Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP030371 Salinibacter ruber strain RM158 plasmid pSR60, complete sequence 0 crisprs NA 0 0 0 0
CP030373 Salinibacter ruber strain RM158 plasmid pSR47, complete sequence 0 crisprs NA 0 0 0 0
CP030372 Salinibacter ruber strain RM158 plasmid pSR67, complete sequence 0 crisprs NA 0 0 0 0
CP030369 Salinibacter ruber strain RM158 chromosome, complete genome 2 crisprs NA 0 1 0 0
CP030370 Salinibacter ruber strain RM158 plasmid pSR31, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP030369
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030369_1 53580-53681 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030369_2 2807905-2807994 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP030369_2 2.1|2807934|32|CP030369|CRISPRCasFinder 2807934-2807965 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4027536-4027567 9 0.719
CP030369_2 2.1|2807934|32|CP030369|CRISPRCasFinder 2807934-2807965 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 148705-148736 9 0.719
CP030369_2 2.1|2807934|32|CP030369|CRISPRCasFinder 2807934-2807965 32 NZ_CP023408 Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence 173121-173152 9 0.719

1. spacer 2.1|2807934|32|CP030369|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719

atcgggcgctctaccgcgtcgtcggtgtctgc	CRISPR spacer
gtcgggcgcgccaccgcgtcgtcggaccgctc	Protospacer
.******** *.*************  . . *

2. spacer 2.1|2807934|32|CP030369|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.719

atcgggcgctctaccgcgtcgtcggtgtctgc	CRISPR spacer
agcgggcgctcgaccgcgccgtcggcaagcac	Protospacer
* ********* ******.******..  ..*

3. spacer 2.1|2807934|32|CP030369|CRISPRCasFinder matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719

atcgggcgctctaccgcgtcgtcggtgtctgc	CRISPR spacer
gcggctcgctctacctcgtcgtcggcgtcctc	Protospacer
.. *  ********* *********.***. *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage