1. spacer 4.18|846610|21|CP024190|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 0, identity: 1.0
gccgccgttgccgaacagcag CRISPR spacer
gccgccgttgccgaacagcag Protospacer
*********************
2. spacer 4.3|845950|21|CP024190|CRISPRCasFinder matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 1, identity: 0.952
gccgccacctgcgccgtttcc CRISPR spacer
gccgccaccagcgccgtttcc Protospacer
********* ***********
3. spacer 4.3|845950|21|CP024190|CRISPRCasFinder matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 1, identity: 0.952
gccgccacctgcgccgtttcc CRISPR spacer
gccgccacctgcgccgtatcc Protospacer
***************** ***
4. spacer 4.3|845950|21|CP024190|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 1, identity: 0.952
gccgccacctgcgccgtttcc CRISPR spacer
gccgccacctgcgccgattcc Protospacer
**************** ****
5. spacer 4.18|846610|21|CP024190|CRISPRCasFinder matches to NZ_CP022992 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN2, complete sequence) position: , mismatch: 1, identity: 0.952
gccgccgttgccgaacagcag CRISPR spacer
gccgcccttgccgaacagcag Protospacer
****** **************
6. spacer 4.18|846610|21|CP024190|CRISPRCasFinder matches to NZ_CP022992 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN2, complete sequence) position: , mismatch: 1, identity: 0.952
gccgccgttgccgaacagcag CRISPR spacer
gccgcccttgccgaacagcag Protospacer
****** **************
7. spacer 4.18|846610|21|CP024190|CRISPRCasFinder matches to NZ_CP037902 (Cupriavidus metallidurans strain BS1 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
gccgccgttgccgaacagcag CRISPR spacer
gccgccgttgccgaacaccag Protospacer
***************** ***
8. spacer 4.18|846610|21|CP024190|CRISPRCasFinder matches to NC_016110 (Streptomyces pratensis ATCC 33331 plasmid pSFLA01, complete sequence) position: , mismatch: 1, identity: 0.952
gccgccgttgccgaacagcag CRISPR spacer
gccgccgttgacgaacagcag Protospacer
********** **********
9. spacer 4.18|846610|21|CP024190|CRISPRCasFinder matches to NC_010627 (Paraburkholderia phymatum STM815 plasmid pBPHY02, complete sequence) position: , mismatch: 1, identity: 0.952
gccgccgttgccgaacagcag CRISPR spacer
gccgcccttgccgaacagcag Protospacer
****** **************
10. spacer 4.18|846610|21|CP024190|CRISPRCasFinder matches to NC_010627 (Paraburkholderia phymatum STM815 plasmid pBPHY02, complete sequence) position: , mismatch: 1, identity: 0.952
gccgccgttgccgaacagcag CRISPR spacer
gccgcccttgccgaacagcag Protospacer
****** **************
11. spacer 4.18|846610|21|CP024190|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 1, identity: 0.952
gccgccgttgccgaacagcag CRISPR spacer
gccgccgatgccgaacagcag Protospacer
******* *************
12. spacer 4.18|846610|21|CP024190|CRISPRCasFinder matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 1, identity: 0.952
gccgccgttgccgaacagcag CRISPR spacer
gccgccgttgccgaacagccg Protospacer
******************* *
13. spacer 4.18|846610|21|CP024190|CRISPRCasFinder matches to NZ_CP033968 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.952
gccgccgttgccgaacagcag CRISPR spacer
gccgccgttgccgaacaccag Protospacer
***************** ***
14. spacer 4.18|846610|21|CP024190|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 1, identity: 0.952
gccgccgttgccgaacagcag CRISPR spacer
gccgccgttgccgaacagccg Protospacer
******************* *
15. spacer 4.18|846610|21|CP024190|CRISPRCasFinder matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 1, identity: 0.952
gccgccgttgccgaacagcag CRISPR spacer
gccgccgttgccgaacagccg Protospacer
******************* *
16. spacer 5.1|900644|20|CP024190|CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 1, identity: 0.95
tggatggcgccgttcgcgcc CRISPR spacer
aggatggcgccgttcgcgcc Protospacer
*******************
17. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 1, identity: 0.957
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttgccgccggtgcc Protospacer
****************** ****
18. spacer 5.2|900695|23|CP024190|CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 1, identity: 0.957
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttgccgccattgcc Protospacer
*****************.*****
19. spacer 5.2|900695|23|CP024190|CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 1, identity: 0.957
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttgccgccattgcc Protospacer
*****************.*****
20. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 1, identity: 0.957
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttgccgccattgcc Protospacer
*****************.*****
21. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 1, identity: 0.957
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttgccgccattgcc Protospacer
*****************.*****
22. spacer 5.2|900695|23|CP024190|CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 1, identity: 0.957
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttgccgccattgcc Protospacer
*****************.*****
23. spacer 5.2|900695|23|CP024190|CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 1, identity: 0.957
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttgccgccggtgcc Protospacer
****************** ****
24. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 1, identity: 0.957
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttgccgccattgcc Protospacer
*****************.*****
25. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 1, identity: 0.957
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttgccgccattgcc Protospacer
*****************.*****
26. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 1, identity: 0.957
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttgccgccattgcc Protospacer
*****************.*****
27. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 1, identity: 0.957
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttgccgccattgcc Protospacer
*****************.*****
28. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 1, identity: 0.957
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttgccgccattgcc Protospacer
*****************.*****
29. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 1, identity: 0.957
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttgccgccattgcc Protospacer
*****************.*****
30. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 1, identity: 0.957
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttgccgccattgcc Protospacer
*****************.*****
31. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 1, identity: 0.957
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttgccgccattgcc Protospacer
*****************.*****
32. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 1, identity: 0.957
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttgccgccattgcc Protospacer
*****************.*****
33. spacer 5.2|900695|23|CP024190|CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 1, identity: 0.957
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttgccgccattgcc Protospacer
*****************.*****
34. spacer 7.9|1614190|21|CP024190|CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 1, identity: 0.952
ccaccgacaccgccgtcggcg CRISPR spacer
acaccgacaccgccgtcggcg Protospacer
********************
35. spacer 7.9|1614190|21|CP024190|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 1, identity: 0.952
ccaccgacaccgccgtcggcg CRISPR spacer
ccaccgccaccgccgtcggcg Protospacer
****** **************
36. spacer 7.9|1614190|21|CP024190|CRT matches to NC_019957 (Mycobacterium sp. JS623 plasmid pMYCSM01, complete sequence) position: , mismatch: 1, identity: 0.952
ccaccgacaccgccgtcggcg CRISPR spacer
ccaccgacaccgccgtccgcg Protospacer
***************** ***
37. spacer 7.9|1614190|21|CP024190|CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 1, identity: 0.952
ccaccgacaccgccgtcggcg CRISPR spacer
ccaccgacatcgccgtcggcg Protospacer
*********.***********
38. spacer 16.5|5388706|20|CP024190|CRISPRCasFinder matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 1, identity: 0.95
cgacggcggagcgacgctga CRISPR spacer
cgacggcggagcgacgctgg Protospacer
*******************.
39. spacer 4.18|846610|21|CP024190|CRISPRCasFinder matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 2, identity: 0.905
gccgccgttgccgaacagcag CRISPR spacer
gccgccgttgccgaacagcgc Protospacer
*******************.
40. spacer 4.18|846610|21|CP024190|CRISPRCasFinder matches to NC_047756 (Caulobacter phage Sansa, complete genome) position: , mismatch: 2, identity: 0.905
gccgccgttgccgaacagcag CRISPR spacer
gccgccgttgccgaacagctt Protospacer
*******************
41. spacer 4.19|846655|24|CP024190|CRISPRCasFinder matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 2, identity: 0.917
cccgccagtcaccaggctgaaccc CRISPR spacer
cccgctaggcaccaggctgaaccc Protospacer
*****.** ***************
42. spacer 4.19|846655|24|CP024190|CRISPRCasFinder matches to NZ_CP022365 (Azospirillum sp. TSH58 plasmid TSH58_p06, complete sequence) position: , mismatch: 2, identity: 0.917
cccgccagtcaccaggctgaaccc CRISPR spacer
cccgctaggcaccaggctgaaccc Protospacer
*****.** ***************
43. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
ccgttgccgttgccgccgttgcc Protospacer
.*********************
44. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
aagttgccgttgccgccgttgcc Protospacer
. *********************
45. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP020948 (Rhizobium sp. CIAT894 plasmid pRheCIAT894a, complete sequence) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
ttgttcccgttgccgccgttgcc Protospacer
**** *****************
46. spacer 5.2|900695|23|CP024190|CRT matches to CP053333 (Salmonella enterica subsp. diarizonae serovar 47:k:z35 strain 2009K1094 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
ctgttgccgttgccgccgttgtc Protospacer
********************.*
47. spacer 5.2|900695|23|CP024190|CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttaccgccattgcc Protospacer
***********.*****.*****
48. spacer 5.2|900695|23|CP024190|CRT matches to NC_023067 (Streptomyces sp. F2 plasmid pFP3, complete sequence) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttcccgttgccgccgttacc Protospacer
***** **************.**
49. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP049159 (Caballeronia sp. SBC1 plasmid pSBC1_3, complete sequence) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgatgcccttgccgccgttgcc Protospacer
*** **** **************
50. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgtcgccgccggtgcc Protospacer
**********.******* ****
51. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgtcgccgccggtgcc Protospacer
**********.******* ****
52. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP049319 (Caballeronia sp. SBC2 plasmid pSBC2-3, complete sequence) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgatgcccttgccgccgttgcc Protospacer
*** **** **************
53. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttaccgccattgcc Protospacer
***********.*****.*****
54. spacer 5.2|900695|23|CP024190|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgccgccgttgccgccgttgcc Protospacer
***..******************
55. spacer 5.2|900695|23|CP024190|CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttaccgccattgcc Protospacer
***********.*****.*****
56. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgtcgccgccggtgcc Protospacer
**********.******* ****
57. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgtcgccgccggtgcc Protospacer
**********.******* ****
58. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttaccgccattgcc Protospacer
***********.*****.*****
59. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttaccgccattgcc Protospacer
***********.*****.*****
60. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttaccgccattgcc Protospacer
***********.*****.*****
61. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgccgttaccgccattgcc Protospacer
***********.*****.*****
62. spacer 5.2|900695|23|CP024190|CRT matches to MK765595 (Tortoise microvirus 43 isolate 43_SP_105, complete genome) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
gtcttgccggtgccgccgttgcc Protospacer
** ****** *************
63. spacer 5.2|900695|23|CP024190|CRT matches to GU903191 (Escherichia phage vB_EcoM_ECO1230-10, complete genome) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgtagccgctgccgccgttgcc Protospacer
**** ****.*************
64. spacer 5.2|900695|23|CP024190|CRT matches to MH651168 (Gordonia phage Ashertheman, complete genome) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgctgccggtgccgccgttgcc Protospacer
***.***** *************
65. spacer 5.2|900695|23|CP024190|CRT matches to NC_047891 (Gordonia phage BENtherdunthat, complete genome) position: , mismatch: 2, identity: 0.913
gtgttgccgttgccgccgttgcc CRISPR spacer
gcgttgcctttgccgccgttgcc Protospacer
*.****** **************
66. spacer 5.8|901031|23|CP024190|CRT matches to MT121966 (Pseudomonas phage SC_8_H2H8_2017 translation initiation factor IF-3, replication protein P, integrase, terminase, terminase A, capsid family protein, tail protein, and minor tail protein L genes, complete cds) position: , mismatch: 2, identity: 0.913
gcgccaccggtggcaccggtacc CRISPR spacer
gggccaccggtggcaccggtaac Protospacer
* ******************* *
67. spacer 5.8|901031|23|CP024190|CRT matches to NC_015952 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence) position: , mismatch: 2, identity: 0.913
gcgccaccggtggcaccggtacc CRISPR spacer
gcgtcaccggtgtcaccggtacc Protospacer
***.******** **********
68. spacer 5.11|901199|23|CP024190|CRT matches to MK376954 (Gordonia phage WhoseManz, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgtc Protospacer
.*********** **********
69. spacer 5.11|901199|23|CP024190|CRT matches to NC_011273 (Mycobacterium phage Myrna, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgta Protospacer
************ *********
70. spacer 5.11|901199|23|CP024190|CRT matches to MT889397 (Mycobacterium phage OfUltron, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgctgacgctgttgtc Protospacer
*********.******.******
71. spacer 5.11|901199|23|CP024190|CRT matches to KT373978 (Mycobacterium phage Ukulele, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
72. spacer 5.11|901199|23|CP024190|CRT matches to MF919525 (Mycobacterium phage Murica, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
73. spacer 5.11|901199|23|CP024190|CRT matches to MF668277 (Mycobacterium phage MadamMonkfish, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
74. spacer 5.11|901199|23|CP024190|CRT matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
75. spacer 5.11|901199|23|CP024190|CRT matches to MK814754 (Mycobacterium phage Sumter, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
76. spacer 5.11|901199|23|CP024190|CRT matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
77. spacer 5.11|901199|23|CP024190|CRT matches to MK433262 (Mycobacterium phage Nimrod, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
78. spacer 5.11|901199|23|CP024190|CRT matches to MT889396 (Mycobacterium phage Seabastian, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgctgacgctgttgtc Protospacer
*********.******.******
79. spacer 5.11|901199|23|CP024190|CRT matches to MK016498 (Mycobacterium phage Manda, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
80. spacer 5.11|901199|23|CP024190|CRT matches to MG872843 (Mycobacterium phage Sotrice96, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
81. spacer 5.11|901199|23|CP024190|CRT matches to MH651174 (Mycobacterium phage Easy2Say, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
82. spacer 5.11|901199|23|CP024190|CRT matches to MH000607 (Mycobacterium phage RiverMonster, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
83. spacer 5.11|901199|23|CP024190|CRT matches to MT723943 (Mycobacterium phage Cactus, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
84. spacer 5.11|901199|23|CP024190|CRT matches to MK967397 (Mycobacterium phage Mahavrat, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
85. spacer 5.11|901199|23|CP024190|CRT matches to MT114165 (Mycobacterium phage BadStone, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
86. spacer 5.11|901199|23|CP024190|CRT matches to MG872831 (Mycobacterium phage Asriel, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
87. spacer 5.11|901199|23|CP024190|CRT matches to MK757445 (Mycobacterium phage Lilizi, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
88. spacer 5.11|901199|23|CP024190|CRT matches to MH576953 (Mycobacterium phage Hopey, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
89. spacer 5.11|901199|23|CP024190|CRT matches to KX834009 (Mycobacterium phage Goldilocks, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
90. spacer 5.11|901199|23|CP024190|CRT matches to MG099953 (Mycobacterium phage Youngblood, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
91. spacer 5.11|901199|23|CP024190|CRT matches to MF919506 (Mycobacterium phage FireRed, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
92. spacer 5.11|901199|23|CP024190|CRT matches to MK359320 (Mycobacterium phage Cookies, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
93. spacer 5.11|901199|23|CP024190|CRT matches to MH015258 (Ruegeria phage vB_RpoS-V16, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ccgccgccgttgccgccgttgtc Protospacer
*.********** **********
94. spacer 5.11|901199|23|CP024190|CRT matches to AY129331 (Mycobacterium virus Cjw1, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
95. spacer 5.11|901199|23|CP024190|CRT matches to MN586043 (Mycobacterium phage Buck, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
96. spacer 5.11|901199|23|CP024190|CRT matches to MT522000 (Mycobacterium phage Soul22, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
97. spacer 5.11|901199|23|CP024190|CRT matches to MH536829 (Mycobacterium phage TBrady12, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
98. spacer 5.11|901199|23|CP024190|CRT matches to KY348865 (Mycobacterium phage Bubbles123, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
99. spacer 5.11|901199|23|CP024190|CRT matches to MN096364 (Mycobacterium phage Tomaszewski, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
100. spacer 5.11|901199|23|CP024190|CRT matches to MN428047 (Mycobacterium phage Doomphist, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
101. spacer 5.11|901199|23|CP024190|CRT matches to MF919502 (Mycobacterium phage Demsculpinboyz, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
102. spacer 5.11|901199|23|CP024190|CRT matches to MH590587 (Mycobacterium phage xkcd, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
103. spacer 5.11|901199|23|CP024190|CRT matches to MH371112 (Mycobacterium phage Adnama, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
104. spacer 5.11|901199|23|CP024190|CRT matches to MF919541 (Mycobacterium phage YassJohnny, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
105. spacer 5.11|901199|23|CP024190|CRT matches to KX611831 (Mycobacterium phage Pharsalus, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
106. spacer 5.11|901199|23|CP024190|CRT matches to NC_042027 (Mycobacterium phage Pumpkin, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
107. spacer 5.11|901199|23|CP024190|CRT matches to KF493883 (Mycobacterium phage Mosby, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
108. spacer 5.11|901199|23|CP024190|CRT matches to MH513978 (Mycobacterium phage Phaja, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
109. spacer 5.11|901199|23|CP024190|CRT matches to AY129336 (Mycobacteriophage Che9d, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
110. spacer 5.11|901199|23|CP024190|CRT matches to MN428059 (Mycobacterium phage Kanye, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
111. spacer 5.11|901199|23|CP024190|CRT matches to KY549152 (Mycobacterium phage Maxxinista, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
112. spacer 5.11|901199|23|CP024190|CRT matches to MH399778 (Mycobacterium phage Icee, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
113. spacer 5.11|901199|23|CP024190|CRT matches to MF919529 (Mycobacterium phage Sassay, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
114. spacer 5.11|901199|23|CP024190|CRT matches to MH513972 (Mycobacterium phage IHOP, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
115. spacer 5.11|901199|23|CP024190|CRT matches to MT771340 (Mycobacterium phage Jorgensen, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
116. spacer 5.11|901199|23|CP024190|CRT matches to MK359343 (Mycobacterium phage Pollywog, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
117. spacer 5.11|901199|23|CP024190|CRT matches to MN586051 (Mycobacterium phage Myrale, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
118. spacer 5.11|901199|23|CP024190|CRT matches to MK359309 (Mycobacterium phage Czyszczon1, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
119. spacer 5.11|901199|23|CP024190|CRT matches to KU865303 (Mycobacterium phage TeardropMSU, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
120. spacer 5.11|901199|23|CP024190|CRT matches to MN586041 (Mycobacterium phage Elite2014, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
121. spacer 5.11|901199|23|CP024190|CRT matches to MF919524 (Mycobacterium phage MISSy, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
122. spacer 5.11|901199|23|CP024190|CRT matches to EU816588 (Mycobacterium phage Porky, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
123. spacer 5.11|901199|23|CP024190|CRT matches to MT952854 (Mycobacterium phage Miniwave, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
124. spacer 5.11|901199|23|CP024190|CRT matches to MK016502 (Mycobacterium phage Pat3, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
125. spacer 5.11|901199|23|CP024190|CRT matches to JF937106 (Mycobacterium phage SirDuracell, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
126. spacer 5.11|901199|23|CP024190|CRT matches to NC_042030 (Mycobacterium phage Yoshi, complete sequence) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
127. spacer 5.11|901199|23|CP024190|CRT matches to KC748969 (Mycobacterium phage Phaux, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
128. spacer 5.11|901199|23|CP024190|CRT matches to MH536827 (Mycobacterium phage Simpliphy, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
129. spacer 5.11|901199|23|CP024190|CRT matches to MH669002 (Mycobacterium phage Emmina, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
130. spacer 5.11|901199|23|CP024190|CRT matches to MN586035 (Mycobacterium phage ChosenOne, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
131. spacer 5.11|901199|23|CP024190|CRT matches to KR080204 (Mycobacterium phage Mindy, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
132. spacer 5.11|901199|23|CP024190|CRT matches to NC_048729 (Mycobacterium phage Renaud18, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
133. spacer 5.11|901199|23|CP024190|CRT matches to DQ398041 (Mycobacterium virus 244, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
134. spacer 5.11|901199|23|CP024190|CRT matches to MG872832 (Mycobacterium phage Barbarian, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
135. spacer 5.11|901199|23|CP024190|CRT matches to NC_029079 (Mycobacterium phage Dusk, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
136. spacer 5.11|901199|23|CP024190|CRT matches to MN586032 (Mycobacterium phage Command613, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
137. spacer 5.11|901199|23|CP024190|CRT matches to KC661277 (Mycobacterium phage Phrux, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
138. spacer 5.11|901199|23|CP024190|CRT matches to JF937096 (Mycobacterium phage Henry, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
139. spacer 5.11|901199|23|CP024190|CRT matches to NC_022065 (Mycobacterium phage Contagion, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
140. spacer 5.11|901199|23|CP024190|CRT matches to KX817173 (Mycobacterium phage Tuco, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
141. spacer 5.11|901199|23|CP024190|CRT matches to MK937593 (Mycobacterium phage Flypotenuse, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
142. spacer 5.11|901199|23|CP024190|CRT matches to MG757160 (Mycobacterium phage Kimchi, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
143. spacer 5.11|901199|23|CP024190|CRT matches to MT889380 (Mycobacterium phage Coco12, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
144. spacer 5.11|901199|23|CP024190|CRT matches to MN096361 (Mycobacterium phage Gator, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
145. spacer 5.11|901199|23|CP024190|CRT matches to MN586013 (Mycobacterium phage Traaww1, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
146. spacer 5.11|901199|23|CP024190|CRT matches to NC_026585 (Mycobacteriophage Estave1, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
147. spacer 5.11|901199|23|CP024190|CRT matches to MK305886 (Mycobacterium phage Poenanya, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
148. spacer 5.11|901199|23|CP024190|CRT matches to JN859129 (Mycobacterium virus DotProduct, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
149. spacer 5.11|901199|23|CP024190|CRT matches to MH020247 (Mycobacterium phage MPhalcon, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
150. spacer 5.11|901199|23|CP024190|CRT matches to JN391441 (Mycobacterium phage Elph10, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
151. spacer 5.11|901199|23|CP024190|CRT matches to KF306380 (Mycobacterium phage DrDrey, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
152. spacer 5.11|901199|23|CP024190|CRT matches to MH576956 (Mycobacterium phage Inca, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
153. spacer 5.11|901199|23|CP024190|CRT matches to MK620893 (Mycobacterium phage HanKaySha, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
154. spacer 5.11|901199|23|CP024190|CRT matches to MG925354 (Mycobacterium phage Ogopogo, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
155. spacer 5.11|901199|23|CP024190|CRT matches to MH779503 (Mycobacterium phage Gemini, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
156. spacer 5.11|901199|23|CP024190|CRT matches to NC_022969 (Mycobacterium phage PhatBacter, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
157. spacer 5.11|901199|23|CP024190|CRT matches to MN586019 (Mycobacterium phage Stark, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
158. spacer 5.11|901199|23|CP024190|CRT matches to MN586050 (Mycobacterium phage Lilpickle, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
159. spacer 5.11|901199|23|CP024190|CRT matches to NC_041850 (Mycobacterium phage Eureka, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
160. spacer 5.11|901199|23|CP024190|CRT matches to KF562099 (Mycobacterium phage Bruin, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
161. spacer 5.11|901199|23|CP024190|CRT matches to MK016491 (Mycobacterium phage BaboJay, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
162. spacer 5.11|901199|23|CP024190|CRT matches to NC_028906 (Mycobacterium phage Toto, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
163. spacer 5.11|901199|23|CP024190|CRT matches to KY319168 (Mycobacterium phage CrystalP, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
164. spacer 5.11|901199|23|CP024190|CRT matches to KF562100 (Mycobacterium phage HufflyPuff, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
165. spacer 5.11|901199|23|CP024190|CRT matches to NC_023698 (Mycobacterium phage Avani, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
166. spacer 5.11|901199|23|CP024190|CRT matches to MN428051 (Mycobacterium phage Modragons, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgctgacgctgttgtc Protospacer
*********.******.******
167. spacer 5.11|901199|23|CP024190|CRT matches to MG872837 (Mycobacterium phage Gage, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
168. spacer 5.11|901199|23|CP024190|CRT matches to MH536820 (Mycobacterium phage Glexan, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
169. spacer 5.11|901199|23|CP024190|CRT matches to NC_008194 (Mycobacterium phage 244, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
170. spacer 5.11|901199|23|CP024190|CRT matches to NC_028923 (Mycobacterium phage Llama, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgctgacgctgttgtc Protospacer
*********.******.******
171. spacer 5.11|901199|23|CP024190|CRT matches to JF937091 (Mycobacterium phage Bask21, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
172. spacer 5.11|901199|23|CP024190|CRT matches to KF188414 (Mycobacterium phage ABCat, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
173. spacer 5.11|901199|23|CP024190|CRT matches to JN006062 (Mycobacterium phage Rakim, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
174. spacer 5.11|901199|23|CP024190|CRT matches to NC_011054 (Mycobacterium phage Boomer, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
175. spacer 5.11|901199|23|CP024190|CRT matches to MK801726 (Mycobacterium phage ChotaBhai, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
176. spacer 5.11|901199|23|CP024190|CRT matches to MH727557 (Mycobacterium phage Paperbeatsrock, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
177. spacer 5.11|901199|23|CP024190|CRT matches to KF279417 (Mycobacterium phage Quink, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
178. spacer 5.11|901199|23|CP024190|CRT matches to MH399774 (Mycobacterium phage DoctorDiddles, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
179. spacer 5.11|901199|23|CP024190|CRT matches to JN382248 (Mycobacterium phage Lilac, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
180. spacer 5.11|901199|23|CP024190|CRT matches to NC_028785 (Mycobacterium phage NelitzaMV, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
181. spacer 5.11|901199|23|CP024190|CRT matches to MN586044 (Mycobacterium phage Rimmer, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
182. spacer 5.11|901199|23|CP024190|CRT matches to MN586017 (Mycobacterium phage OrionPax, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
183. spacer 5.11|901199|23|CP024190|CRT matches to MK559429 (Mycobacterium phage Moldemort, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
184. spacer 5.11|901199|23|CP024190|CRT matches to MF919535 (Mycobacterium phage Terminus, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
185. spacer 5.11|901199|23|CP024190|CRT matches to NC_022976 (Mycobacterium phage Nala, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
186. spacer 5.11|901199|23|CP024190|CRT matches to NC_021305 (Mycobacterium phage Murphy, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
187. spacer 5.11|901199|23|CP024190|CRT matches to MF919540 (Mycobacterium phage Willez, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
188. spacer 5.11|901199|23|CP024190|CRT matches to MT114167 (Mycobacterium phage Phanphagia, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
189. spacer 5.11|901199|23|CP024190|CRT matches to MH077585 (Mycobacterium phage TChen, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
190. spacer 5.11|901199|23|CP024190|CRT matches to MT522005 (Mycobacterium phage Misfit, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
191. spacer 5.11|901199|23|CP024190|CRT matches to MN586037 (Mycobacterium phage GooberAzure, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
192. spacer 5.11|901199|23|CP024190|CRT matches to KC691255 (Mycobacterium phage Dumbo, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
193. spacer 5.11|901199|23|CP024190|CRT matches to EU816591 (Mycobacterium phage Kostya, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
194. spacer 5.11|901199|23|CP024190|CRT matches to MN586034 (Mycobacterium phage Hoonter, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
195. spacer 5.11|901199|23|CP024190|CRT matches to NC_022085 (Mycobacterium phage Goku, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
196. spacer 5.11|901199|23|CP024190|CRT matches to NC_048788 (Mycobacterium phage ThetaBob, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgcc Protospacer
************ ********.*
197. spacer 5.11|901199|23|CP024190|CRT matches to NC_004681 (Mycobacterium phage Cjw1, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
198. spacer 5.11|901199|23|CP024190|CRT matches to MH513983 (Mycobacterium phage ShereKhan, complete genome) position: , mismatch: 2, identity: 0.913
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttggc Protospacer
************ ******** *
199. spacer 5.13|901337|23|CP024190|CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 2, identity: 0.913
tcgcctcggatggtgccgccgcc CRISPR spacer
tcgtctcggatggtggcgccgcc Protospacer
***.*********** *******
200. spacer 7.8|1614151|21|CP024190|CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 2, identity: 0.905
ccgccgctgccgaacagcaac CRISPR spacer
ccgccgctgccgaacagcacg Protospacer
*******************
201. spacer 7.9|1614190|21|CP024190|CRT matches to NZ_CP023152 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence) position: , mismatch: 2, identity: 0.905
ccaccgacaccgccgtcggcg CRISPR spacer
gcaccgacaccgccgtcggca Protospacer
*******************.
202. spacer 7.9|1614190|21|CP024190|CRT matches to NZ_CP010860 (Marinovum algicola DG 898 plasmid pMaD5, complete sequence) position: , mismatch: 2, identity: 0.905
ccaccgacaccgccgtcggcg CRISPR spacer
agaccgacaccgccgtcggcg Protospacer
*******************
203. spacer 7.9|1614190|21|CP024190|CRT matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 2, identity: 0.905
ccaccgacaccgccgtcggcg CRISPR spacer
gcaccgacaccgccgtcggca Protospacer
*******************.
204. spacer 11.6|3846189|23|CP024190|CRT matches to NZ_CP031103 (Leclercia sp. W17 plasmid pW17-2, complete sequence) position: , mismatch: 2, identity: 0.913
gttcgccagcggcggtaccggcg CRISPR spacer
gttcggcagcggcggtaccggct Protospacer
***** ****************
205. spacer 11.6|3846189|23|CP024190|CRT matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 2, identity: 0.913
gttcgccagcggcggtaccggcg CRISPR spacer
gttcgccaccggcggcaccggcg Protospacer
******** ******.*******
206. spacer 11.6|3846189|23|CP024190|CRT matches to MN175603 (Microbacterium phage Tyrumbra, complete genome) position: , mismatch: 2, identity: 0.913
gttcgccagcggcggtaccggcg CRISPR spacer
gttcgccagcggcggtgccgccg Protospacer
****************.*** **
207. spacer 11.6|3846189|23|CP024190|CRT matches to MH271312 (Microbacterium phage RobsFeet, complete genome) position: , mismatch: 2, identity: 0.913
gttcgccagcggcggtaccggcg CRISPR spacer
gttcgccagcggcggtgccgccg Protospacer
****************.*** **
208. spacer 11.6|3846189|23|CP024190|CRT matches to MK524510 (Microbacterium phage Fireman, complete genome) position: , mismatch: 2, identity: 0.913
gttcgccagcggcggtaccggcg CRISPR spacer
gttcgccagcggcggtgccgccg Protospacer
****************.*** **
209. spacer 11.6|3846189|23|CP024190|CRT matches to NC_047988 (Microbacterium phage Metamorphoo, complete genome) position: , mismatch: 2, identity: 0.913
gttcgccagcggcggtaccggcg CRISPR spacer
gttcgccagcggcggtgccgccg Protospacer
****************.*** **
210. spacer 11.12|3846507|26|CP024190|CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 2, identity: 0.923
caatggcggcagcgccgggctggtcg CRISPR spacer
caatgtcggcagcgcggggctggtcg Protospacer
***** ********* **********
211. spacer 12.1|4334059|22|CP024190|CRISPRCasFinder matches to NC_012854 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132505, complete sequence) position: , mismatch: 2, identity: 0.909
ccagaagccggtgttcacgtcg CRISPR spacer
ccagaagccggtgttcaagtct Protospacer
***************** ***
212. spacer 12.1|4334059|22|CP024190|CRISPRCasFinder matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 2, identity: 0.909
ccagaagccggtgttcacgtcg CRISPR spacer
ccagaagccggtgctcacgtca Protospacer
*************.*******.
213. spacer 3.1|791267|27|CP024190|CRISPRCasFinder matches to NZ_AP017657 (Sphingobium cloacae strain JCM 10874 plasmid pSCLO_3, complete sequence) position: , mismatch: 3, identity: 0.889
gtggagcgatcgcgagcgcggcggagc CRISPR spacer
gcggagcgatcgcgcacgcggcggagc Protospacer
*.************ .***********
214. spacer 4.1|845854|24|CP024190|CRISPRCasFinder matches to NC_013930 (Thioalkalivibrio sp. K90mix plasmid pTK9001, complete sequence) position: , mismatch: 3, identity: 0.875
tccggaagtgataccgccaaagcc CRISPR spacer
tccggaggtgataccgctaaagct Protospacer
******.**********.*****.
215. spacer 4.14|846427|24|CP024190|CRISPRCasFinder matches to NC_012987 (Methylorubrum extorquens AM1 plasmid p1METDI, complete sequence) position: , mismatch: 3, identity: 0.875
gccaccggtgccggagaacacgcc CRISPR spacer
gccaccggagccggagaacacgag Protospacer
******** *************
216. spacer 4.14|846427|24|CP024190|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 3, identity: 0.875
gccaccggtgccggagaacacgcc CRISPR spacer
gccaccggggccggagaacgcgct Protospacer
******** **********.***.
217. spacer 4.14|846427|24|CP024190|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 3, identity: 0.875
gccaccggtgccggagaacacgcc CRISPR spacer
gccaccggggccggagaacgcgct Protospacer
******** **********.***.
218. spacer 4.19|846655|24|CP024190|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 3, identity: 0.875
cccgccagtcaccaggctgaaccc CRISPR spacer
cccgacagtcaccaggctgaccca Protospacer
**** *************** **
219. spacer 5.2|900695|23|CP024190|CRT matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 3, identity: 0.87
gtgttgccgttgccgccgttgcc CRISPR spacer
ccgtagccgttgccgccgttgcc Protospacer
.** ******************
220. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP006993 (Methylobacterium sp. AMS5 plasmid pAMS5a, complete sequence) position: , mismatch: 3, identity: 0.87
gtgttgccgttgccgccgttgcc CRISPR spacer
gtgttgcccttgccgccgttggg Protospacer
******** ************
221. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 3, identity: 0.87
gtgttgccgttgccgccgttgcc CRISPR spacer
ccgttgccattgccgccgttgcc Protospacer
.******.**************
222. spacer 5.2|900695|23|CP024190|CRT matches to MK376954 (Gordonia phage WhoseManz, complete genome) position: , mismatch: 3, identity: 0.87
gtgttgccgttgccgccgttgcc CRISPR spacer
tcgttgtcgttgccgccgttgcc Protospacer
.****.****************
223. spacer 5.4|900809|23|CP024190|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 3, identity: 0.87
tcacctctgatcgcgccgtcgcc CRISPR spacer
gcacctctgatcgcgccgtcgat Protospacer
******************** .
224. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.885
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
tcgccgccgccggcgccgttgttgaa Protospacer
*.*******.** *************
225. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.885
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
tcgccgccgttgacgccgttgttgaa Protospacer
*.********.* *************
226. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.885
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
tcgccgccgccgctgccgttgttgaa Protospacer
*.*******.***.************
227. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 3, identity: 0.885
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
tcgccgccgccggcgccgttgttgaa Protospacer
*.*******.** *************
228. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 3, identity: 0.885
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
tcgccgccgccgctgccgttgttgaa Protospacer
*.*******.***.************
229. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 3, identity: 0.885
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
tcgccgccgccgctgccgttgttgaa Protospacer
*.*******.***.************
230. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 3, identity: 0.885
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
tcgccgccgttgacgccgttgttgaa Protospacer
*.********.* *************
231. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 3, identity: 0.885
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
tcgccgccgccggcgccgttgttgaa Protospacer
*.*******.** *************
232. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.885
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
tcgccgccgccggcgccgttgttgaa Protospacer
*.*******.** *************
233. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.885
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
tcgccgccgttgacgccgttgttgaa Protospacer
*.********.* *************
234. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.885
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
tcgccgccgccgctgccgttgttgaa Protospacer
*.*******.***.************
235. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 3, identity: 0.885
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
tcgccgccgccgctgccgttgttgaa Protospacer
*.*******.***.************
236. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 3, identity: 0.885
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
tcgccgccgttgacgccgttgttgaa Protospacer
*.********.* *************
237. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.885
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
tcgccgccgttgacgccgttgttgaa Protospacer
*.********.* *************
238. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.885
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
tcgccgccgccgctgccgttgttgaa Protospacer
*.*******.***.************
239. spacer 5.7|900974|26|CP024190|CRT matches to KC736071 (Mycobacterium phage WIVsmall, complete genome) position: , mismatch: 3, identity: 0.885
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgctgga Protospacer
**********.**********.**.*
240. spacer 5.7|900974|26|CP024190|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 3, identity: 0.885
ttgccgccgtcgccgccgttgttgaa-- CRISPR spacer
ttgccgccgccgccgccgttg--gaacc Protospacer
*********.*********** ***
241. spacer 5.10|901142|26|CP024190|CRT matches to NZ_CP045376 (Sulfitobacter sp. THAF37 plasmid pTHAF37_d, complete sequence) position: , mismatch: 3, identity: 0.885
aagccggtggccaaggtgccgttgcc CRISPR spacer
acgccgttggccaaggtgccgatgcc Protospacer
* **** ************** ****
242. spacer 5.11|901199|23|CP024190|CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
tcgccgccgttgacgccgttgtt Protospacer
..********************.
243. spacer 5.11|901199|23|CP024190|CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgacgccgttcat Protospacer
******************** .
244. spacer 5.11|901199|23|CP024190|CRT matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
tcgccgccgttgacgccgttgtt Protospacer
..********************.
245. spacer 5.11|901199|23|CP024190|CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
tcgccgccgttgacgccgttgtt Protospacer
..********************.
246. spacer 5.11|901199|23|CP024190|CRT matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
tcgccgccgttgacgccgttgtt Protospacer
..********************.
247. spacer 5.11|901199|23|CP024190|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
tcgccgccgttgacgccgttgtt Protospacer
..********************.
248. spacer 5.11|901199|23|CP024190|CRT matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgacgccgttcat Protospacer
******************** .
249. spacer 5.11|901199|23|CP024190|CRT matches to NZ_AP022849 (Bosea sp. ANAM02 plasmid pANAM02, complete sequence) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
cggccgccgttgacgccgttgat Protospacer
* ******************* .
250. spacer 5.11|901199|23|CP024190|CRT matches to MH020235 (Mycobacterium phage Batiatus, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgta Protospacer
.*********** *********
251. spacer 5.11|901199|23|CP024190|CRT matches to MN586029 (Mycobacterium phage Hannaconda, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgta Protospacer
.*********** *********
252. spacer 5.11|901199|23|CP024190|CRT matches to KM597530 (Mycobacterium phage Bipolar, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgta Protospacer
.*********** *********
253. spacer 5.11|901199|23|CP024190|CRT matches to MH590598 (Mycobacterium phage Krakatau, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgta Protospacer
.*********** *********
254. spacer 5.11|901199|23|CP024190|CRT matches to MK016496 (Mycobacterium phage IrishSherpFalk, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgta Protospacer
.*********** *********
255. spacer 5.11|901199|23|CP024190|CRT matches to MF919504 (Mycobacterium phage DmpstrDiver, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgta Protospacer
.*********** *********
256. spacer 5.11|901199|23|CP024190|CRT matches to JF937090 (Mycobacterium virus BAKA, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgta Protospacer
.*********** *********
257. spacer 5.11|901199|23|CP024190|CRT matches to MF133445 (Mycobacterium phage Lucky2013, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgta Protospacer
.*********** *********
258. spacer 5.11|901199|23|CP024190|CRT matches to MF072690 (Mycobacterium phage Porcelain, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgta Protospacer
.*********** *********
259. spacer 5.11|901199|23|CP024190|CRT matches to NC_041844 (Mycobacterium phage Optimus, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgta Protospacer
.*********** *********
260. spacer 5.11|901199|23|CP024190|CRT matches to MK279849 (Mycobacterium phage Duke13, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgta Protospacer
.*********** *********
261. spacer 5.11|901199|23|CP024190|CRT matches to JF937101 (Mycobacterium virus LittleE, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgta Protospacer
.*********** *********
262. spacer 5.11|901199|23|CP024190|CRT matches to KX576644 (Mycobacterium phage WillSterrel, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgta Protospacer
.*********** *********
263. spacer 5.11|901199|23|CP024190|CRT matches to KM400683 (Mycobacterium phage Ariel, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgta Protospacer
.*********** *********
264. spacer 5.11|901199|23|CP024190|CRT matches to NC_013936 (Mycobacterium phage Ardmore, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgta Protospacer
.*********** *********
265. spacer 5.11|901199|23|CP024190|CRT matches to MH727548 (Mycobacterium phage Galactic, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgta Protospacer
.*********** *********
266. spacer 5.11|901199|23|CP024190|CRT matches to MF919534 (Mycobacterium phage Superphikiman, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgta Protospacer
.*********** *********
267. spacer 5.11|901199|23|CP024190|CRT matches to KJ409696 (Mycobacterium phage Lamina13, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgct Protospacer
************ ********..
268. spacer 5.11|901199|23|CP024190|CRT matches to KX610764 (Mycobacterium phage Kersh, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgta Protospacer
.*********** *********
269. spacer 5.11|901199|23|CP024190|CRT matches to NC_023690 (Mycobacterium phage Courthouse, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgta Protospacer
.*********** *********
270. spacer 5.11|901199|23|CP024190|CRT matches to NC_022067 (Mycobacterium phage Wanda, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgta Protospacer
.*********** *********
271. spacer 5.11|901199|23|CP024190|CRT matches to NC_028784 (Mycobacterium phage Tasp14, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ctgccgccgttgccgccgttgct Protospacer
************ ********..
272. spacer 5.11|901199|23|CP024190|CRT matches to NC_028953 (Mycobacterium phage MiaZeal, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgta Protospacer
.*********** *********
273. spacer 5.11|901199|23|CP024190|CRT matches to MF668284 (Mycobacterium phage Squint, complete genome) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
ttgccgccgttgccgccgttgta Protospacer
.*********** *********
274. spacer 5.11|901199|23|CP024190|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.87
ctgccgccgttgacgccgttgtc CRISPR spacer
acgccgccgttgacgccgatgtc Protospacer
.**************** ****
275. spacer 5.13|901337|23|CP024190|CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.87
tcgcctcggatggtgccgccgcc CRISPR spacer
cggccgcggatggtgccgccgcc Protospacer
. *** *****************
276. spacer 5.13|901337|23|CP024190|CRT matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 3, identity: 0.87
tcgcctcggatggtgccgccgcc CRISPR spacer
aagccttggatggtgccgccgcc Protospacer
****.****************
277. spacer 7.11|1614286|24|CP024190|CRT matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 3, identity: 0.875
gcgccaccagcaccggtaaggccg CRISPR spacer
gcgccaccagcaccgggaagggca Protospacer
**************** **** *.
278. spacer 11.6|3846189|23|CP024190|CRT matches to KY798216 (Mycobacterium phage Journey13, complete genome) position: , mismatch: 3, identity: 0.87
gttcgccagcggcggtaccggcg CRISPR spacer
tctcgccaacggcggtaccggcg Protospacer
.******.**************
279. spacer 11.8|3846303|26|CP024190|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 3, identity: 0.885
ggccggcggcgacgcctggctgttcg CRISPR spacer
gcccggcggcgacgcctggcagttcc Protospacer
* ****************** ****
280. spacer 11.8|3846303|26|CP024190|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 3, identity: 0.885
ggccggcggcgacgcctggctgttcg CRISPR spacer
gcccggcggcgacgcctggcagttcc Protospacer
* ****************** ****
281. spacer 11.12|3846507|26|CP024190|CRT matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.885
caatggcggcagcgccgggctggtcg CRISPR spacer
caatggcggcagagccggactggttg Protospacer
************ *****.*****.*
282. spacer 11.12|3846507|26|CP024190|CRT matches to KT630646 (Salmonella phage SEN5, complete genome) position: , mismatch: 3, identity: 0.885
caatggcggcagcgccgggctggtcg CRISPR spacer
caaaggcgacagcgccgggctggttg Protospacer
*** ****.***************.*
283. spacer 11.12|3846507|26|CP024190|CRT matches to KT630645 (Salmonella phage SEN4, complete genome) position: , mismatch: 3, identity: 0.885
caatggcggcagcgccgggctggtcg CRISPR spacer
caaaggcgacagcgccgggctggttg Protospacer
*** ****.***************.*
284. spacer 12.1|4334059|22|CP024190|CRISPRCasFinder matches to MN693941 (Marine virus AFVG_250M763, complete genome) position: , mismatch: 3, identity: 0.864
ccagaagccggtgttcacgtcg CRISPR spacer
gacgaagccggtgttcacgtcg Protospacer
*******************
285. spacer 12.1|4334059|22|CP024190|CRISPRCasFinder matches to MN694248 (Marine virus AFVG_250M764, complete genome) position: , mismatch: 3, identity: 0.864
ccagaagccggtgttcacgtcg CRISPR spacer
gacgaagccggtgttcacgtcg Protospacer
*******************
286. spacer 13.4|4334365|22|CP024190|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 3, identity: 0.864
tccgctgccgaagttcgtgttg CRISPR spacer
ggcgctgccgaagttcgtgttc Protospacer
*******************
287. spacer 13.5|4334410|22|CP024190|CRISPRCasFinder matches to NZ_CP049034 (Fluviibacterium aquatile strain SC52 plasmid pSC52_6, complete sequence) position: , mismatch: 3, identity: 0.864
ggtgttgccaatatttccgaca CRISPR spacer
cgtgttgccaatatttccgaac Protospacer
*******************
288. spacer 14.1|4334590|22|CP024190|CRISPRCasFinder matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.864
gatgttgccgatattgccgctg CRISPR spacer
gatgttgccgatattgccgacc Protospacer
******************* .
289. spacer 14.1|4334590|22|CP024190|CRISPRCasFinder matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.864
gatgttgccgatattgccgctg CRISPR spacer
gatgttgccgatattgccgacc Protospacer
******************* .
290. spacer 16.4|5388658|23|CP024190|CRISPRCasFinder matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 3, identity: 0.87
taacggcgggtctgccgggctgt CRISPR spacer
taacggcgggtctgccgagcttc Protospacer
*****************.*** .
291. spacer 16.4|5388658|23|CP024190|CRISPRCasFinder matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 3, identity: 0.87
taacggcgggtctgccgggctgt CRISPR spacer
taacggcgggtctgccgagcttc Protospacer
*****************.*** .
292. spacer 16.4|5388658|23|CP024190|CRISPRCasFinder matches to NZ_CP046906 (Streptomyces sp. QHH-9511 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.87
taacggcgggtctgccgggctgt CRISPR spacer
tgacggcgggtctgccgggcttc Protospacer
*.******************* .
293. spacer 4.14|846427|24|CP024190|CRISPRCasFinder matches to NZ_CP017427 (Methylobacterium sp. XJLW plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.833
gccaccggtgccggagaacacgcc CRISPR spacer
gccaccggagccggagaacaccag Protospacer
******** ************
294. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.826
gtgttgccgttgccgccgttgcc CRISPR spacer
tagttgccgttgccgccgttgat Protospacer
******************* .
295. spacer 5.2|900695|23|CP024190|CRT matches to NZ_CP049248 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.826
gtgttgccgttgccgccgttgcc CRISPR spacer
agcctgccgttgccgccgttgcc Protospacer
. .*******************
296. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP023550 (Rhodobacter sp. CZR27 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgtcgccgccgtcgctgtc Protospacer
*******************.*.**
297. spacer 5.7|900974|26|CP024190|CRT matches to MN585973 (Mycobacterium phage StAnnes, complete genome) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgctggc Protospacer
**********.**********.**.
298. spacer 5.7|900974|26|CP024190|CRT matches to MG944221 (Mycobacterium phage Scowl, complete genome) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgctggc Protospacer
**********.**********.**.
299. spacer 5.7|900974|26|CP024190|CRT matches to KT309034 (Mycobacterium phage Dante, complete genome) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgctggc Protospacer
**********.**********.**.
300. spacer 5.7|900974|26|CP024190|CRT matches to KC661277 (Mycobacterium phage Phrux, complete genome) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
cgggcgccgtggccgccgttgttgaa Protospacer
. * ****** ***************
301. spacer 5.7|900974|26|CP024190|CRT matches to NC_048850 (Mycobacterium phage Cornie, complete genome) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgctggc Protospacer
**********.**********.**.
302. spacer 5.7|900974|26|CP024190|CRT matches to NC_021538 (Mycobacterium phage Job42, complete genome) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgctggc Protospacer
**********.**********.**.
303. spacer 5.7|900974|26|CP024190|CRT matches to MK376954 (Gordonia phage WhoseManz, complete genome) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtcgtg Protospacer
**********.***********.* .
304. spacer 5.7|900974|26|CP024190|CRT matches to NC_019917 (Burkholderia phage BcepMigl, complete genome) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgtcgtcgccgcccttgttggc Protospacer
******.********** ******.
305. spacer 5.7|900974|26|CP024190|CRT matches to NC_026584 (Mycobacterium phage Minerva, complete genome) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgctggc Protospacer
**********.**********.**.
306. spacer 5.7|900974|26|CP024190|CRT matches to NC_011273 (Mycobacterium phage Myrna, complete genome) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ctgccgccgttgccgccgttgtagac Protospacer
.*********.*********** **
307. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgtctccgcccttgttgct Protospacer
*********** ***** ******
308. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccggcgccgcccttgttgcc Protospacer
********* ******* ******
309. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP018048 (Pseudomonas aeruginosa strain DN1 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
tcgccgccttcgccgccgttggtgac Protospacer
*.****** ************ ***
310. spacer 5.7|900974|26|CP024190|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
311. spacer 5.7|900974|26|CP024190|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
312. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
313. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
314. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP026682 (Nostoc sp. 'Peltigera membranacea cyanobiont' N6 plasmid pNPM1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
gtgccgccgccgccgccgttcttgga Protospacer
********.********** ***.*
315. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
316. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
317. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
318. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
319. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
320. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
321. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
322. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
323. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
324. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
325. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
326. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
327. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
328. spacer 5.7|900974|26|CP024190|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
329. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
330. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
331. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
332. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
333. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
334. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
335. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
336. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
337. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
338. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
339. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
340. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
341. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
342. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
343. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
344. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
345. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
346. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
347. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
348. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
349. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
350. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
351. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
352. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
353. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
354. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
355. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
356. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
357. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
358. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
359. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
360. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
361. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
362. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
363. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
364. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
365. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
366. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
367. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
368. spacer 5.7|900974|26|CP024190|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
369. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
370. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
371. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
372. spacer 5.7|900974|26|CP024190|CRT matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccggcgccgccgttgcccaa Protospacer
********* ***********.. **
373. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
374. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
375. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
376. spacer 5.7|900974|26|CP024190|CRT matches to NZ_AP015030 (Pseudomonas putida strain KF715 plasmid pKF715A, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
tcgccgccttcgccgccgttggtgac Protospacer
*.****** ************ ***
377. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
378. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
379. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
380. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
381. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
382. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
383. spacer 5.7|900974|26|CP024190|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
384. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
385. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
386. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
387. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
388. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
389. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP010702 (Phaeobacter inhibens strain P24 plasmid pP24_f, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
tcgccgccttcgccgccgttgatgac Protospacer
*.****** ************ ***
390. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
391. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
392. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
393. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
394. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttctcgccgttgccgccgttgttgac Protospacer
** .******.**************
395. spacer 5.10|901142|26|CP024190|CRT matches to NC_016000 (Sphingobium chungbukense strain DJ77 plasmid pSY2, complete sequence) position: , mismatch: 4, identity: 0.846
aagccggtggccaaggtgccgttgcc CRISPR spacer
gagccgctgggcaaggtgccgttgtc Protospacer
.***** *** *************.*
396. spacer 5.13|901337|23|CP024190|CRT matches to NC_008243 (Chelativorans sp. BNC1 plasmid 2, complete sequence) position: , mismatch: 4, identity: 0.826
tcgcctcggatggtgccgccgcc CRISPR spacer
gggcctcggatggtgccgccgga Protospacer
*******************
397. spacer 8.9|1615629|27|CP024190|CRT matches to NZ_CP046571 (Xanthomonas albilineans strain Xa-FJ1 plasmid pXaFJ1, complete sequence) position: , mismatch: 4, identity: 0.852
gccgccggtgaagccgaacaagccggg CRISPR spacer
gccgccggtgaggccgaacaagcccac Protospacer
***********.************ .
398. spacer 8.9|1615629|27|CP024190|CRT matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 4, identity: 0.852
gccgccggtgaagccgaacaagccggg CRISPR spacer
gccgctggtgaagccgaccaagccgcc Protospacer
*****.*********** *******
399. spacer 11.6|3846189|23|CP024190|CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 4, identity: 0.826
gttcgccagcggcggtaccggcg CRISPR spacer
tggcgccagcggcggtaccggcc Protospacer
*******************
400. spacer 11.8|3846303|26|CP024190|CRT matches to NZ_CP044141 (Escherichia coli O157 strain AR-0430 plasmid pAR-0430-4) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
401. spacer 11.8|3846303|26|CP024190|CRT matches to AP012531 (Stx2-converting phage Stx2a_F422 proviral DNA, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
402. spacer 11.8|3846303|26|CP024190|CRT matches to KP682385 (Escherichia phage PA33, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
403. spacer 11.8|3846303|26|CP024190|CRT matches to KP682382 (Escherichia phage PA29, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
404. spacer 11.8|3846303|26|CP024190|CRT matches to KP682389 (Escherichia phage PA45, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
405. spacer 11.8|3846303|26|CP024190|CRT matches to KP682383 (Escherichia phage PA30, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
406. spacer 11.8|3846303|26|CP024190|CRT matches to NC_004914 (Stx2 converting phage II DNA, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
407. spacer 11.8|3846303|26|CP024190|CRT matches to KP682375 (Escherichia phage PA11, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
408. spacer 11.8|3846303|26|CP024190|CRT matches to KP682387 (Escherichia phage PA42, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
409. spacer 11.8|3846303|26|CP024190|CRT matches to KJ909655 (Escherichia Stx1-converting recombinant phage HUN/2013, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
410. spacer 11.8|3846303|26|CP024190|CRT matches to KU238068 (Stx converting phage vB_EcoS_P32, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
411. spacer 11.8|3846303|26|CP024190|CRT matches to KP682384 (Escherichia phage PA32, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
412. spacer 11.8|3846303|26|CP024190|CRT matches to KP682386 (Escherichia phage PA36, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
413. spacer 11.8|3846303|26|CP024190|CRT matches to KP682376 (Escherichia phage PA12, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
414. spacer 11.8|3846303|26|CP024190|CRT matches to AP000422 (Enterobacteria phage VT2-Sakai genomic DNA, prophage inserted region in Escherichia coli O157:H7) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
415. spacer 11.8|3846303|26|CP024190|CRT matches to KP682391 (Escherichia phage PA51, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
416. spacer 11.8|3846303|26|CP024190|CRT matches to KP682388 (Escherichia phage PA44, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
417. spacer 11.8|3846303|26|CP024190|CRT matches to KP682372 (Escherichia phage PA4, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
418. spacer 11.8|3846303|26|CP024190|CRT matches to KP682377 (Escherichia phage PA16, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
419. spacer 11.8|3846303|26|CP024190|CRT matches to NC_000902 (Enterobacteria phage VT2-Sakai, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
420. spacer 11.8|3846303|26|CP024190|CRT matches to AP000363 (Enterobacteria phage VT2-Sakai proviral DNA, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
421. spacer 11.8|3846303|26|CP024190|CRT matches to KP682380 (Escherichia phage PA27, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
422. spacer 11.8|3846303|26|CP024190|CRT matches to AP005153 (Stx1 converting phage DNA, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
423. spacer 11.8|3846303|26|CP024190|CRT matches to KP682379 (Escherichia phage PA21, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
424. spacer 11.8|3846303|26|CP024190|CRT matches to KP682373 (Escherichia phage PA5, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
425. spacer 11.8|3846303|26|CP024190|CRT matches to KP682378 (Escherichia phage PA18, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
426. spacer 11.8|3846303|26|CP024190|CRT matches to KU238069 (Stx converting phage vB_EcoS_P22, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
427. spacer 11.8|3846303|26|CP024190|CRT matches to KP682390 (Escherichia phage PA50, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
428. spacer 11.8|3846303|26|CP024190|CRT matches to KP682392 (Escherichia phage PA52, complete genome) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgcctggctgttcg Protospacer
*.. .*********************
429. spacer 11.8|3846303|26|CP024190|CRT matches to NZ_CP025505 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvC, complete sequence) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
tggcggcggcgatgcctggccgttcg Protospacer
* *********.*******.*****
430. spacer 11.8|3846303|26|CP024190|CRT matches to NZ_CP029834 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
cggcggcggcggcgcctcgctgttcg Protospacer
* ********.***** ********
431. spacer 11.8|3846303|26|CP024190|CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
cggcggcggcggcgcctcgctgttcg Protospacer
* ********.***** ********
432. spacer 11.8|3846303|26|CP024190|CRT matches to NC_009621 (Sinorhizobium medicae WSM419 plasmid pSMED02, complete sequence) position: , mismatch: 4, identity: 0.846
ggccggcggcgacgcctggctgttcg CRISPR spacer
gcccggcggcgacgcatggcagttcc Protospacer
* ************* **** ****
433. spacer 11.12|3846507|26|CP024190|CRT matches to NZ_CP022659 (Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-1, complete sequence) position: , mismatch: 4, identity: 0.846
caatggcggcagcgccgggctggtcg CRISPR spacer
taaaggcgacagcgccgggctggttg Protospacer
.** ****.***************.*
434. spacer 11.12|3846507|26|CP024190|CRT matches to NZ_CP022659 (Salmonella enterica subsp. enterica strain RM11060 plasmid pRM11060-1, complete sequence) position: , mismatch: 4, identity: 0.846
caatggcggcagcgccgggctggtcg CRISPR spacer
taaaggcgacagcgccgggctggttg Protospacer
.** ****.***************.*
435. spacer 11.12|3846507|26|CP024190|CRT matches to NC_015169 (Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence) position: , mismatch: 4, identity: 0.846
caatggcggcagcgccgggctggtcg CRISPR spacer
cattggcggcagcgccgggcttgagg Protospacer
** ****************** * *
436. spacer 11.12|3846507|26|CP024190|CRT matches to NZ_CP014276 (Martelella sp. AD-3 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846
caatggcggcagcgccgggctggtcg CRISPR spacer
ccatggcggcagcgccgtgctcgtca Protospacer
* *************** *** ***.
437. spacer 15.16|5224588|24|CP024190|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 4, identity: 0.833
tgcgggtggcgtgttcttcggaaa CRISPR spacer
ggcgggtggcgtgttcgtcggatc Protospacer
*************** *****
438. spacer 15.16|5224588|24|CP024190|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 4, identity: 0.833
tgcgggtggcgtgttcttcggaaa CRISPR spacer
ggcgggtggcgtgttcgtcggatc Protospacer
*************** *****
439. spacer 16.2|5388541|29|CP024190|CRISPRCasFinder matches to NZ_CP040937 (Hymenobacter sp. DG01 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.862
acccgcc-aagcccagcagcagccaggcca CRISPR spacer
-cccgctgaagcccagcagcagcaaggccc Protospacer
*****. *************** *****
440. spacer 3.1|791267|27|CP024190|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 5, identity: 0.815
gtggagcgatcgcgagcgcggcggagc CRISPR spacer
ctggagcgatcgcgaccgcggctggga Protospacer
************** ****** *.*
441. spacer 3.1|791267|27|CP024190|CRISPRCasFinder matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 5, identity: 0.815
gtggagcgatcgcgagcgcggcggagc CRISPR spacer
ctggagcgatcgcgagcgtggctggga Protospacer
*****************.*** *.*
442. spacer 3.1|791267|27|CP024190|CRISPRCasFinder matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 5, identity: 0.815
gtggagcgatcgcgagcgcggcggagc CRISPR spacer
ctggagcgatcgcgagcgtggctggga Protospacer
*****************.*** *.*
443. spacer 3.1|791267|27|CP024190|CRISPRCasFinder matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 5, identity: 0.815
gtggagcgatcgcgagcgcggcggagc CRISPR spacer
ctggagcgatcgcgagcgtggctggga Protospacer
*****************.*** *.*
444. spacer 3.1|791267|27|CP024190|CRISPRCasFinder matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 5, identity: 0.815
gtggagcgatcgcgagcgcggcggagc CRISPR spacer
ctggagcgatcgcgagcgtggctggga Protospacer
*****************.*** *.*
445. spacer 3.1|791267|27|CP024190|CRISPRCasFinder matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 5, identity: 0.815
gtggagcgatcgcgagcgcggcggagc CRISPR spacer
ctggagcgatcgcgagcgtggctggga Protospacer
*****************.*** *.*
446. spacer 3.1|791267|27|CP024190|CRISPRCasFinder matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 5, identity: 0.815
gtggagcgatcgcgagcgcggcggagc CRISPR spacer
ctggagcgatcgcgagcgtggctggga Protospacer
*****************.*** *.*
447. spacer 3.1|791267|27|CP024190|CRISPRCasFinder matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 5, identity: 0.815
gtggagcgatcgcgagcgcggcggagc CRISPR spacer
gtggagctatcgcgagcgtggcgtcgg Protospacer
******* **********.**** *
448. spacer 3.1|791267|27|CP024190|CRISPRCasFinder matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 5, identity: 0.815
gtggagcgatcgcgagcgcggcggagc CRISPR spacer
ctggagcgatcgcgagcgtggctggga Protospacer
*****************.*** *.*
449. spacer 3.1|791267|27|CP024190|CRISPRCasFinder matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 5, identity: 0.815
gtggagcgatcgcgagcgcggcggagc CRISPR spacer
ctggagcgatcgcgagcgtggctggga Protospacer
*****************.*** *.*
450. spacer 4.14|846427|24|CP024190|CRISPRCasFinder matches to NZ_CP042265 (Litoreibacter sp. LN3S51 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.792
gccaccggtgccggagaacacgcc CRISPR spacer
cgcaccggtgccggagaacaccag Protospacer
*******************
451. spacer 5.5|900863|26|CP024190|CRT matches to NC_014635 (Aeromonas phage phiAS4, complete genome) position: , mismatch: 5, identity: 0.808
tcgcgattcgtgaagaagccgttaac CRISPR spacer
ccaaaattcgtgaagaagccgtaaac Protospacer
.*. .***************** ***
452. spacer 5.5|900863|26|CP024190|CRT matches to MH179476 (Aeromonas phage 50AhydR13PP, complete genome) position: , mismatch: 5, identity: 0.808
tcgcgattcgtgaagaagccgttaac CRISPR spacer
ccaaaattcgtgaagaagccgtaaac Protospacer
.*. .***************** ***
453. spacer 5.5|900863|26|CP024190|CRT matches to NC_020879 (Aeromonas phage Aes012, complete genome) position: , mismatch: 5, identity: 0.808
tcgcgattcgtgaagaagccgttaac CRISPR spacer
ccaaaattcgtgaagaagccgtaaac Protospacer
.*. .***************** ***
454. spacer 5.5|900863|26|CP024190|CRT matches to NC_008208 (Aeromonas phage 25, complete genome) position: , mismatch: 5, identity: 0.808
tcgcgattcgtgaagaagccgttaac CRISPR spacer
ccaaaattcgtgaagaagccgtaaac Protospacer
.*. .***************** ***
455. spacer 5.5|900863|26|CP024190|CRT matches to DQ529280 (Aeromonas salmonicida bacteriophage 25, complete genome) position: , mismatch: 5, identity: 0.808
tcgcgattcgtgaagaagccgttaac CRISPR spacer
ccaaaattcgtgaagaagccgtaaac Protospacer
.*. .***************** ***
456. spacer 5.5|900863|26|CP024190|CRT matches to MF479730 (Aeromonas phage AS-gz, complete genome) position: , mismatch: 5, identity: 0.808
tcgcgattcgtgaagaagccgttaac CRISPR spacer
ccaaaattcgtgaagaagccgtaaac Protospacer
.*. .***************** ***
457. spacer 5.7|900974|26|CP024190|CRT matches to JX042579 (Mycobacterium virus MacnCheese, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
gccccgccgtcgccgccgttgttggc Protospacer
. *********************.
458. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
gtgccgccgacgccgccgttcttgtt Protospacer
******** ********** ***
459. spacer 5.7|900974|26|CP024190|CRT matches to MH020235 (Mycobacterium phage Batiatus, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtatgt Protospacer
**********.*********** .
460. spacer 5.7|900974|26|CP024190|CRT matches to MN586029 (Mycobacterium phage Hannaconda, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtatgt Protospacer
**********.*********** .
461. spacer 5.7|900974|26|CP024190|CRT matches to KM597530 (Mycobacterium phage Bipolar, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtatgt Protospacer
**********.*********** .
462. spacer 5.7|900974|26|CP024190|CRT matches to MH590598 (Mycobacterium phage Krakatau, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtatgt Protospacer
**********.*********** .
463. spacer 5.7|900974|26|CP024190|CRT matches to MK016496 (Mycobacterium phage IrishSherpFalk, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtatgt Protospacer
**********.*********** .
464. spacer 5.7|900974|26|CP024190|CRT matches to MF919504 (Mycobacterium phage DmpstrDiver, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtatgt Protospacer
**********.*********** .
465. spacer 5.7|900974|26|CP024190|CRT matches to JF937090 (Mycobacterium virus BAKA, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtatgt Protospacer
**********.*********** .
466. spacer 5.7|900974|26|CP024190|CRT matches to MF133445 (Mycobacterium phage Lucky2013, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtatgt Protospacer
**********.*********** .
467. spacer 5.7|900974|26|CP024190|CRT matches to MF072690 (Mycobacterium phage Porcelain, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtatgt Protospacer
**********.*********** .
468. spacer 5.7|900974|26|CP024190|CRT matches to NC_041844 (Mycobacterium phage Optimus, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtatgt Protospacer
**********.*********** .
469. spacer 5.7|900974|26|CP024190|CRT matches to MK279849 (Mycobacterium phage Duke13, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtatgt Protospacer
**********.*********** .
470. spacer 5.7|900974|26|CP024190|CRT matches to JF937101 (Mycobacterium virus LittleE, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtatgt Protospacer
**********.*********** .
471. spacer 5.7|900974|26|CP024190|CRT matches to KX576644 (Mycobacterium phage WillSterrel, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtatgt Protospacer
**********.*********** .
472. spacer 5.7|900974|26|CP024190|CRT matches to KM400683 (Mycobacterium phage Ariel, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtatgt Protospacer
**********.*********** .
473. spacer 5.7|900974|26|CP024190|CRT matches to NC_013936 (Mycobacterium phage Ardmore, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtatgt Protospacer
**********.*********** .
474. spacer 5.7|900974|26|CP024190|CRT matches to MH727548 (Mycobacterium phage Galactic, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtatgt Protospacer
**********.*********** .
475. spacer 5.7|900974|26|CP024190|CRT matches to MF919534 (Mycobacterium phage Superphikiman, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtatgt Protospacer
**********.*********** .
476. spacer 5.7|900974|26|CP024190|CRT matches to KX610764 (Mycobacterium phage Kersh, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtatgt Protospacer
**********.*********** .
477. spacer 5.7|900974|26|CP024190|CRT matches to NC_023690 (Mycobacterium phage Courthouse, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtatgt Protospacer
**********.*********** .
478. spacer 5.7|900974|26|CP024190|CRT matches to NC_022067 (Mycobacterium phage Wanda, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtatgt Protospacer
**********.*********** .
479. spacer 5.7|900974|26|CP024190|CRT matches to NC_028953 (Mycobacterium phage MiaZeal, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtatgt Protospacer
**********.*********** .
480. spacer 5.7|900974|26|CP024190|CRT matches to MF668284 (Mycobacterium phage Squint, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgtatgt Protospacer
**********.*********** .
481. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP026745 (Nocardia cyriacigeorgica strain MDA3349 isolate MDA3349 ancestor plasmid p_unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
gcgccgccgtcgccgccgttgatgcc Protospacer
.******************* **
482. spacer 5.7|900974|26|CP024190|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgccgcc Protospacer
**********.**********..*
483. spacer 5.7|900974|26|CP024190|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgccgcc Protospacer
**********.**********..*
484. spacer 5.7|900974|26|CP024190|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgtcgcctccgttgccgcc Protospacer
************** ******..*
485. spacer 5.7|900974|26|CP024190|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgccgcc Protospacer
**********.**********..*
486. spacer 5.7|900974|26|CP024190|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgtcgcctccgttgcctac Protospacer
************** ******.. *
487. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgtcgccgccgtcgccgcc Protospacer
*******************.*..*
488. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP021405 (Celeribacter manganoxidans strain DY25 plasmid pDY25-A, complete sequence) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ccgccgccgtcgccgccgtcgtcgat Protospacer
..*****************.**.**
489. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP019063 (Rahnella sp. ERMR1:05 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ctgtcgccgtcgccgccggtgttgct Protospacer
.**.************** *****
490. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
tcgccgccgtcgccgccgttgacgtc Protospacer
*.******************* .*
491. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ctgcccccgtcgccgccattgttgcg Protospacer
.**** ***********.****** .
492. spacer 5.7|900974|26|CP024190|CRT matches to NC_019307 (Streptomyces sp. W75 plasmid pCQ4, complete sequence) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
atgcggccctcgccgccgttgttgtt Protospacer
*** *** ***************
493. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP009572 (Sphingomonas taxi strain ATCC 55669 plasmid STP1, complete sequence) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
aagccgccgtcgctgacgttgttgat Protospacer
***********.* *********
494. spacer 5.7|900974|26|CP024190|CRT matches to NC_018452 (Burkholderia phage DC1, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgtcgtcgccgcccttgttcgc Protospacer
******.********** ***** .
495. spacer 5.7|900974|26|CP024190|CRT matches to FJ937737 (Burkholderia cenocepacia phage BcepIL02, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgtcgtcgccgcccttgttcgc Protospacer
******.********** ***** .
496. spacer 5.7|900974|26|CP024190|CRT matches to KY555144 (Caulobacter phage Ccr5, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ccgccgccgttgccgccgttgtagag Protospacer
..********.*********** **.
497. spacer 5.7|900974|26|CP024190|CRT matches to KJ409696 (Mycobacterium phage Lamina13, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ctgccgccgttgccgccgttgctggc Protospacer
.*********.**********.**.
498. spacer 5.7|900974|26|CP024190|CRT matches to NC_012743 (Burkholderia phage BcepIL02, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgtcgtcgccgcccttgttcgc Protospacer
******.********** ***** .
499. spacer 5.7|900974|26|CP024190|CRT matches to JN699018 (Mycobacterium phage Kamiyu, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgtcgccgcccttgcccca Protospacer
***************** ***.. *
500. spacer 5.7|900974|26|CP024190|CRT matches to NC_028784 (Mycobacterium phage Tasp14, complete genome) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ctgccgccgttgccgccgttgctggc Protospacer
.*********.**********.**.
501. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ccgcggccgtcgccgcccttgttgag Protospacer
..** ************ *******.
502. spacer 5.7|900974|26|CP024190|CRT matches to NZ_LR134454 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
gcgccgcgggcgccgccgttgttgac Protospacer
.***** * ***************
503. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
gtgccgccgacgccgacgttgttgcc Protospacer
******** ***** ********
504. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
gtgccgccggcgccgcccttgttggt Protospacer
******** ******* ******.
505. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP008954 (Amycolatopsis japonica strain DSM 44213 plasmid pAmyja1, complete sequence) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
gagccgccgtcgacgccgttgtagat Protospacer
********** ********* **
506. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ccgcggccgtcgccgcccttgttgag Protospacer
..** ************ *******.
507. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ccgcggccgtcgccgcccttgttgag Protospacer
..** ************ *******.
508. spacer 5.7|900974|26|CP024190|CRT matches to NC_007949 (Polaromonas sp. JS666 plasmid 1, complete sequence) position: , mismatch: 5, identity: 0.808
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgacgccgtcgccgccgttggccac Protospacer
*** ***************** . *
509. spacer 5.10|901142|26|CP024190|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 5, identity: 0.808
aagccggtggccaaggtgccgttgcc CRISPR spacer
gttccggtggccgaggtgccgttgca Protospacer
. *********.************
510. spacer 5.10|901142|26|CP024190|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.808
aagccggtggccaaggtgccgttgcc CRISPR spacer
gttccggtggccgaggtgccgttgca Protospacer
. *********.************
511. spacer 8.9|1615629|27|CP024190|CRT matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.815
gccgccggtgaagccgaacaagccggg CRISPR spacer
taccccggtgaagccgaagaagccggc Protospacer
* ************** *******
512. spacer 8.9|1615629|27|CP024190|CRT matches to KX879752 (Halomonas phage QHHSV-1, complete genome) position: , mismatch: 5, identity: 0.815
gccgccggtgaagccgaacaagccggg CRISPR spacer
gccgccggtgaagccggccaagcgtga Protospacer
****************. ***** *.
513. spacer 11.8|3846303|26|CP024190|CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
acaaggcggcgacgcctgcctgttcg Protospacer
. ************** *******
514. spacer 11.8|3846303|26|CP024190|CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
cggaggcggcgacgcccggctgttcc Protospacer
* ************.********
515. spacer 11.8|3846303|26|CP024190|CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
ccacgccggcgaggcctggctgttcg Protospacer
** ****** *************
516. spacer 11.8|3846303|26|CP024190|CRT matches to NC_021910 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetNIM1c, complete sequence) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
ggccggcgatgacgcctggctgtcga Protospacer
********..*************. .
517. spacer 11.8|3846303|26|CP024190|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
cttcggcggcgacgactggctgatcg Protospacer
.*********** ******* ***
518. spacer 11.8|3846303|26|CP024190|CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
cttcggcggcgacgactggctgatcg Protospacer
.*********** ******* ***
519. spacer 11.8|3846303|26|CP024190|CRT matches to NZ_CP010865 (Marinovum algicola DG 898 plasmid pMaD10, complete sequence) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
ctacggcgacggcgcctggctgttcg Protospacer
*****.**.**************
520. spacer 11.8|3846303|26|CP024190|CRT matches to NZ_CP033227 (Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
ggtcggcggcgacgcctggctaatgt Protospacer
**.******************. *
521. spacer 11.8|3846303|26|CP024190|CRT matches to NZ_CP041018 (Sphingobium fuliginis ATCC 27551 plasmid pSF1, complete sequence) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
ggtcggcggcgacgcctggctaatgt Protospacer
**.******************. *
522. spacer 11.8|3846303|26|CP024190|CRT matches to NZ_CP018080 (Sulfitobacter sp. AM1-D1 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
ggcgggcggcgacgcctgggtgtaga Protospacer
*** *************** *** .
523. spacer 11.8|3846303|26|CP024190|CRT matches to NZ_CP014802 (Salipiger profundus strain JLT2016 plasmid pTPRO6, complete sequence) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
caacggcggcaacgactggctgttcg Protospacer
. *******.*** ***********
524. spacer 11.8|3846303|26|CP024190|CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
cttcggcggcgacgactggctgatcg Protospacer
.*********** ******* ***
525. spacer 11.8|3846303|26|CP024190|CRT matches to KU935731 (Mycobacterium phage Phrann, complete genome) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
ctgcgacggcgacgcctggctgatcg Protospacer
**.**************** ***
526. spacer 11.8|3846303|26|CP024190|CRT matches to MK524522 (Mycobacterium phage Purgamenstris, complete genome) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
ctgcgacggcgacgcctggctgatcg Protospacer
**.**************** ***
527. spacer 11.8|3846303|26|CP024190|CRT matches to MT684588 (Mycobacterium phage Snekmaggedon, complete genome) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
ctgcgacggcgacgcctggctgatcg Protospacer
**.**************** ***
528. spacer 11.8|3846303|26|CP024190|CRT matches to MT498042 (Mycobacterium phage Rebel, complete genome) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
ctgcgacggcgacgcctggctgatcg Protospacer
**.**************** ***
529. spacer 11.8|3846303|26|CP024190|CRT matches to MT498044 (Mycobacterium phage Jamie19, complete genome) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
ctgcgacggcgacgcctggctgatcg Protospacer
**.**************** ***
530. spacer 11.8|3846303|26|CP024190|CRT matches to KX756439 (Mycobacterium phage PhancyPhin, complete genome) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
ctgcgacggcgacgcctggctgatcg Protospacer
**.**************** ***
531. spacer 11.8|3846303|26|CP024190|CRT matches to MK392367 (Mycobacterium phage BabeRuth, complete genome) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
ctgcgacggcgacgcctggctgatcg Protospacer
**.**************** ***
532. spacer 11.8|3846303|26|CP024190|CRT matches to KJ603229 (Shigella phage POCJ13, complete genome) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgccaggctgttcg Protospacer
*.. .*********** *********
533. spacer 11.8|3846303|26|CP024190|CRT matches to MK524520 (Mycobacterium phage Nenae, complete genome) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
ctgcgacggcgacgcctggctgatcg Protospacer
**.**************** ***
534. spacer 11.8|3846303|26|CP024190|CRT matches to NC_029120 (Shigella phage 75/02 Stx, complete genome) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
gatgagcggcgacgccaggctgttcg Protospacer
*.. .*********** *********
535. spacer 11.8|3846303|26|CP024190|CRT matches to JN624851 (Mycobacterium phage Redi, complete genome) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
ctgcgacggcgacgcctggctgatcg Protospacer
**.**************** ***
536. spacer 11.8|3846303|26|CP024190|CRT matches to KU935727 (Mycobacterium phage Panchino, complete genome) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
ctgcgacggcgacgcctggctgatcg Protospacer
**.**************** ***
537. spacer 11.8|3846303|26|CP024190|CRT matches to KU935729 (Mycobacterium phage SkinnyPete, complete genome) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
ctgcgacggcgacgcctggctgatcg Protospacer
**.**************** ***
538. spacer 11.8|3846303|26|CP024190|CRT matches to MK524509 (Mycobacterium phage SpongeBob, complete genome) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
ctgcgacggcgacgcctggctgatcg Protospacer
**.**************** ***
539. spacer 11.8|3846303|26|CP024190|CRT matches to MK524528 (Mycobacterium phage ShrimpFriedEgg, complete genome) position: , mismatch: 5, identity: 0.808
ggccggcggcgacgcctggctgttcg CRISPR spacer
ctgcgacggcgacgcctggctgatcg Protospacer
**.**************** ***
540. spacer 11.9|3846348|32|CP024190|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
--cagcggcggggccggcgccatcaacgacggcg CRISPR spacer
gtccacggcggg--cggcgccatcaacaacggcg Protospacer
* .******* *************.******
541. spacer 11.9|3846348|32|CP024190|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844
--cagcggcggggccggcgccatcaacgacggcg CRISPR spacer
gtccacggcggg--cggcgccatcaacaacggcg Protospacer
* .******* *************.******
542. spacer 11.9|3846348|32|CP024190|CRT matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 5, identity: 0.844
--cagcggcggggccggcgccatcaacgacggcg CRISPR spacer
gtccacggcggg--cggcgccatcaacaacggcg Protospacer
* .******* *************.******
543. spacer 11.12|3846507|26|CP024190|CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 5, identity: 0.808
caatggcggcagcgccgggctggtcg CRISPR spacer
ggttggcggcaccgccgggctgctcg Protospacer
. ******** ********** ***
544. spacer 11.12|3846507|26|CP024190|CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 5, identity: 0.808
caatggcggcagcgccgggctggtcg CRISPR spacer
cggcggcggcagcgacgggctggtcc Protospacer
*...********** **********
545. spacer 11.12|3846507|26|CP024190|CRT matches to NZ_CP019878 (Komagataeibacter nataicola strain RZS01 plasmid pKNA03, complete sequence) position: , mismatch: 5, identity: 0.808
caatggcggcagcgccgggctggtcg CRISPR spacer
acatggcggcagcgccgggctttccg Protospacer
******************* .**
546. spacer 11.12|3846507|26|CP024190|CRT matches to NZ_CP021469 (Komagataeibacter europaeus strain SRCM101446 plasmid pKE1446-2, complete sequence) position: , mismatch: 5, identity: 0.808
caatggcggcagcgccgggctggtcg CRISPR spacer
acatggcggcagcgccgggctttccg Protospacer
******************* .**
547. spacer 11.12|3846507|26|CP024190|CRT matches to NZ_CP018236 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed8) position: , mismatch: 5, identity: 0.808
caatggcggcagcgccgggctggtcg CRISPR spacer
gggtggcggcagctccgggcaggtcg Protospacer
..********** ****** *****
548. spacer 11.12|3846507|26|CP024190|CRT matches to NZ_CP004364 (Komagataeibacter xylinus E25 plasmid pGX4, complete sequence) position: , mismatch: 5, identity: 0.808
caatggcggcagcgccgggctggtcg CRISPR spacer
acatggcggcagcgccgggctttccg Protospacer
******************* .**
549. spacer 11.12|3846507|26|CP024190|CRT matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 5, identity: 0.808
caatggcggcagcgccgggctggtcg CRISPR spacer
gcgtggcggcatcgccgggctgatcg Protospacer
.******** **********.***
550. spacer 16.2|5388541|29|CP024190|CRISPRCasFinder matches to NZ_CP053906 (Hymenobacter sp. BRD67 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.828
acccgccaagcccagcagcagccaggcca CRISPR spacer
ccccgcgaagcccagcagcagcaaggcgc Protospacer
***** *************** ****
551. spacer 3.1|791267|27|CP024190|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.778
gtggagcgatcgcgagcgcggcggagc CRISPR spacer
tgagcgcgatcgcgagcgcggcggcgg Protospacer
.* ******************* *
552. spacer 5.7|900974|26|CP024190|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.769
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttgcctcc Protospacer
**********.**********..
553. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.769
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
actgagccgtcgccgccggtgttgaa Protospacer
. ************* *******
554. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.769
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
actgagccgtcgccgccggtgttgaa Protospacer
. ************* *******
555. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP007515 (Rubrobacter radiotolerans strain RSPS-4 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.769
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
cgcccgccgtcgccgccgtcgttgtg Protospacer
. ****************.**** .
556. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.769
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
actgagccgtcgccgccggtgttgaa Protospacer
. ************* *******
557. spacer 5.7|900974|26|CP024190|CRT matches to MT897910 (Mycobacterium phage VioletZ, complete genome) position: , mismatch: 6, identity: 0.769
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttggacgc Protospacer
**********.********** .
558. spacer 5.7|900974|26|CP024190|CRT matches to MN369759 (Mycobacterium phage Mithril, complete genome) position: , mismatch: 6, identity: 0.769
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttggacgc Protospacer
**********.********** .
559. spacer 5.7|900974|26|CP024190|CRT matches to MH513970 (Mycobacterium phage Hangman, complete genome) position: , mismatch: 6, identity: 0.769
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttggatgc Protospacer
**********.********** .
560. spacer 5.7|900974|26|CP024190|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 6, identity: 0.769
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttggacgc Protospacer
**********.********** .
561. spacer 5.7|900974|26|CP024190|CRT matches to MT639648 (Mycobacterium phage Heath, complete genome) position: , mismatch: 6, identity: 0.769
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttggacgc Protospacer
**********.********** .
562. spacer 5.7|900974|26|CP024190|CRT matches to NC_042035 (Mycobacterium phage Zemanar, complete sequence) position: , mismatch: 6, identity: 0.769
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttggacgc Protospacer
**********.********** .
563. spacer 5.7|900974|26|CP024190|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 6, identity: 0.769
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttggatgc Protospacer
**********.********** .
564. spacer 5.7|900974|26|CP024190|CRT matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 6, identity: 0.769
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttggacgc Protospacer
**********.********** .
565. spacer 5.7|900974|26|CP024190|CRT matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 6, identity: 0.769
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttggacgc Protospacer
**********.********** .
566. spacer 5.7|900974|26|CP024190|CRT matches to KF493881 (Mycobacterium phage JAMaL, complete genome) position: , mismatch: 6, identity: 0.769
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttggatgc Protospacer
**********.********** .
567. spacer 5.7|900974|26|CP024190|CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 6, identity: 0.769
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
ttgccgccgttgccgccgttggacgc Protospacer
**********.********** .
568. spacer 5.7|900974|26|CP024190|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.769
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
actgagccgtcgccgccggtgttgaa Protospacer
. ************* *******
569. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.769
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
actgagccgtcgccgccggtgttgaa Protospacer
. ************* *******
570. spacer 5.9|901085|26|CP024190|CRT matches to NZ_CP026426 (Acinetobacter sp. ACNIH1 plasmid pACI-df08, complete sequence) position: , mismatch: 6, identity: 0.769
gcgatatttgacccgttgccgtgccc CRISPR spacer
taaatattttacccgttgccgtgcat Protospacer
.****** ************** .
571. spacer 5.10|901142|26|CP024190|CRT matches to NZ_CP010421 (Azotobacter chroococcum NCIMB 8003 plasmid pAcX50f, complete sequence) position: , mismatch: 6, identity: 0.769
aagccggtggccaaggtgccgttgcc CRISPR spacer
tcgccggtggccaaggtgccgggcca Protospacer
******************* *
572. spacer 5.10|901142|26|CP024190|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 6, identity: 0.769
aagccggtggccaaggtgccgttgcc CRISPR spacer
aagccggtgcccaaggtgccgcccgg Protospacer
********* ***********..
573. spacer 5.10|901142|26|CP024190|CRT matches to NZ_AP022611 (Mycolicibacterium madagascariense strain JCM 13574 plasmid pJCM13574) position: , mismatch: 6, identity: 0.769
aagccggtggccaaggtgccgttgcc CRISPR spacer
aagccggtgcccaaggtgccgcccgg Protospacer
********* ***********..
574. spacer 11.3|3845985|29|CP024190|CRT matches to NZ_CP015221 (Rhodococcus sp. PBTS 2 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.793
caacgccgtcgggaactctggggtcggtg CRISPR spacer
gaatcgcgtcgagaactccggggtcggtg Protospacer
**. *****.******.**********
575. spacer 11.8|3846303|26|CP024190|CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 6, identity: 0.769
ggccggcggcgacgcctggctgttcg CRISPR spacer
ctacggcggcgacgcctggctgctga Protospacer
*******************.* .
576. spacer 11.12|3846507|26|CP024190|CRT matches to MK059749 (Mycobacterium phage CRB2, complete genome) position: , mismatch: 6, identity: 0.769
caatggcggcagcgccgggctggtcg CRISPR spacer
tcggcgcggcagcgccgggctggttg Protospacer
. . *******************.*
577. spacer 15.18|5224675|30|CP024190|CRISPRCasFinder matches to NZ_CP049813 (Monaibacterium sp. ALG8 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8
tgcggccggcaacggggtactgatcggcaa CRISPR spacer
tctgtccggcaccggggttctgatcggcga Protospacer
* .* ****** ****** *********.*
578. spacer 16.2|5388541|29|CP024190|CRISPRCasFinder matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 6, identity: 0.793
acccgccaagcccagcagcagccaggcca CRISPR spacer
ctgcgccaggcccagcagcagcccggccg Protospacer
. *****.************** ****.
579. spacer 16.2|5388541|29|CP024190|CRISPRCasFinder matches to NZ_CP049906 (Diaphorobacter sp. HDW4B plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.793
acccgccaagcccagcagcagccaggcca CRISPR spacer
acccgccatgcccagcagcagcacacccg Protospacer
******** ************* . **.
580. spacer 16.2|5388541|29|CP024190|CRISPRCasFinder matches to NC_011962 (Rhodobacter sphaeroides KD131 plasmid pRSKD131A, complete sequence) position: , mismatch: 6, identity: 0.793
acccgccaagcccagcagcagccaggcca CRISPR spacer
ccccgccacgcccagcagcagcgacgaga Protospacer
******* ************* * * *
581. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 7, identity: 0.794
ggcgccaccgtctccgccggcgccacccccggtc---- CRISPR spacer
atcgccaccgtctccgccggcgcca----cggtgaagg Protospacer
. *********************** ****
582. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 7, identity: 0.794
ggcgccaccgtctccgccggcgccacccccggtc---- CRISPR spacer
atcgccaccgtctccgccggcgcca----cggtgaagg Protospacer
. *********************** ****
583. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 7, identity: 0.794
ggcgccaccgtctccgccggcgccacccccggtc---- CRISPR spacer
atcgccaccgtctccgccggcgcca----cggtgaagg Protospacer
. *********************** ****
584. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP018759 (Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence) position: , mismatch: 7, identity: 0.794
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
ggcgccaccgtcgccgccggcggcaccggcagca Protospacer
************ ********* **** *.*.
585. spacer 3.1|791267|27|CP024190|CRISPRCasFinder matches to NZ_CP017148 (Bosea vaviloviae strain Vaf18 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.741
gtggagcgatcgcgagcgcggcggagc CRISPR spacer
cgctggcgatcgcgagcgcggcggcga Protospacer
.******************* *
586. spacer 3.1|791267|27|CP024190|CRISPRCasFinder matches to NZ_CP046053 (Methylocystis heyeri strain H2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.741
gtggagcgatcgcgagcgcggcggagc CRISPR spacer
cgaaagcgatcgcgagcgcggcgaggg Protospacer
..*******************..*
587. spacer 3.1|791267|27|CP024190|CRISPRCasFinder matches to KX641262 (Mycobacterium phage Nazo, complete genome) position: , mismatch: 7, identity: 0.741
gtggagcgatcgcgagcgcggcggagc CRISPR spacer
cgcttgcgatcgcgagcgcggcggtga Protospacer
******************* *
588. spacer 3.1|791267|27|CP024190|CRISPRCasFinder matches to NC_023692 (Mycobacterium phage BigNuz, complete genome) position: , mismatch: 7, identity: 0.741
gtggagcgatcgcgagcgcggcggagc CRISPR spacer
cgcttgcgatcgcgagcgcggcggtga Protospacer
******************* *
589. spacer 3.1|791267|27|CP024190|CRISPRCasFinder matches to KR080195 (Mycobacterium phage Phayonce, complete genome) position: , mismatch: 7, identity: 0.741
gtggagcgatcgcgagcgcggcggagc CRISPR spacer
cgcttgcgatcgcgagcgcggcggtga Protospacer
******************* *
590. spacer 4.15|846475|30|CP024190|CRISPRCasFinder matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 7, identity: 0.767
cccgccttcggtgcctgcgggagcgatgcc---- CRISPR spacer
gccgccatcggtgcctgcgggcgc----ccgcga Protospacer
***** ************** ** **
591. spacer 4.15|846475|30|CP024190|CRISPRCasFinder matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 7, identity: 0.767
cccgccttcggtgcctgcgggagcgatgcc---- CRISPR spacer
gccgccatcggtgcctgcgggcgc----ccgcga Protospacer
***** ************** ** **
592. spacer 4.15|846475|30|CP024190|CRISPRCasFinder matches to NZ_CP011521 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-4, complete sequence) position: , mismatch: 7, identity: 0.767
cccgccttcggtgcctgcgggagcgatgcc CRISPR spacer
gccgccttcggtgcgtgcgggaaatagccc Protospacer
************* *******. * **
593. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.731
ttgccgccgtcgccgccgttgttgaa CRISPR spacer
acgccgccgtcgccgccgttgcctct Protospacer
.*******************..
594. spacer 7.3|1613935|33|CP024190|CRT matches to NZ_LR134454 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence) position: , mismatch: 7, identity: 0.788
ccgccggttccggcgataccgagcccgccgaac CRISPR spacer
acgccggttccggcgatgccgcgcccacggccc Protospacer
****************.*** ****.* * *
595. spacer 7.5|1614022|33|CP024190|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.788
ccgccgccgttggcgacaccgaatccgccgaag CRISPR spacer
cggtcgccgttggcgacaccggacccgctgtcg Protospacer
* *.*****************.*.****.* *
596. spacer 10.1|3449582|31|CP024190|CRISPRCasFinder matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.774
gagcgccccctatgcggaagccgcgctggaa CRISPR spacer
gggcgccgccgatgcggaagccgcgcgaggt Protospacer
*.***** ** *************** .*.
597. spacer 11.9|3846348|32|CP024190|CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
cagcggc-ggggccggcgccatcaacgacggcg CRISPR spacer
-aacgctgggggccggcgccaacagcgacggct Protospacer
*.** . ************* **.*******
598. spacer 11.9|3846348|32|CP024190|CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
cagcggc-ggggccggcgccatcaacgacggcg CRISPR spacer
-aacgctgggggccggcgccaacagcgacggct Protospacer
*.** . ************* **.*******
599. spacer 11.9|3846348|32|CP024190|CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781
cagcggc-ggggccggcgccatcaacgacggcg CRISPR spacer
-aacgctgggggccggcgccaacagcgacggct Protospacer
*.** . ************* **.*******
600. spacer 11.9|3846348|32|CP024190|CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
cagcggc-ggggccggcgccatcaacgacggcg CRISPR spacer
-aacgctgggggccggcgccaacagcgacggct Protospacer
*.** . ************* **.*******
601. spacer 11.9|3846348|32|CP024190|CRT matches to NZ_CP029835 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.781
cagcggcggggccggcgccatcaacgacggcg- CRISPR spacer
cagcggcggggccggcaccaac-acgctgacct Protospacer
****************.*** * *** .*.*
602. spacer 11.9|3846348|32|CP024190|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 7, identity: 0.781
cagcggcggggccggcgccatcaa--cgacggcg CRISPR spacer
cagcagcgtggccggcgccatcagatcgacct-- Protospacer
****.*** **************. ****
603. spacer 11.12|3846507|26|CP024190|CRT matches to NC_013531 (Xylanimonas cellulosilytica DSM 15894 plasmid pXCEL01, complete sequence) position: , mismatch: 7, identity: 0.731
caatggcggcagcgccgggctggtcg CRISPR spacer
ggtccccggcagcgccgggctggtca Protospacer
. . *******************.
604. spacer 15.18|5224675|30|CP024190|CRISPRCasFinder matches to NZ_CP040763 (Paracoccus sp. 2251 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.767
tgcggccggcaacggggtactgatcggcaa CRISPR spacer
cggacccggcgacggggtcctgatcggcga Protospacer
.* . *****.******* *********.*
605. spacer 15.18|5224675|30|CP024190|CRISPRCasFinder matches to NZ_LR134461 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence) position: , mismatch: 7, identity: 0.767
tgcggccggcaacggggtactgatcggcaa CRISPR spacer
gtccaccggcaacgtggtgctgatcggcga Protospacer
* .********* ***.*********.*
606. spacer 16.2|5388541|29|CP024190|CRISPRCasFinder matches to NZ_CP015279 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.759
acccgccaagcccagcagcagccaggcca CRISPR spacer
gcccgccaagaccagcggcagccagcgtc Protospacer
.********* *****.******** .
607. spacer 16.2|5388541|29|CP024190|CRISPRCasFinder matches to NZ_LR594664 (Variovorax sp. RA8 plasmid 3) position: , mismatch: 7, identity: 0.759
acccgccaagcccagcagcagccaggcca CRISPR spacer
ggtcggcaagcccagcagcagccagtcgc Protospacer
. .** ******************* *
608. spacer 16.2|5388541|29|CP024190|CRISPRCasFinder matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759
acccgccaagcccagcagcagccaggcca CRISPR spacer
cgacatcaagcccagcagctgccaggcct Protospacer
*..************* ********
609. spacer 16.2|5388541|29|CP024190|CRISPRCasFinder matches to NZ_CP015268 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.759
acccgccaagcccagcagcagccaggcca CRISPR spacer
gcccgccaagaccagcggcagccagcgtc Protospacer
.********* *****.******** .
610. spacer 16.2|5388541|29|CP024190|CRISPRCasFinder matches to NC_030931 (Pseudomonas phage phi2, complete genome) position: , mismatch: 7, identity: 0.759
acccgccaagcccagcagcagccaggcca CRISPR spacer
agaggcaaagcccaacagcagccaggcag Protospacer
* ** *******.************ .
611. spacer 16.2|5388541|29|CP024190|CRISPRCasFinder matches to NC_031091 (Pseudomonas phage MD8, complete genome) position: , mismatch: 7, identity: 0.759
acccgccaagcccagcagcagccaggcca CRISPR spacer
agaggcaaagcccaacagcagccaggcag Protospacer
* ** *******.************ .
612. spacer 16.2|5388541|29|CP024190|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 7, identity: 0.759
acccgccaagcccagcagcagccaggcca CRISPR spacer
cagcgcgaagcccatcagcagccaggacg Protospacer
*** ******* *********** *.
613. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.765
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
cgcgccaccgtctccaccgacgccaccgctgcca Protospacer
**************.***.******* *.* .
614. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.765
ggcgccaccgtctccgccggcgccacccccggtc---- CRISPR spacer
atcgccaccgtttccgccggcgcca----cggtgaagg Protospacer
. *********.************* ****
615. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.765
ggcgccaccgtctccgccggcgccac--ccccggtc CRISPR spacer
accgtcaccgtcaccgccggcgccacggcgacgg-- Protospacer
. **.******* ************* * ***
616. spacer 1.1|656619|34|CP024190|PILER-CR matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.765
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
ggcgccaccgtcgccgccgacgccgtcgagggcc Protospacer
************ ******.****..* **.*
617. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 8, identity: 0.765
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
ggcgccaccgacgccgccggcgccgcggtcggca Protospacer
********** * ***********.* .***.
618. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_LR594676 (Variovorax sp. PBS-H4 plasmid 2) position: , mismatch: 8, identity: 0.765
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
ggcgccaccggctccgccgccgcccgaacctatc Protospacer
********** ******** **** ** .**
619. spacer 4.10|846244|33|CP024190|CRISPRCasFinder matches to MH616755 (Microviridae sp. isolate ctbe756, complete genome) position: , mismatch: 8, identity: 0.758
cccgccggcccctccggtaccggagagggcgcc CRISPR spacer
agctccgccccctccggtaccggagaggacagg Protospacer
* *** ********************.*.
620. spacer 4.10|846244|33|CP024190|CRISPRCasFinder matches to JQ692107 (Vibrio vulnificus phage SSP002, complete genome) position: , mismatch: 8, identity: 0.758
cccgccggcccctccggtaccggagagggcgcc CRISPR spacer
tgcacaggctcctccggtagcggagagggcttc Protospacer
. *.* ***.********* ********** .*
621. spacer 4.10|846244|33|CP024190|CRISPRCasFinder matches to MN215888 (Vibrio phage vB_VpaS_HCMJ, complete genome) position: , mismatch: 8, identity: 0.758
cccgccggcccctccggtaccggagagggcgcc CRISPR spacer
tgcacaggctcctccggtatcggagagggcttc Protospacer
. *.* ***.*********.********** .*
622. spacer 4.10|846244|33|CP024190|CRISPRCasFinder matches to MF754116 (Vibrio phage vB_VpaS_KF6, complete genome) position: , mismatch: 8, identity: 0.758
cccgccggcccctccggtaccggagagggcgcc CRISPR spacer
tgcacaggctcctccggtagcggagagggcttc Protospacer
. *.* ***.********* ********** .*
623. spacer 4.10|846244|33|CP024190|CRISPRCasFinder matches to MF754115 (Vibrio phage vB_VpaS_KF5, complete genome) position: , mismatch: 8, identity: 0.758
cccgccggcccctccggtaccggagagggcgcc CRISPR spacer
tgcacaggctcctccggtagcggagagggcttc Protospacer
. *.* ***.********* ********** .*
624. spacer 4.10|846244|33|CP024190|CRISPRCasFinder matches to MG602476 (Vibrio phage VVP001, complete genome) position: , mismatch: 8, identity: 0.758
cccgccggcccctccggtaccggagagggcgcc CRISPR spacer
tgcacaggctcctccggtagcggagagggcttc Protospacer
. *.* ***.********* ********** .*
625. spacer 4.10|846244|33|CP024190|CRISPRCasFinder matches to MH925090 (UNVERIFIED: Vibrio phage ValLY_3, complete genome) position: , mismatch: 8, identity: 0.758
cccgccggcccctccggtaccggagagggcgcc CRISPR spacer
tgcacaggctcctccggtagcggagagggcttc Protospacer
. *.* ***.********* ********** .*
626. spacer 4.21|846772|30|CP024190|CRISPRCasFinder matches to NZ_CP021214 (Sinorhizobium meliloti RU11/001 plasmid pSmeRU11b, complete sequence) position: , mismatch: 8, identity: 0.733
accgccggcgccgaatagacctgccatgcc CRISPR spacer
ggcgccggcgccgaatagccatgccccgta Protospacer
. **************** * **** .*.
627. spacer 11.9|3846348|32|CP024190|CRT matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cagcggcggggccggcgccatcaacgacggcg CRISPR spacer
agatggcggggcggtcgccatcaacgacatcg Protospacer
...******** * *************. **
628. spacer 11.9|3846348|32|CP024190|CRT matches to NZ_CP015587 (Roseomonas gilardii strain U14-5 plasmid 3, complete sequence) position: , mismatch: 8, identity: 0.75
cagcggcggggccggcgccatcaacgacggcg CRISPR spacer
ggccgtcccggccggcgccgtctacgacggcg Protospacer
. ** * **********.** *********
629. spacer 11.9|3846348|32|CP024190|CRT matches to NZ_CP007792 (Corynebacterium marinum DSM 44953 plasmid pCmarinum1, complete sequence) position: , mismatch: 8, identity: 0.75
cagcggcggggccggcgccatcaacgacggcg CRISPR spacer
tttcgggcaggccgacgccatcatcgacggcg Protospacer
. *** .*****.******** ********
630. spacer 11.9|3846348|32|CP024190|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 8, identity: 0.75
cagcggcggggccggcgccatcaacgacggcg CRISPR spacer
gaacggcgcgaccggcgccatcaacgcggcct Protospacer
*.***** *.*************** * *
631. spacer 11.9|3846348|32|CP024190|CRT matches to CP054917 (Streptomyces sp. NA02950 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cagcggcggggccggcgccatcaacgacggcg CRISPR spacer
cgccttccaggccggcgccatcaacatcggcg Protospacer
*. * * .****************. *****
632. spacer 11.9|3846348|32|CP024190|CRT matches to AP021851 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-2 DNA, complete genome) position: , mismatch: 8, identity: 0.75
cagcggcggggccggcgccatcaacgacggcg CRISPR spacer
ccgcctcggggccggcgccatcaccgtcgtgc Protospacer
* ** ***************** ** **
633. spacer 11.9|3846348|32|CP024190|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 8, identity: 0.75
cagcggcggggccggcgccatcaacgacggcg CRISPR spacer
gaacggcgcgaccggcgccatcaacgcggcct Protospacer
*.***** *.*************** * *
634. spacer 15.18|5224675|30|CP024190|CRISPRCasFinder matches to MT498058 (Gordonia phage Clawz, complete genome) position: , mismatch: 8, identity: 0.733
tgcggccggcaacggggtactgatcggcaa CRISPR spacer
cgagatcggcaacgcggtactgatcggact Protospacer
.* *..******** ************
635. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.735
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
accgccaccgtctcacccggcgccacctcaccgc Protospacer
. ************ ***********.* *
636. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.735
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
atcgccaccgtctccgccggcgccaccgtgaagg Protospacer
. ************************* . ..
637. spacer 1.1|656619|34|CP024190|PILER-CR matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 9, identity: 0.735
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
gaccaggtcgtcgccgacggcgccacccccggtg Protospacer
*.* ..**** *** ****************
638. spacer 1.1|656619|34|CP024190|PILER-CR matches to NC_028865 (Tsukamurella phage TIN2, complete genome) position: , mismatch: 9, identity: 0.735
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
tgcgccaccgtatccgccagcgccaggcgttggc Protospacer
********** ******.****** * . * *
639. spacer 8.11|1615713|33|CP024190|CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 9, identity: 0.727
cccgccggcacctccgtcgcccaacggcgagct CRISPR spacer
agccacggcagctccgtcgcccaaccgcgggaa Protospacer
* ***** ************** ***.*
640. spacer 10.1|3449582|31|CP024190|CRISPRCasFinder matches to NC_004929 (Ruegeria sp. PR1b plasmid pSD20, complete sequence) position: , mismatch: 9, identity: 0.71
gagcgccccctatgcggaagccgcgctggaa CRISPR spacer
cagcgccgcctatgcggatgccgcctatgtg Protospacer
****** ********** ***** . * .
641. spacer 10.1|3449582|31|CP024190|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.71
gagcgccccctatgcggaagccgcgctggaa CRISPR spacer
tcacgcccccgacgcggaagccgcgccgctg Protospacer
.******* *.*************.* .
642. spacer 11.9|3846348|32|CP024190|CRT matches to NZ_CP047900 (Pseudarthrobacter sp. YJ56 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cagcggcggggccggcgccatcaacgacggcg CRISPR spacer
cacattcggggccggtgccatcaccgacgtgc Protospacer
** *********.******* *****
643. spacer 11.9|3846348|32|CP024190|CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 9, identity: 0.719
cagcggcggggccggcgccatcaacgacggcg CRISPR spacer
gcgccgcggggccggcgccatgaactggcggg Protospacer
** **************** *** . * *
644. spacer 15.18|5224675|30|CP024190|CRISPRCasFinder matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 9, identity: 0.7
tgcggccggcaacggggtactgatcggcaa CRISPR spacer
cctcatcggcaacggggaagtgatcggcat Protospacer
. . ..*********** * *********
645. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
atcgccaccgtctccgctggcgccaccgtgaagg Protospacer
. ***************.********* . ..
646. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 10, identity: 0.706
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
atcgccaccgtctcggccggcgccaccgtgaagg Protospacer
. ************ ************ . ..
647. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 10, identity: 0.706
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
atcgccaccgtctccgctggcgccaccgtgaagg Protospacer
. ***************.********* . ..
648. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 10, identity: 0.706
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
atcgccaccgtctccgctggcgccaccgtaaagg Protospacer
. ***************.********* . ..
649. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 10, identity: 0.706
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
atcgccaccgtctccgctggcgccaccgtgaagg Protospacer
. ***************.********* . ..
650. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 10, identity: 0.706
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
atcgccaccgtctccgctggcgccaccgtaaagg Protospacer
. ***************.********* . ..
651. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 10, identity: 0.706
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
atcgccaccgtctcggccggcgccaccgtgaagg Protospacer
. ************ ************ . ..
652. spacer 1.1|656619|34|CP024190|PILER-CR matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 10, identity: 0.706
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
tgcgccagcgtctccgccgccgccagcagggtat Protospacer
****** *********** ***** * * .
653. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 10, identity: 0.706
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
atcgccgccgtcgccgccggcgccacctgtgccg Protospacer
. ****.***** **************. .* .
654. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP053444 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eB, complete sequence) position: , mismatch: 10, identity: 0.706
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
cgagccaccatctccgccgacgccaccgcgtact Protospacer
* ******.*********.******* * ...
655. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP050096 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b3, complete sequence) position: , mismatch: 10, identity: 0.706
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
cgagccaccatctccgccgacgccaccgcgtact Protospacer
* ******.*********.******* * ...
656. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP050102 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b2, complete sequence) position: , mismatch: 10, identity: 0.706
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
cgagccaccatctccgccgacgccaccgcgtact Protospacer
* ******.*********.******* * ...
657. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 10, identity: 0.706
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
aacgccaccgtctcccccgccgccacagtcagcg Protospacer
..************* *** ****** .*.*.
658. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP032230 (Streptomyces seoulensis strain KCTC 9819 plasmid unnamed) position: , mismatch: 10, identity: 0.706
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
ggcgtcaccgtcgccgccggcgccgacatcatct Protospacer
****.******* ***********. * .*. ..
659. spacer 5.7|900974|26|CP024190|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 10, identity: 0.615
ttgccgccgtcgccgccgttgttgaa--- CRISPR spacer
---tcgccgccgtcgccgccgttgggctc Protospacer
.*****.**.*****..****..
660. spacer 15.7|5224114|36|CP024190|CRISPRCasFinder matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 10, identity: 0.722
ggccggcgggctgctgtccggtttggttggtgccgg CRISPR spacer
cgccggcgtgctgccgtccggtttggtcacggtcat Protospacer
******* *****.************.. *.*.
661. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 11, identity: 0.676
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
atcgccaccgtctccgccggtgccacagtaaagg Protospacer
. ******************.***** . ..
662. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 11, identity: 0.676
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
atcgccaccgtctcggctggcgccaccgtgaagg Protospacer
. ************ **.********* . ..
663. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 11, identity: 0.676
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
atcgccaccgtctcggctggcgccaccgtgaagg Protospacer
. ************ **.********* . ..
664. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 11, identity: 0.676
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
atcgccaccgtctcggctggcgccaccgtgaagg Protospacer
. ************ **.********* . ..
665. spacer 1.1|656619|34|CP024190|PILER-CR matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.676
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
tacgccgccttctccgccggcgccaccatgaccg Protospacer
.****.** ***************** . . .
666. spacer 1.1|656619|34|CP024190|PILER-CR matches to MF141540 (Mycobacterium phage Avocado, complete genome) position: , mismatch: 11, identity: 0.676
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
cgcgccaccgttgccgccggcgccaatgtccagg Protospacer
**********. ************ . .* .
667. spacer 1.1|656619|34|CP024190|PILER-CR matches to KR080198 (Mycobacterium phage Cambiare, complete genome) position: , mismatch: 11, identity: 0.676
ggcgccaccgtctccgccggcgccacccccggtc CRISPR spacer
cgcgccaccgttgccgccggcgccaatgtccagg Protospacer
**********. ************ . .* .