Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP031670 Staphylococcus aureus strain 64 chromosome, complete genome 10 crisprs cas3,DEDDh,DinG,csa3,WYL 5 1 9 0
CP031672 Staphylococcus aureus strain 64 plasmid pPS00119.1A.2, complete sequence 0 crisprs NA 0 0 0 0
CP031671 Staphylococcus aureus strain 64 plasmid pPS00119.1A.1, complete sequence 0 crisprs csa3 0 0 0 0

Results visualization

1. CP031670
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031670_1 397379-397479 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031670_2 637624-637716 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031670_3 700542-700640 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031670_4 753499-753581 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031670_5 794551-794631 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031670_6 843081-843162 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031670_7 1082439-1082526 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031670_8 1210167-1210353 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031670_9 1910585-1910811 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031670_10 2266394-2266544 Orphan NA
2 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP031670_5 5.1|794577|29|CP031670|CRISPRCasFinder 794577-794605 29 CP031670.1 2832891-2832919 0 1.0
CP031670_6 6.1|843105|34|CP031670|CRISPRCasFinder 843105-843138 34 CP031670.1 1418471-1418504 0 1.0
CP031670_6 6.1|843105|34|CP031670|CRISPRCasFinder 843105-843138 34 CP031670.1 1506856-1506889 0 1.0
CP031670_8 8.2|1210242|37|CP031670|CRT 1210242-1210278 37 CP031670.1 1066150-1066186 0 1.0
CP031670_8 8.2|1210242|37|CP031670|CRT 1210242-1210278 37 CP031670.1 1418430-1418466 0 1.0
CP031670_8 8.2|1210242|37|CP031670|CRT 1210242-1210278 37 CP031670.1 2066673-2066709 0 1.0
CP031670_8 8.3|1210298|37|CP031670|CRT 1210298-1210334 37 CP031670.1 135469-135505 0 1.0
CP031670_8 8.3|1210298|37|CP031670|CRT 1210298-1210334 37 CP031670.1 636662-636698 0 1.0
CP031670_8 8.3|1210298|37|CP031670|CRT 1210298-1210334 37 CP031670.1 752517-752553 0 1.0
CP031670_8 8.3|1210298|37|CP031670|CRT 1210298-1210334 37 CP031670.1 753487-753523 0 1.0
CP031670_8 8.3|1210298|37|CP031670|CRT 1210298-1210334 37 CP031670.1 800007-800043 0 1.0
CP031670_8 8.3|1210298|37|CP031670|CRT 1210298-1210334 37 CP031670.1 1418488-1418524 0 1.0
CP031670_8 8.3|1210298|37|CP031670|CRT 1210298-1210334 37 CP031670.1 1506836-1506872 0 1.0
CP031670_8 8.3|1210298|37|CP031670|CRT 1210298-1210334 37 CP031670.1 2068130-2068166 0 1.0
CP031670_8 8.3|1210298|37|CP031670|CRT 1210298-1210334 37 CP031670.1 2068189-2068225 0 1.0
CP031670_5 5.1|794577|29|CP031670|CRISPRCasFinder 794577-794605 29 CP031670.1 358845-358873 1 0.966
CP031670_5 5.1|794577|29|CP031670|CRISPRCasFinder 794577-794605 29 CP031670.1 358900-358928 1 0.966
CP031670_5 5.1|794577|29|CP031670|CRISPRCasFinder 794577-794605 29 CP031670.1 1910548-1910576 1 0.966
CP031670_8 8.1|1210186|37|CP031670|CRT 1210186-1210222 37 CP031670.1 1910545-1910581 1 0.973
CP031670_8 8.2|1210242|37|CP031670|CRT 1210242-1210278 37 CP031670.1 1506894-1506930 1 0.973
CP031670_8 8.2|1210242|37|CP031670|CRT 1210242-1210278 37 CP031670.1 2667485-2667521 1 0.973
CP031670_8 8.3|1210298|37|CP031670|CRT 1210298-1210334 37 CP031670.1 1092347-1092383 1 0.973
CP031670_8 8.3|1210298|37|CP031670|CRT 1210298-1210334 37 CP031670.1 2557027-2557063 1 0.973
CP031670_5 5.1|794577|29|CP031670|CRISPRCasFinder 794577-794605 29 CP031670.1 843147-843175 2 0.931
CP031670_5 5.1|794577|29|CP031670|CRISPRCasFinder 794577-794605 29 CP031670.1 955082-955110 2 0.931
CP031670_5 5.1|794577|29|CP031670|CRISPRCasFinder 794577-794605 29 CP031670.1 1731891-1731919 2 0.931
CP031670_5 5.1|794577|29|CP031670|CRISPRCasFinder 794577-794605 29 CP031670.1 2077484-2077512 2 0.931
CP031670_5 5.1|794577|29|CP031670|CRISPRCasFinder 794577-794605 29 CP031670.1 2582313-2582341 2 0.931
CP031670_8 8.1|1210186|37|CP031670|CRT 1210186-1210222 37 CP031670.1 843142-843178 2 0.946
CP031670_8 8.1|1210186|37|CP031670|CRT 1210186-1210222 37 CP031670.1 1731886-1731922 2 0.946
CP031670_8 8.1|1210186|37|CP031670|CRT 1210186-1210222 37 CP031670.1 2077479-2077515 2 0.946
CP031670_8 8.1|1210186|37|CP031670|CRT 1210186-1210222 37 CP031670.1 2582310-2582346 2 0.946
CP031670_8 8.1|1210186|37|CP031670|CRT 1210186-1210222 37 CP031670.1 2832886-2832922 2 0.946
CP031670_8 8.2|1210242|37|CP031670|CRT 1210242-1210278 37 CP031670.1 799951-799987 2 0.946
CP031670_8 8.2|1210242|37|CP031670|CRT 1210242-1210278 37 CP031670.1 1206274-1206310 2 0.946
CP031670_8 8.2|1210242|37|CP031670|CRT 1210242-1210278 37 CP031670.1 1210354-1210390 2 0.946
CP031670_8 8.2|1210242|37|CP031670|CRT 1210242-1210278 37 CP031670.1 2066614-2066650 2 0.946
CP031670_8 8.3|1210298|37|CP031670|CRT 1210298-1210334 37 CP031670.1 1206330-1206366 2 0.946

1. spacer 5.1|794577|29|CP031670|CRISPRCasFinder matches to position: 2832891-2832919, mismatch: 0, identity: 1.0

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgtttgtagaatttcttttcgaaa	Protospacer
*****************************

2. spacer 6.1|843105|34|CP031670|CRISPRCasFinder matches to position: 1418471-1418504, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

3. spacer 6.1|843105|34|CP031670|CRISPRCasFinder matches to position: 1506856-1506889, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

4. spacer 8.2|1210242|37|CP031670|CRT matches to position: 1066150-1066186, mismatch: 0, identity: 1.0

agctgacgaaaagtcagcttacaataatgtgcaagtt	CRISPR spacer
agctgacgaaaagtcagcttacaataatgtgcaagtt	Protospacer
*************************************

5. spacer 8.2|1210242|37|CP031670|CRT matches to position: 1418430-1418466, mismatch: 0, identity: 1.0

agctgacgaaaagtcagcttacaataatgtgcaagtt	CRISPR spacer
agctgacgaaaagtcagcttacaataatgtgcaagtt	Protospacer
*************************************

6. spacer 8.2|1210242|37|CP031670|CRT matches to position: 2066673-2066709, mismatch: 0, identity: 1.0

agctgacgaaaagtcagcttacaataatgtgcaagtt	CRISPR spacer
agctgacgaaaagtcagcttacaataatgtgcaagtt	Protospacer
*************************************

7. spacer 8.3|1210298|37|CP031670|CRT matches to position: 135469-135505, mismatch: 0, identity: 1.0

gaaattggattcccaatttctacagacaatgcaagtt	CRISPR spacer
gaaattggattcccaatttctacagacaatgcaagtt	Protospacer
*************************************

8. spacer 8.3|1210298|37|CP031670|CRT matches to position: 636662-636698, mismatch: 0, identity: 1.0

gaaattggattcccaatttctacagacaatgcaagtt	CRISPR spacer
gaaattggattcccaatttctacagacaatgcaagtt	Protospacer
*************************************

9. spacer 8.3|1210298|37|CP031670|CRT matches to position: 752517-752553, mismatch: 0, identity: 1.0

gaaattggattcccaatttctacagacaatgcaagtt	CRISPR spacer
gaaattggattcccaatttctacagacaatgcaagtt	Protospacer
*************************************

10. spacer 8.3|1210298|37|CP031670|CRT matches to position: 753487-753523, mismatch: 0, identity: 1.0

gaaattggattcccaatttctacagacaatgcaagtt	CRISPR spacer
gaaattggattcccaatttctacagacaatgcaagtt	Protospacer
*************************************

11. spacer 8.3|1210298|37|CP031670|CRT matches to position: 800007-800043, mismatch: 0, identity: 1.0

gaaattggattcccaatttctacagacaatgcaagtt	CRISPR spacer
gaaattggattcccaatttctacagacaatgcaagtt	Protospacer
*************************************

12. spacer 8.3|1210298|37|CP031670|CRT matches to position: 1418488-1418524, mismatch: 0, identity: 1.0

gaaattggattcccaatttctacagacaatgcaagtt	CRISPR spacer
gaaattggattcccaatttctacagacaatgcaagtt	Protospacer
*************************************

13. spacer 8.3|1210298|37|CP031670|CRT matches to position: 1506836-1506872, mismatch: 0, identity: 1.0

gaaattggattcccaatttctacagacaatgcaagtt	CRISPR spacer
gaaattggattcccaatttctacagacaatgcaagtt	Protospacer
*************************************

14. spacer 8.3|1210298|37|CP031670|CRT matches to position: 2068130-2068166, mismatch: 0, identity: 1.0

gaaattggattcccaatttctacagacaatgcaagtt	CRISPR spacer
gaaattggattcccaatttctacagacaatgcaagtt	Protospacer
*************************************

15. spacer 8.3|1210298|37|CP031670|CRT matches to position: 2068189-2068225, mismatch: 0, identity: 1.0

gaaattggattcccaatttctacagacaatgcaagtt	CRISPR spacer
gaaattggattcccaatttctacagacaatgcaagtt	Protospacer
*************************************

16. spacer 5.1|794577|29|CP031670|CRISPRCasFinder matches to position: 358845-358873, mismatch: 1, identity: 0.966

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcttgtagaatttcttttcgaaa	Protospacer
*******.*********************

17. spacer 5.1|794577|29|CP031670|CRISPRCasFinder matches to position: 358900-358928, mismatch: 1, identity: 0.966

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcttgtagaatttcttttcgaaa	Protospacer
*******.*********************

18. spacer 5.1|794577|29|CP031670|CRISPRCasFinder matches to position: 1910548-1910576, mismatch: 1, identity: 0.966

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgtctgtagaatttcttttcgaaa	Protospacer
********.********************

19. spacer 8.1|1210186|37|CP031670|CRT matches to position: 1910545-1910581, mismatch: 1, identity: 0.973

gaatttcaaaaagaaattctacagacaatgcaagttg	CRISPR spacer
gaatttcgaaaagaaattctacagacaatgcaagttg	Protospacer
*******.*****************************

20. spacer 8.2|1210242|37|CP031670|CRT matches to position: 1506894-1506930, mismatch: 1, identity: 0.973

agctgacgaaaagtcagcttacaataatgtgcaagtt	CRISPR spacer
agatgacgaaaagtcagcttacaataatgtgcaagtt	Protospacer
** **********************************

21. spacer 8.2|1210242|37|CP031670|CRT matches to position: 2667485-2667521, mismatch: 1, identity: 0.973

agctgacgaaaagtcagcttacaataatgtgcaagtt	CRISPR spacer
agctgacgaaaagtcagcttacaataatgtgcgagtt	Protospacer
********************************.****

22. spacer 8.3|1210298|37|CP031670|CRT matches to position: 1092347-1092383, mismatch: 1, identity: 0.973

gaaattggattcccaatttctacagacaatgcaagtt	CRISPR spacer
gaaattggattcccaatttctacagacaatgtaagtt	Protospacer
*******************************.*****

23. spacer 8.3|1210298|37|CP031670|CRT matches to position: 2557027-2557063, mismatch: 1, identity: 0.973

gaaattggattcccaatttctacagacaatgcaagtt	CRISPR spacer
gaaattggattcccaatttctagagacaatgcaagtt	Protospacer
********************** **************

24. spacer 5.1|794577|29|CP031670|CRISPRCasFinder matches to position: 843147-843175, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

25. spacer 5.1|794577|29|CP031670|CRISPRCasFinder matches to position: 955082-955110, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

26. spacer 5.1|794577|29|CP031670|CRISPRCasFinder matches to position: 1731891-1731919, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

27. spacer 5.1|794577|29|CP031670|CRISPRCasFinder matches to position: 2077484-2077512, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgtctgtagaatttcctttcgaaa	Protospacer
********.***********.********

28. spacer 5.1|794577|29|CP031670|CRISPRCasFinder matches to position: 2582313-2582341, mismatch: 2, identity: 0.931

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaa	Protospacer
*******..********************

29. spacer 8.1|1210186|37|CP031670|CRT matches to position: 843142-843178, mismatch: 2, identity: 0.946

gaatttcaaaaagaaattctacagacaatgcaagttg	CRISPR spacer
gaatttcgaaaagaaattctacaggcaatgcaagttg	Protospacer
*******.****************.************

30. spacer 8.1|1210186|37|CP031670|CRT matches to position: 1731886-1731922, mismatch: 2, identity: 0.946

gaatttcaaaaagaaattctacagacaatgcaagttg	CRISPR spacer
gaatttcgaaaagaaattctacaggcaatgcaagttg	Protospacer
*******.****************.************

31. spacer 8.1|1210186|37|CP031670|CRT matches to position: 2077479-2077515, mismatch: 2, identity: 0.946

gaatttcaaaaagaaattctacagacaatgcaagttg	CRISPR spacer
gaatttcgaaaggaaattctacagacaatgcaagttg	Protospacer
*******.***.*************************

32. spacer 8.1|1210186|37|CP031670|CRT matches to position: 2582310-2582346, mismatch: 2, identity: 0.946

gaatttcaaaaagaaattctacagacaatgcaagttg	CRISPR spacer
gaatttcgaaaagaaattctacaggcaatgcaagttg	Protospacer
*******.****************.************

33. spacer 8.1|1210186|37|CP031670|CRT matches to position: 2832886-2832922, mismatch: 2, identity: 0.946

gaatttcaaaaagaaattctacagacaatgcaagttg	CRISPR spacer
gaatttcgaaaagaaattctacaaacaatgcaagttg	Protospacer
*******.***************.*************

34. spacer 8.2|1210242|37|CP031670|CRT matches to position: 799951-799987, mismatch: 2, identity: 0.946

agctgacgaaaagtcagcttacaataatgtgcaagtt	CRISPR spacer
agctggcggaaagtcagcttacaataatgtgcaagtt	Protospacer
*****.**.****************************

35. spacer 8.2|1210242|37|CP031670|CRT matches to position: 1206274-1206310, mismatch: 2, identity: 0.946

agctgacgaaaagtcagcttacaataatgtgcaagtt	CRISPR spacer
agctggcgaaaagtcagcttacaaaaatgtgcaagtt	Protospacer
*****.****************** ************

36. spacer 8.2|1210242|37|CP031670|CRT matches to position: 1210354-1210390, mismatch: 2, identity: 0.946

agctgacgaaaagtcagcttacaataatgtgcaagtt	CRISPR spacer
agctggcggaaagtcagcttacaataatgtgcaagtt	Protospacer
*****.**.****************************

37. spacer 8.2|1210242|37|CP031670|CRT matches to position: 2066614-2066650, mismatch: 2, identity: 0.946

agctgacgaaaagtcagcttacaataatgtgcaagtt	CRISPR spacer
agctgacgaaaagtcagcttacgataatgtgcaggtt	Protospacer
**********************.**********.***

38. spacer 8.3|1210298|37|CP031670|CRT matches to position: 1206330-1206366, mismatch: 2, identity: 0.946

gaaattggattcccaatttctacagacaatgcaagtt	CRISPR spacer
gaaattggaaccccaatttctacagacaatgcaagtt	Protospacer
********* .**************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP031670_5 5.1|794577|29|CP031670|CRISPRCasFinder 794577-794605 29 MN693281 Marine virus AFVG_25M371, complete genome 6448-6476 7 0.759

1. spacer 5.1|794577|29|CP031670|CRISPRCasFinder matches to MN693281 (Marine virus AFVG_25M371, complete genome) position: , mismatch: 7, identity: 0.759

tgcattgtttgtagaatttcttttcgaaa	CRISPR spacer
tgcattgtttgtaggatttcttctaagtg	Protospacer
**************.*******.* .. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 731606 : 739426 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_2 751398 : 766185 12 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_3 854747 : 897982 61 Staphylococcus_phage(94.92%) tail,transposase,capsid,portal,protease,holin NA
DBSCAN-SWA_4 1067663 : 1076136 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 1127793 : 1173866 72 Staphylococcus_phage(68.12%) tail,head,capsid,lysis,portal,terminase,holin NA
DBSCAN-SWA_6 1561236 : 1648389 99 Staphylococcus_phage(72.97%) tail,head,tRNA,transposase,capsid,lysis,portal,terminase,protease,holin NA
DBSCAN-SWA_7 1703513 : 1711825 7 Staphylococcus_phage(16.67%) tRNA NA
DBSCAN-SWA_8 1780905 : 1789948 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_9 1922659 : 1996490 71 Staphylococcus_phage(88.89%) protease,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage