| CRISPR_ID |
Spacer_Info |
Spacer_region |
Spacer_length |
Hit_phage_ID |
Hit_phage_def |
Protospacer_location |
Mismatch |
Identity |
| CP030369_2 |
2.1|2807934|32|CP030369|CRISPRCasFinder |
2807934-2807965 |
32 |
NZ_AP022593 |
Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence |
4027536-4027567 |
9 |
0.719 |
| CP030369_2 |
2.1|2807934|32|CP030369|CRISPRCasFinder |
2807934-2807965 |
32 |
NC_012586 |
Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence |
148705-148736 |
9 |
0.719 |
| CP030369_2 |
2.1|2807934|32|CP030369|CRISPRCasFinder |
2807934-2807965 |
32 |
NZ_CP023408 |
Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence |
173121-173152 |
9 |
0.719 |
1. spacer 2.1|2807934|32|CP030369|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
atcgggcgctctaccgcgtcgtcggtgtctgc CRISPR spacer
gtcgggcgcgccaccgcgtcgtcggaccgctc Protospacer
.******** *.************* . . *
2. spacer 2.1|2807934|32|CP030369|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.719
atcgggcgctctaccgcgtcgtcggtgtctgc CRISPR spacer
agcgggcgctcgaccgcgccgtcggcaagcac Protospacer
* ********* ******.******.. ..*
3. spacer 2.1|2807934|32|CP030369|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
atcgggcgctctaccgcgtcgtcggtgtctgc CRISPR spacer
gcggctcgctctacctcgtcgtcggcgtcctc Protospacer
.. * ********* *********.***. *