Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP023062 Escherichia coli strain FORC_069 plasmid pFORC69, complete sequence 0 crisprs RT 0 0 3 0
CP023061 Escherichia coli strain FORC_069 chromosome, complete genome 4 crisprs csa3,RT,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,DEDDh,DinG,c2c9_V-U4,PrimPol 0 13 15 0

Results visualization

1. CP023061
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023061_1 1118185-1119006 Unclear I-E
13 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023061_3 2372205-2372328 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023061_5 3566510-3566654 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP023061_6 3806480-3806576 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP023061_4 4.1|3216056|40|CP023061|CRISPRCasFinder 3216056-3216095 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP023061_3 3.1|2372248|38|CP023061|CRISPRCasFinder 2372248-2372285 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP023061_1 1.2|1118274|33|CP023061|PILER-CR 1118274-1118306 33 NZ_CP038598 Salmonella enterica subsp. enterica serovar Hadar strain 12-2388 plasmid p12-2388.3, complete sequence 2051-2083 7 0.788
CP023061_1 1.2|1118274|33|CP023061|PILER-CR 1118274-1118306 33 NZ_CP033827 Klebsiella sp. FDAARGOS_511 plasmid unnamed4, complete sequence 692-724 7 0.788
CP023061_1 1.2|1118274|33|CP023061|PILER-CR 1118274-1118306 33 NZ_CP029125 Enterobacter hormaechei strain AR432 plasmid unnamed2, complete sequence 518-550 7 0.788
CP023061_1 1.2|1118274|33|CP023061|PILER-CR 1118274-1118306 33 NZ_AP019693 Salmonella enterica subsp. enterica serovar Senftenberg strain SL180013 plasmid pSL180013-1, complete sequence 2811-2843 7 0.788
CP023061_1 1.2|1118274|33|CP023061|PILER-CR 1118274-1118306 33 NZ_CP030192 Salmonella enterica strain SA20104250 plasmid pSA20104250.2, complete sequence 1835-1867 7 0.788
CP023061_1 1.2|1118274|33|CP023061|PILER-CR 1118274-1118306 33 NZ_CP039274 Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 plasmid pCFSAN004025.4, complete sequence 118-150 7 0.788
CP023061_1 1.2|1118274|33|CP023061|PILER-CR 1118274-1118306 33 NZ_CP016528 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_4, complete sequence 52-84 7 0.788
CP023061_1 1.2|1118274|33|CP023061|PILER-CR 1118274-1118306 33 NZ_CP030227 Salmonella enterica strain SA20041605 plasmid pSA20041605.2, complete sequence 3123-3155 7 0.788
CP023061_1 1.2|1118274|33|CP023061|PILER-CR 1118274-1118306 33 NC_013090 Endophytic bacterium LOB-07 plasmid pLK39, complete sequence 52-84 7 0.788
CP023061_1 1.2|1118274|33|CP023061|PILER-CR 1118274-1118306 33 NZ_CP030009 Enterobacter hormaechei subsp. xiangfangensis strain Pb204 plasmid pPb204002, complete sequence 2572-2604 7 0.788
CP023061_1 1.2|1118274|33|CP023061|PILER-CR 1118274-1118306 33 NZ_CP011606 Citrobacter freundii strain CAV1321 plasmid pCAV1321-4310, complete sequence 3835-3867 7 0.788
CP023061_1 1.2|1118274|33|CP023061|PILER-CR 1118274-1118306 33 NZ_CP044113 Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed4, complete sequence 3638-3670 7 0.788
CP023061_1 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT 1118275-1118306 32 NZ_CP038598 Salmonella enterica subsp. enterica serovar Hadar strain 12-2388 plasmid p12-2388.3, complete sequence 2052-2083 7 0.781
CP023061_1 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT 1118275-1118306 32 NZ_CP033827 Klebsiella sp. FDAARGOS_511 plasmid unnamed4, complete sequence 693-724 7 0.781
CP023061_1 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT 1118275-1118306 32 NZ_CP029125 Enterobacter hormaechei strain AR432 plasmid unnamed2, complete sequence 518-549 7 0.781
CP023061_1 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT 1118275-1118306 32 NZ_AP019693 Salmonella enterica subsp. enterica serovar Senftenberg strain SL180013 plasmid pSL180013-1, complete sequence 2812-2843 7 0.781
CP023061_1 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT 1118275-1118306 32 NZ_CP030192 Salmonella enterica strain SA20104250 plasmid pSA20104250.2, complete sequence 1835-1866 7 0.781
CP023061_1 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT 1118275-1118306 32 NZ_CP039274 Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 plasmid pCFSAN004025.4, complete sequence 118-149 7 0.781
CP023061_1 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT 1118275-1118306 32 NZ_CP016528 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_4, complete sequence 53-84 7 0.781
CP023061_1 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT 1118275-1118306 32 NZ_CP030227 Salmonella enterica strain SA20041605 plasmid pSA20041605.2, complete sequence 3124-3155 7 0.781
CP023061_1 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT 1118275-1118306 32 NC_013090 Endophytic bacterium LOB-07 plasmid pLK39, complete sequence 53-84 7 0.781
CP023061_1 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT 1118275-1118306 32 NZ_CP030009 Enterobacter hormaechei subsp. xiangfangensis strain Pb204 plasmid pPb204002, complete sequence 2572-2603 7 0.781
CP023061_1 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT 1118275-1118306 32 NZ_CP011606 Citrobacter freundii strain CAV1321 plasmid pCAV1321-4310, complete sequence 3835-3866 7 0.781
CP023061_1 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT 1118275-1118306 32 NZ_CP044113 Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed4, complete sequence 3639-3670 7 0.781
CP023061_1 1.19|1118519|32|CP023061|CRISPRCasFinder,CRT 1118519-1118550 32 MN693005 Marine virus AFVG_117M50, complete genome 6262-6293 7 0.781
CP023061_1 1.1|1118213|33|CP023061|PILER-CR 1118213-1118245 33 NZ_CP012265 Cronobacter condimenti 1330 strain LMG 26250 plasmid pCCO1, complete sequence 26062-26094 8 0.758
CP023061_1 1.6|1118518|33|CP023061|PILER-CR 1118518-1118550 33 MN693005 Marine virus AFVG_117M50, complete genome 6262-6294 8 0.758
CP023061_1 1.11|1118823|33|CP023061|PILER-CR 1118823-1118855 33 MK016501 Mycobacterium phage Nebkiss, complete genome 21453-21485 8 0.758
CP023061_1 1.11|1118823|33|CP023061|PILER-CR 1118823-1118855 33 NC_026590 Mycobacterium phage Gaia, complete genome 21452-21484 8 0.758
CP023061_1 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT 1118214-1118245 32 NZ_CP012265 Cronobacter condimenti 1330 strain LMG 26250 plasmid pCCO1, complete sequence 26063-26094 8 0.75
CP023061_1 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT 1118275-1118306 32 NC_019341 Pseudomonas syringae plasmid pNCPPB880-40, complete sequence 6612-6643 8 0.75
CP023061_1 1.17|1118397|32|CP023061|CRISPRCasFinder,CRT 1118397-1118428 32 AB452989 Serratia phage KSP20 orf7 to orf11 genes for scaffolding protein, major capsid protein, terminase, head completion protein, hypothetical protein, complete and partial cds 1966-1997 8 0.75
CP023061_1 1.19|1118519|32|CP023061|CRISPRCasFinder,CRT 1118519-1118550 32 MK295204 Shigella phage vB_SdyM_006, complete genome 16122-16153 8 0.75
CP023061_1 1.19|1118519|32|CP023061|CRISPRCasFinder,CRT 1118519-1118550 32 MG696114 Proteus phage phiP4-3, complete genome 149804-149835 8 0.75
CP023061_1 1.19|1118519|32|CP023061|CRISPRCasFinder,CRT 1118519-1118550 32 NZ_CP017949 Tenericutes bacterium MO-XQ plasmid unnamed, complete sequence 58006-58037 8 0.75
CP023061_1 1.22|1118702|32|CP023061|CRISPRCasFinder,CRT 1118702-1118733 32 NZ_CP010769 Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence 121002-121033 8 0.75
CP023061_1 1.24|1118824|32|CP023061|CRISPRCasFinder,CRT 1118824-1118855 32 MK016501 Mycobacterium phage Nebkiss, complete genome 21454-21485 8 0.75
CP023061_1 1.24|1118824|32|CP023061|CRISPRCasFinder,CRT 1118824-1118855 32 NC_026590 Mycobacterium phage Gaia, complete genome 21453-21484 8 0.75
CP023061_1 1.6|1118518|33|CP023061|PILER-CR 1118518-1118550 33 MK295204 Shigella phage vB_SdyM_006, complete genome 16121-16153 9 0.727
CP023061_1 1.6|1118518|33|CP023061|PILER-CR 1118518-1118550 33 MG696114 Proteus phage phiP4-3, complete genome 149804-149836 9 0.727
CP023061_1 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT 1118214-1118245 32 NC_006569 Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence 460266-460297 9 0.719
CP023061_1 1.19|1118519|32|CP023061|CRISPRCasFinder,CRT 1118519-1118550 32 AP022649 Bacillus wiedmannii PL1 plasmid pBwiPL1-6 DNA, complete sequence 5394-5425 9 0.719
CP023061_1 1.19|1118519|32|CP023061|CRISPRCasFinder,CRT 1118519-1118550 32 KC821606 Cellulophaga phage phi12:2, complete genome 1257-1288 9 0.719
CP023061_1 1.19|1118519|32|CP023061|CRISPRCasFinder,CRT 1118519-1118550 32 KT070867 Bacillus phage PBC2, complete genome 154855-154886 9 0.719
CP023061_1 1.6|1118518|33|CP023061|PILER-CR 1118518-1118550 33 AP022649 Bacillus wiedmannii PL1 plasmid pBwiPL1-6 DNA, complete sequence 5394-5426 10 0.697
CP023061_1 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT 1118214-1118245 32 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1538980-1539011 10 0.688
CP023061_1 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT 1118214-1118245 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1187025-1187056 10 0.688
CP023061_1 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT 1118214-1118245 32 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1615960-1615991 10 0.688
CP023061_1 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT 1118214-1118245 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1459996-1460027 10 0.688
CP023061_1 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT 1118214-1118245 32 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1531874-1531905 10 0.688
CP023061_1 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT 1118214-1118245 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1459018-1459049 10 0.688
CP023061_1 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT 1118214-1118245 32 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1526371-1526402 10 0.688
CP023061_1 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT 1118214-1118245 32 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1526372-1526403 10 0.688
CP023061_1 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT 1118214-1118245 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1459988-1460019 10 0.688
CP023061_1 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT 1118214-1118245 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1459341-1459372 10 0.688
CP023061_1 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT 1118214-1118245 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1459978-1460009 10 0.688
CP023061_1 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT 1118214-1118245 32 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1539145-1539176 10 0.688
CP023061_1 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT 1118214-1118245 32 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1539126-1539157 10 0.688
CP023061_1 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT 1118214-1118245 32 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1539107-1539138 10 0.688
CP023061_1 1.19|1118519|32|CP023061|CRISPRCasFinder,CRT 1118519-1118550 32 KC821631 Cellulophaga phage phi48:1, complete genome 1257-1288 10 0.688
CP023061_1 1.19|1118519|32|CP023061|CRISPRCasFinder,CRT 1118519-1118550 32 KC821628 Cellulophaga phage phi18:4, complete genome 1257-1288 10 0.688
CP023061_1 1.19|1118519|32|CP023061|CRISPRCasFinder,CRT 1118519-1118550 32 NC_021805 Cellulophaga phage phi12a:1, complete genome 1257-1288 10 0.688
CP023061_1 1.23|1118763|32|CP023061|CRISPRCasFinder,CRT 1118763-1118794 32 KU160664 Arthrobacter phage Salgado, complete genome 140-171 11 0.656
CP023061_1 1.23|1118763|32|CP023061|CRISPRCasFinder,CRT 1118763-1118794 32 MF140418 Arthrobacter phage LiSara, complete genome 140-171 11 0.656
CP023061_1 1.23|1118763|32|CP023061|CRISPRCasFinder,CRT 1118763-1118794 32 KU160654 Arthrobacter phage Laroye, complete genome 140-171 11 0.656

1. spacer 4.1|3216056|40|CP023061|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 3.1|2372248|38|CP023061|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 1.2|1118274|33|CP023061|PILER-CR matches to NZ_CP038598 (Salmonella enterica subsp. enterica serovar Hadar strain 12-2388 plasmid p12-2388.3, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

4. spacer 1.2|1118274|33|CP023061|PILER-CR matches to NZ_CP033827 (Klebsiella sp. FDAARGOS_511 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

5. spacer 1.2|1118274|33|CP023061|PILER-CR matches to NZ_CP029125 (Enterobacter hormaechei strain AR432 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

6. spacer 1.2|1118274|33|CP023061|PILER-CR matches to NZ_AP019693 (Salmonella enterica subsp. enterica serovar Senftenberg strain SL180013 plasmid pSL180013-1, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

7. spacer 1.2|1118274|33|CP023061|PILER-CR matches to NZ_CP030192 (Salmonella enterica strain SA20104250 plasmid pSA20104250.2, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

8. spacer 1.2|1118274|33|CP023061|PILER-CR matches to NZ_CP039274 (Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 plasmid pCFSAN004025.4, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

9. spacer 1.2|1118274|33|CP023061|PILER-CR matches to NZ_CP016528 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_4, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

10. spacer 1.2|1118274|33|CP023061|PILER-CR matches to NZ_CP030227 (Salmonella enterica strain SA20041605 plasmid pSA20041605.2, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

11. spacer 1.2|1118274|33|CP023061|PILER-CR matches to NC_013090 (Endophytic bacterium LOB-07 plasmid pLK39, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

12. spacer 1.2|1118274|33|CP023061|PILER-CR matches to NZ_CP030009 (Enterobacter hormaechei subsp. xiangfangensis strain Pb204 plasmid pPb204002, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

13. spacer 1.2|1118274|33|CP023061|PILER-CR matches to NZ_CP011606 (Citrobacter freundii strain CAV1321 plasmid pCAV1321-4310, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

14. spacer 1.2|1118274|33|CP023061|PILER-CR matches to NZ_CP044113 (Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.788

gaaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
gaaaagggccgcattagcggccc----ttttcggaga	Protospacer
***************..******    ** ***    

15. spacer 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP038598 (Salmonella enterica subsp. enterica serovar Hadar strain 12-2388 plasmid p12-2388.3, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

16. spacer 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP033827 (Klebsiella sp. FDAARGOS_511 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

17. spacer 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP029125 (Enterobacter hormaechei strain AR432 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

18. spacer 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT matches to NZ_AP019693 (Salmonella enterica subsp. enterica serovar Senftenberg strain SL180013 plasmid pSL180013-1, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

19. spacer 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP030192 (Salmonella enterica strain SA20104250 plasmid pSA20104250.2, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

20. spacer 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP039274 (Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 plasmid pCFSAN004025.4, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

21. spacer 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP016528 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_4, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

22. spacer 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP030227 (Salmonella enterica strain SA20041605 plasmid pSA20041605.2, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

23. spacer 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT matches to NC_013090 (Endophytic bacterium LOB-07 plasmid pLK39, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

24. spacer 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP030009 (Enterobacter hormaechei subsp. xiangfangensis strain Pb204 plasmid pPb204002, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

25. spacer 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP011606 (Citrobacter freundii strain CAV1321 plasmid pCAV1321-4310, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

26. spacer 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP044113 (Klebsiella michiganensis strain FDAARGOS_647 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781

aaaagggccgcattgacggccctgtgttatcg----	CRISPR spacer
aaaagggccgcattagcggccc----ttttcggaga	Protospacer
**************..******    ** ***    

27. spacer 1.19|1118519|32|CP023061|CRISPRCasFinder,CRT matches to MN693005 (Marine virus AFVG_117M50, complete genome) position: , mismatch: 7, identity: 0.781

atttttcagactcatcaaaataatcctttaat	CRISPR spacer
tttgttcatactcatcaaaataatctataact	Protospacer
 ** **** ****************. * * *

28. spacer 1.1|1118213|33|CP023061|PILER-CR matches to NZ_CP012265 (Cronobacter condimenti 1330 strain LMG 26250 plasmid pCCO1, complete sequence) position: , mismatch: 8, identity: 0.758

aggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
aagaactggcgctgctggagaaaatccgcaaag	Protospacer
*.****************** *** **  . * 

29. spacer 1.6|1118518|33|CP023061|PILER-CR matches to MN693005 (Marine virus AFVG_117M50, complete genome) position: , mismatch: 8, identity: 0.758

gatttttcagactcatcaaaataatcctttaat	CRISPR spacer
ctttgttcatactcatcaaaataatctataact	Protospacer
  ** **** ****************. * * *

30. spacer 1.11|1118823|33|CP023061|PILER-CR matches to MK016501 (Mycobacterium phage Nebkiss, complete genome) position: , mismatch: 8, identity: 0.758

gacacctctactgacgttcctgaacaagaagat	CRISPR spacer
gacacctccactggcgttcctgaacgtattcat	Protospacer
********.****.***********. .   **

31. spacer 1.11|1118823|33|CP023061|PILER-CR matches to NC_026590 (Mycobacterium phage Gaia, complete genome) position: , mismatch: 8, identity: 0.758

gacacctctactgacgttcctgaacaagaagat	CRISPR spacer
gacacctccactggcgttcctgaacgtattcat	Protospacer
********.****.***********. .   **

32. spacer 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP012265 (Cronobacter condimenti 1330 strain LMG 26250 plasmid pCCO1, complete sequence) position: , mismatch: 8, identity: 0.75

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
agaactggcgctgctggagaaaatccgcaaag	Protospacer
.****************** *** **  . * 

33. spacer 1.15|1118275|32|CP023061|CRISPRCasFinder,CRT matches to NC_019341 (Pseudomonas syringae plasmid pNCPPB880-40, complete sequence) position: , mismatch: 8, identity: 0.75

aaaagggccgcattgacggccctgtgttatcg	CRISPR spacer
aaaagggccgcattagcggcccttttaatttg	Protospacer
**************..******* *    *.*

34. spacer 1.17|1118397|32|CP023061|CRISPRCasFinder,CRT matches to AB452989 (Serratia phage KSP20 orf7 to orf11 genes for scaffolding protein, major capsid protein, terminase, head completion protein, hypothetical protein, complete and partial cds) position: , mismatch: 8, identity: 0.75

gggtggcggtggtgctgtaattcacaccggta	CRISPR spacer
ggcgcgtggtggtgctgttgttcacaccggcc	Protospacer
**   *.*********** .**********. 

35. spacer 1.19|1118519|32|CP023061|CRISPRCasFinder,CRT matches to MK295204 (Shigella phage vB_SdyM_006, complete genome) position: , mismatch: 8, identity: 0.75

atttttcagactcatcaaaataatcctttaat-----	CRISPR spacer
gtttttcataatcatcaaaataatc-----atgacca	Protospacer
.******* * **************     **     

36. spacer 1.19|1118519|32|CP023061|CRISPRCasFinder,CRT matches to MG696114 (Proteus phage phiP4-3, complete genome) position: , mismatch: 8, identity: 0.75

atttttcagactcatcaaaataatcctttaat-----	CRISPR spacer
gtttttcataatcatcaaaataatc-----atgacca	Protospacer
.******* * **************     **     

37. spacer 1.19|1118519|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP017949 (Tenericutes bacterium MO-XQ plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

-----atttttcagactcatcaaaataatcctttaat	CRISPR spacer
cagtgatt-----aacccatctaaataatcctttaat	Protospacer
     ***     .**.**** ***************

38. spacer 1.22|1118702|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP010769 (Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence) position: , mismatch: 8, identity: 0.75

ccgtcaaacagtatcaccgcgttaacgcccgc	CRISPR spacer
cccacaaacagtagcatcgcgttaacgatcaa	Protospacer
**  ********* **.********** .*. 

39. spacer 1.24|1118824|32|CP023061|CRISPRCasFinder,CRT matches to MK016501 (Mycobacterium phage Nebkiss, complete genome) position: , mismatch: 8, identity: 0.75

acacctctactgacgttcctgaacaagaagat	CRISPR spacer
acacctccactggcgttcctgaacgtattcat	Protospacer
*******.****.***********. .   **

40. spacer 1.24|1118824|32|CP023061|CRISPRCasFinder,CRT matches to NC_026590 (Mycobacterium phage Gaia, complete genome) position: , mismatch: 8, identity: 0.75

acacctctactgacgttcctgaacaagaagat	CRISPR spacer
acacctccactggcgttcctgaacgtattcat	Protospacer
*******.****.***********. .   **

41. spacer 1.6|1118518|33|CP023061|PILER-CR matches to MK295204 (Shigella phage vB_SdyM_006, complete genome) position: , mismatch: 9, identity: 0.727

gatttttcagactcatcaaaataatcctttaat-----	CRISPR spacer
cgtttttcataatcatcaaaataatc-----atgacca	Protospacer
 .******* * **************     **     

42. spacer 1.6|1118518|33|CP023061|PILER-CR matches to MG696114 (Proteus phage phiP4-3, complete genome) position: , mismatch: 9, identity: 0.727

gatttttcagactcatcaaaataatcctttaat-----	CRISPR spacer
cgtttttcataatcatcaaaataatc-----atgacca	Protospacer
 .******* * **************     **     

43. spacer 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
ggccaaggcgctgctggaacagaacccggacc	Protospacer
**    ************.**.*******  .

44. spacer 1.19|1118519|32|CP023061|CRISPRCasFinder,CRT matches to AP022649 (Bacillus wiedmannii PL1 plasmid pBwiPL1-6 DNA, complete sequence) position: , mismatch: 9, identity: 0.719

atttttcagactcatcaaaataatcctttaat	CRISPR spacer
ccctatcatattcatcaaaataatcctttgcg	Protospacer
 ..* *** *.******************.  

45. spacer 1.19|1118519|32|CP023061|CRISPRCasFinder,CRT matches to KC821606 (Cellulophaga phage phi12:2, complete genome) position: , mismatch: 9, identity: 0.719

atttttcagactcatcaaaataatcctttaat	CRISPR spacer
gttttttaaactcatcaaaataataacctacc	Protospacer
.*****.*.***************  ..** .

46. spacer 1.19|1118519|32|CP023061|CRISPRCasFinder,CRT matches to KT070867 (Bacillus phage PBC2, complete genome) position: , mismatch: 9, identity: 0.719

atttttcagactcatcaaaataatcctttaat	CRISPR spacer
atttttcagacttatcaaaagaacagtcggaa	Protospacer
************.******* **.  *. .* 

47. spacer 1.6|1118518|33|CP023061|PILER-CR matches to AP022649 (Bacillus wiedmannii PL1 plasmid pBwiPL1-6 DNA, complete sequence) position: , mismatch: 10, identity: 0.697

gatttttcagactcatcaaaataatcctttaat	CRISPR spacer
tccctatcatattcatcaaaataatcctttgcg	Protospacer
  ..* *** *.******************.  

48. spacer 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

49. spacer 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
cctgctggcggtgctggagcagaaccccgcgg	Protospacer
   .****** **********.***** *.. 

50. spacer 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

51. spacer 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

52. spacer 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

53. spacer 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

54. spacer 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

55. spacer 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

56. spacer 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

57. spacer 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

58. spacer 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

59. spacer 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

60. spacer 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

61. spacer 1.14|1118214|32|CP023061|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

ggaactggcgctgctggagcaaaacccggtat	CRISPR spacer
tcaactggcgctgctggaggacaacgagcggc	Protospacer
  ***************** * ***  *  ..

62. spacer 1.19|1118519|32|CP023061|CRISPRCasFinder,CRT matches to KC821631 (Cellulophaga phage phi48:1, complete genome) position: , mismatch: 10, identity: 0.688

atttttcagactcatcaaaataatcctttaat	CRISPR spacer
gttttttaaactcatcaaaataataacccacc	Protospacer
.*****.*.***************  ...* .

63. spacer 1.19|1118519|32|CP023061|CRISPRCasFinder,CRT matches to KC821628 (Cellulophaga phage phi18:4, complete genome) position: , mismatch: 10, identity: 0.688

atttttcagactcatcaaaataatcctttaat	CRISPR spacer
gttttttaaactcatcaaaataataacccacc	Protospacer
.*****.*.***************  ...* .

64. spacer 1.19|1118519|32|CP023061|CRISPRCasFinder,CRT matches to NC_021805 (Cellulophaga phage phi12a:1, complete genome) position: , mismatch: 10, identity: 0.688

atttttcagactcatcaaaataatcctttaat	CRISPR spacer
gttttttaaactcatcaaaataataacccacc	Protospacer
.*****.*.***************  ...* .

65. spacer 1.23|1118763|32|CP023061|CRISPRCasFinder,CRT matches to KU160664 (Arthrobacter phage Salgado, complete genome) position: , mismatch: 11, identity: 0.656

ccacacacgtcgagctggtgggggttaatgct	CRISPR spacer
aacggggcgtcgggctggtgggggtgaatgta	Protospacer
    . .*****.************ ****. 

66. spacer 1.23|1118763|32|CP023061|CRISPRCasFinder,CRT matches to MF140418 (Arthrobacter phage LiSara, complete genome) position: , mismatch: 11, identity: 0.656

ccacacacgtcgagctggtgggggttaatgct	CRISPR spacer
aacggggcgtcgggctggtgggggtgaatgta	Protospacer
    . .*****.************ ****. 

67. spacer 1.23|1118763|32|CP023061|CRISPRCasFinder,CRT matches to KU160654 (Arthrobacter phage Laroye, complete genome) position: , mismatch: 11, identity: 0.656

ccacacacgtcgagctggtgggggttaatgct	CRISPR spacer
aacggggcgtcgggctggtgggggtgaatgta	Protospacer
    . .*****.************ ****. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 868339 : 880036 11 Stx2-converting_phage(50.0%) protease NA
DBSCAN-SWA_2 1161151 : 1168291 6 Escherichia_phage(83.33%) NA NA
DBSCAN-SWA_3 1246103 : 1252460 10 Enterobacteria_phage(42.86%) transposase NA
DBSCAN-SWA_4 1769239 : 1778681 10 Enterobacteria_phage(85.71%) lysis NA
DBSCAN-SWA_5 1988526 : 1999997 13 Enterobacteria_phage(20.0%) NA NA
DBSCAN-SWA_6 2039754 : 2074903 51 Enterobacteria_phage(86.36%) portal,plate,tail,terminase,capsid,head NA
DBSCAN-SWA_7 2112967 : 2204224 116 Enterobacteria_phage(46.38%) portal,tail,terminase,protease,capsid,tRNA,head NA
DBSCAN-SWA_8 2449488 : 2538672 116 Escherichia_phage(37.65%) portal,lysis,tail,integrase,terminase,protease,capsid,holin,head attL 2465523:2465540|attR 2493757:2493774
DBSCAN-SWA_9 2826547 : 2888016 84 Enterobacteria_phage(37.74%) portal,tail,terminase,protease,capsid,head NA
DBSCAN-SWA_10 3134332 : 3137642 6 Stx2-converting_phage(50.0%) NA NA
DBSCAN-SWA_11 3172437 : 3179701 8 Stx2-converting_phage(66.67%) NA NA
DBSCAN-SWA_12 3247058 : 3293032 64 Escherichia_phage(63.46%) portal,tail,terminase,protease,holin,tRNA NA
DBSCAN-SWA_13 3311543 : 3410270 107 Shigella_phage(47.62%) plate,tail,terminase,protease,capsid,transposase,tRNA NA
DBSCAN-SWA_14 4659686 : 4670965 11 Enterobacteria_phage(44.44%) protease NA
DBSCAN-SWA_15 4682011 : 4699353 19 Enterobacteria_phage(50.0%) protease NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP023062
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 93 : 7580 16 Enterobacteria_phage(50.0%) integrase,transposase attL 30:42|attR 3529:3541
DBSCAN-SWA_2 30532 : 46519 26 Enterobacteria_phage(26.67%) NA NA
DBSCAN-SWA_3 70342 : 77289 13 Stx2-converting_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage