Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP027698 Klebsiella pneumoniae strain KP30835 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 0 0
CP027697 Klebsiella pneumoniae strain KP30835 chromosome, complete genome 2 crisprs cas3,DEDDh,WYL,RT,DinG,csa3 0 1 10 0
CP027696 Klebsiella pneumoniae strain KP30835 plasmid unnamed1, complete sequence 0 crisprs csa3,RT 0 0 1 0
CP027699 Klebsiella pneumoniae strain KP30835 plasmid unnamed4, complete sequence 0 crisprs NA 0 0 0 0
CP027695 Klebsiella pneumoniae strain KP30835 plasmid unnamed2, complete sequence 0 crisprs DEDDh 0 0 1 0
CP027700 Klebsiella pneumoniae strain KP30835 plasmid unnamed5, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP027695
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 73123 : 96856 20 Enterobacteria_phage(37.5%) transposase,integrase attL 78574:78613|attR 97016:97055
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP027697
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027697_1 732103-732188 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP027697_3 1602757-1602834 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP027697_2 2.1|1215996|36|CP027697|CRISPRCasFinder 1215996-1216031 36 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 8447-8482 0 1.0
CP027697_2 2.1|1215996|36|CP027697|CRISPRCasFinder 1215996-1216031 36 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 8447-8482 0 1.0
CP027697_2 2.1|1215996|36|CP027697|CRISPRCasFinder 1215996-1216031 36 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 11383-11418 0 1.0

1. spacer 2.1|1215996|36|CP027697|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtaccggcgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
************************************

2. spacer 2.1|1215996|36|CP027697|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtaccggcgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
************************************

3. spacer 2.1|1215996|36|CP027697|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0

acgcaaacccagtaaccacgctgcgtaccggcgagg	CRISPR spacer
acgcaaacccagtaaccacgctgcgtaccggcgagg	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 983788 : 995437 11 Enterobacteria_phage(77.78%) integrase attL 971926:971940|attR 994974:994988
DBSCAN-SWA_2 1185719 : 1251309 82 Escherichia_phage(25.45%) integrase,tail,terminase,tRNA,lysis,transposase,head,protease,coat attL 1207826:1207872|attR 1258051:1258097
DBSCAN-SWA_3 1696318 : 1777502 81 Salmonella_phage(60.87%) integrase,tail,capsid,tRNA,portal,plate,head,protease attL 1696226:1696244|attR 1733714:1733732
DBSCAN-SWA_4 2166983 : 2217858 59 Klebsiella_phage(27.91%) integrase,tail,terminase,holin,transposase attL 2158965:2158980|attR 2181788:2181803
DBSCAN-SWA_5 2259613 : 2299377 53 uncultured_Caudovirales_phage(37.78%) tail,terminase,lysis,transposase,head,protease NA
DBSCAN-SWA_6 2521533 : 2527962 7 Escherichia_phage(100.0%) NA NA
DBSCAN-SWA_7 3498670 : 3506295 7 Escherichia_phage(28.57%) NA NA
DBSCAN-SWA_8 3839131 : 3920477 73 Salmonella_phage(37.21%) tail,terminase,holin,transposase,protease NA
DBSCAN-SWA_9 3996755 : 4077543 81 Salmonella_phage(67.39%) integrase,tail,tRNA,capsid,portal,plate,transposase,coat attL 4041446:4041492|attR 4079203:4079249
DBSCAN-SWA_10 4797918 : 4849494 61 uncultured_Caudovirales_phage(68.75%) integrase,tail,terminase,tRNA,capsid,portal,head,protease attL 4833677:4833694|attR 4849668:4849685
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP027696
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 16689 : 54513 34 Escherichia_phage(35.71%) transposase,protease,integrase attL 4409:4424|attR 57984:57999
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage