Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP012214 Campylobacter jejuni strain CJ088CC52, complete genome 1 crisprs DEDDh,WYL,c2c9_V-U4,cas2,cas1,cas9,csa3 0 5 1 0

Results visualization

1. CP012214
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP012214_2 1374620-1374792 TypeII NA
2 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP012214_2 2.1|1374657|29|CP012214|CRISPRCasFinder 1374657-1374685 29 MN530981 Campylobacter phage DA10, complete genome 12856-12884 1 0.966
CP012214_2 2.3|1374663|25|CP012214|PILER-CR 1374663-1374687 25 MN530981 Campylobacter phage DA10, complete genome 12860-12884 1 0.96
CP012214_2 2.2|1374723|29|CP012214|CRISPRCasFinder 1374723-1374751 29 MN530981 Campylobacter phage DA10, complete genome 19435-19463 2 0.931
CP012214_2 2.4|1374729|28|CP012214|PILER-CR 1374729-1374756 28 MN530981 Campylobacter phage DA10, complete genome 19436-19463 2 0.929
CP012214_1 1.1|1271609|34|CP012214|CRISPRCasFinder 1271609-1271642 34 MH752385 Bacillus phage Ray17, complete genome 8509-8542 10 0.706

1. spacer 2.1|1374657|29|CP012214|CRISPRCasFinder matches to MN530981 (Campylobacter phage DA10, complete genome) position: , mismatch: 1, identity: 0.966

tgattgaagtgtagtaaaggctgtagcac	CRISPR spacer
tgattgaagtgtggtaaaggctgtagcac	Protospacer
************.****************

2. spacer 2.3|1374663|25|CP012214|PILER-CR matches to MN530981 (Campylobacter phage DA10, complete genome) position: , mismatch: 1, identity: 0.96

tgaagtgtagtaaaggctgtagcac	CRISPR spacer
tgaagtgtggtaaaggctgtagcac	Protospacer
********.****************

3. spacer 2.2|1374723|29|CP012214|CRISPRCasFinder matches to MN530981 (Campylobacter phage DA10, complete genome) position: , mismatch: 2, identity: 0.931

tatactctaaaggctctccctcccacacg	CRISPR spacer
tatactctaaaggttctccttcccacacg	Protospacer
*************.*****.*********

4. spacer 2.4|1374729|28|CP012214|PILER-CR matches to MN530981 (Campylobacter phage DA10, complete genome) position: , mismatch: 2, identity: 0.929

atactctaaaggctctccctcccacacg	CRISPR spacer
atactctaaaggttctccttcccacacg	Protospacer
************.*****.*********

5. spacer 1.1|1271609|34|CP012214|CRISPRCasFinder matches to MH752385 (Bacillus phage Ray17, complete genome) position: , mismatch: 10, identity: 0.706

ttttttagctttatactcagccttactcatataa	CRISPR spacer
cttacaagctttatactcagccttattgatcgtt	Protospacer
.** . *******************.* **    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1288254 : 1294324 7 Synechococcus_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage