Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP031369 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101, complete sequence 0 crisprs NA 0 0 0 0
CP031368 Klebsiella pneumoniae strain KpvST101_OXA-48 chromosome, complete genome 2 crisprs NA 0 1 0 0
CP031374 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvOXA-48, complete sequence 0 crisprs NA 0 0 0 0
CP031373 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_6, complete sequence 0 crisprs NA 0 0 0 0
CP031371 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_4, complete sequence 0 crisprs NA 0 0 0 0
CP031375 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_7, complete sequence 0 crisprs NA 0 0 0 0
CP031372 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_5, complete sequence 0 crisprs NA 0 0 0 0
CP031370 Klebsiella pneumoniae strain KpvST101_OXA-48 plasmid pKpvST101_3, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP031368
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031368_1 157422-157523 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP031368_2 2051439-2051534 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP031368_2 2.1|2051469|36|CP031368|CRISPRCasFinder 2051469-2051504 36 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 8447-8482 0 1.0
CP031368_2 2.1|2051469|36|CP031368|CRISPRCasFinder 2051469-2051504 36 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 8447-8482 0 1.0
CP031368_2 2.1|2051469|36|CP031368|CRISPRCasFinder 2051469-2051504 36 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 11383-11418 0 1.0

1. spacer 2.1|2051469|36|CP031368|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

2. spacer 2.1|2051469|36|CP031368|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

3. spacer 2.1|2051469|36|CP031368|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage