggtcatcaattaata Protospacer
**** ******* ********** ..
1598. spacer 2.89|1122009|32|CP023014|PILER-CR matches to NC_017385 (Ketogulonicigenium vulgare WSH-001 plasmid 2, complete sequence) position: , mismatch: 11, identity: 0.656
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
gtctgcggcgcctcgaccaccggcctgatcca Protospacer
********.*********.**** ...
1599. spacer 2.89|1122009|32|CP023014|PILER-CR matches to NZ_CP012910 (Ketogulonicigenium vulgare strain Hbe602 plasmid 2, complete sequence) position: , mismatch: 11, identity: 0.656
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
gtctgcggcgcctcgaccaccggcctgatcca Protospacer
********.*********.**** ...
1600. spacer 2.89|1122009|32|CP023014|PILER-CR matches to NC_008381 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence) position: , mismatch: 11, identity: 0.656
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
aagacgggcaccttgacgatcggcagttcgcg Protospacer
*******.*** *********** .
1601. spacer 2.89|1122009|32|CP023014|PILER-CR matches to NZ_CP048285 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248a, complete sequence) position: , mismatch: 11, identity: 0.656
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
aagacgggcaccttgacgatcggcagttcgcg Protospacer
*******.*** *********** .
1602. spacer 2.89|1122009|32|CP023014|PILER-CR matches to NC_014626 (Ketogulonicigenium vulgare Y25 plasmid pYP12, complete sequence) position: , mismatch: 11, identity: 0.656
ttctgcggcacctcgaccatcggcagttcttc CRISPR spacer
gtctgcggcgcctcgaccaccggcctgatcca Protospacer
********.*********.**** ...