Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP033548 Acinetobacter nosocomialis strain 2014N23-120 plasmid p2014N23-120-3, complete sequence 0 crisprs NA 0 0 0 0
CP033545 Acinetobacter nosocomialis strain 2014N23-120 chromosome, complete genome 4 crisprs WYL,csa3,DEDDh 2 6 8 0
CP033546 Acinetobacter nosocomialis strain 2014N23-120 plasmid p2014N23-120-1, complete sequence 0 crisprs NA 0 0 0 0
CP033547 Acinetobacter nosocomialis strain 2014N23-120 plasmid p2014N23-120-2, complete sequence 0 crisprs NA 0 0 0 0
CP033549 Acinetobacter nosocomialis strain 2014N23-120 plasmid p2014N23-120-4, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP033545
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033545_1 103128-103272 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033545_2 521869-522354 Orphan NA
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033545_3 2090454-2090554 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033545_5 3239165-3239247 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP033545_2 2.4|522079|18|CP033545|CRT 522079-522096 18 CP033545.1 522761-522778 0 1.0
CP033545_2 2.6|522187|18|CP033545|CRT 522187-522204 18 CP033545.1 522761-522778 0 1.0
CP033545_2 2.4|522079|18|CP033545|CRT 522079-522096 18 CP033545.1 521851-521868 1 0.944
CP033545_2 2.4|522079|18|CP033545|CRT 522079-522096 18 CP033545.1 522842-522859 1 0.944
CP033545_2 2.4|522079|18|CP033545|CRT 522079-522096 18 CP033545.1 522923-522940 1 0.944
CP033545_2 2.6|522187|18|CP033545|CRT 522187-522204 18 CP033545.1 521851-521868 1 0.944
CP033545_2 2.6|522187|18|CP033545|CRT 522187-522204 18 CP033545.1 522842-522859 1 0.944
CP033545_2 2.6|522187|18|CP033545|CRT 522187-522204 18 CP033545.1 522923-522940 1 0.944

1. spacer 2.4|522079|18|CP033545|CRT matches to position: 522761-522778, mismatch: 0, identity: 1.0

accaccgataatgtcagt	CRISPR spacer
accaccgataatgtcagt	Protospacer
******************

2. spacer 2.6|522187|18|CP033545|CRT matches to position: 522761-522778, mismatch: 0, identity: 1.0

accaccgataatgtcagt	CRISPR spacer
accaccgataatgtcagt	Protospacer
******************

3. spacer 2.4|522079|18|CP033545|CRT matches to position: 521851-521868, mismatch: 1, identity: 0.944

accaccgataatgtcagt	CRISPR spacer
accaccgatgatgtcagt	Protospacer
*********.********

4. spacer 2.4|522079|18|CP033545|CRT matches to position: 522842-522859, mismatch: 1, identity: 0.944

accaccgataatgtcagt	CRISPR spacer
accaccaataatgtcagt	Protospacer
******.***********

5. spacer 2.4|522079|18|CP033545|CRT matches to position: 522923-522940, mismatch: 1, identity: 0.944

accaccgataatgtcagt	CRISPR spacer
accaccgatgatgtcagt	Protospacer
*********.********

6. spacer 2.6|522187|18|CP033545|CRT matches to position: 521851-521868, mismatch: 1, identity: 0.944

accaccgataatgtcagt	CRISPR spacer
accaccgatgatgtcagt	Protospacer
*********.********

7. spacer 2.6|522187|18|CP033545|CRT matches to position: 522842-522859, mismatch: 1, identity: 0.944

accaccgataatgtcagt	CRISPR spacer
accaccaataatgtcagt	Protospacer
******.***********

8. spacer 2.6|522187|18|CP033545|CRT matches to position: 522923-522940, mismatch: 1, identity: 0.944

accaccgataatgtcagt	CRISPR spacer
accaccgatgatgtcagt	Protospacer
*********.********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033545_1 1.2|103218|32|CP033545|PILER-CR 103218-103249 32 NZ_CP022446 Bacillus cereus C1L plasmid pC1L1, complete sequence 299561-299592 6 0.812
CP033545_1 1.2|103218|32|CP033545|PILER-CR 103218-103249 32 NZ_CP011154 Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence 205975-206006 6 0.812
CP033545_1 1.2|103218|32|CP033545|PILER-CR 103218-103249 32 NZ_CP011152 Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence 340909-340940 6 0.812
CP033545_1 1.2|103218|32|CP033545|PILER-CR 103218-103249 32 NC_019358 Clostridium perfringens plasmid pCP8533S12 DNA, complete sequence 5865-5896 8 0.75
CP033545_2 2.1|521899|30|CP033545|CRT 521899-521928 30 AP013864 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15J-MedDCM-OCT-S26-C75, *** SEQUENCING IN PROGRESS *** 10902-10931 8 0.733
CP033545_1 1.2|103218|32|CP033545|PILER-CR 103218-103249 32 NZ_CP029457 Bacillus cereus strain FORC087 plasmid pFORC087.3, complete sequence 14787-14818 9 0.719
CP033545_1 1.2|103218|32|CP033545|PILER-CR 103218-103249 32 NZ_CP031267 Staphylococcus warneri strain 16A plasmid unnamed3 3551-3582 10 0.688
CP033545_1 1.2|103218|32|CP033545|PILER-CR 103218-103249 32 NC_010371 Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence 43411-43442 10 0.688
CP033545_2 2.3|522019|30|CP033545|CRT 522019-522048 30 MN692983 Marine virus AFVG_117M11, complete genome 25850-25879 10 0.667
CP033545_2 2.5|522127|30|CP033545|CRT 522127-522156 30 MN692983 Marine virus AFVG_117M11, complete genome 25850-25879 10 0.667
CP033545_2 2.7|522235|30|CP033545|CRT 522235-522264 30 MN692983 Marine virus AFVG_117M11, complete genome 25850-25879 10 0.667
CP033545_2 2.8|522295|30|CP033545|CRT 522295-522324 30 MN692983 Marine virus AFVG_117M11, complete genome 25850-25879 10 0.667

1. spacer 1.2|103218|32|CP033545|PILER-CR matches to NZ_CP022446 (Bacillus cereus C1L plasmid pC1L1, complete sequence) position: , mismatch: 6, identity: 0.812

atcattttttcttcaatttctactaccagttg	CRISPR spacer
atcattttttcttttatttctactagtagctc	Protospacer
*************. ********** .**.* 

2. spacer 1.2|103218|32|CP033545|PILER-CR matches to NZ_CP011154 (Bacillus cereus strain CMCC P0011 plasmid pRML05, complete sequence) position: , mismatch: 6, identity: 0.812

atcattttttcttcaatttctactaccagttg	CRISPR spacer
atcattttttcttttatttctactagtagctc	Protospacer
*************. ********** .**.* 

3. spacer 1.2|103218|32|CP033545|PILER-CR matches to NZ_CP011152 (Bacillus cereus strain CMCC P0021 plasmid pRML04, complete sequence) position: , mismatch: 6, identity: 0.812

atcattttttcttcaatttctactaccagttg	CRISPR spacer
atcattttttcttttatttctactagtagctc	Protospacer
*************. ********** .**.* 

4. spacer 1.2|103218|32|CP033545|PILER-CR matches to NC_019358 (Clostridium perfringens plasmid pCP8533S12 DNA, complete sequence) position: , mismatch: 8, identity: 0.75

atcattttttcttcaatttctactaccagttg	CRISPR spacer
ttcattttttcttcaatttgtgctaatattgt	Protospacer
 ****************** *.*** .* *  

5. spacer 2.1|521899|30|CP033545|CRT matches to AP013864 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15J-MedDCM-OCT-S26-C75, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.733

gccaccagttaaaccaccgataatgtcagt	CRISPR spacer
gccactaattaaaccaccgataaaagtctt	Protospacer
*****.*.*************** . .  *

6. spacer 1.2|103218|32|CP033545|PILER-CR matches to NZ_CP029457 (Bacillus cereus strain FORC087 plasmid pFORC087.3, complete sequence) position: , mismatch: 9, identity: 0.719

atcattttttcttcaatttctactaccagttg--	CRISPR spacer
ttctttttttcttcaatttttactttt--tcggc	Protospacer
 ** ***************.**** ..  *.*  

7. spacer 1.2|103218|32|CP033545|PILER-CR matches to NZ_CP031267 (Staphylococcus warneri strain 16A plasmid unnamed3) position: , mismatch: 10, identity: 0.688

atcattttttcttcaatttctactaccagttg	CRISPR spacer
ctctttttttcttcaatttctactgaacaaca	Protospacer
 ** ********************.   . ..

8. spacer 1.2|103218|32|CP033545|PILER-CR matches to NC_010371 (Finegoldia magna ATCC 29328 plasmid pFMC, complete sequence) position: , mismatch: 10, identity: 0.688

atcattttttcttcaatttctactaccagttg	CRISPR spacer
tcagtttttgcttcaatttctacaacctttct	Protospacer
 . .***** ************* ***  *. 

9. spacer 2.3|522019|30|CP033545|CRT matches to MN692983 (Marine virus AFVG_117M11, complete genome) position: , mismatch: 10, identity: 0.667

accaccagttaaaccaccgatgatatcagt	CRISPR spacer
accaccatttaaaccaccgattgcggagag	Protospacer
******* ************* ...  .. 

10. spacer 2.5|522127|30|CP033545|CRT matches to MN692983 (Marine virus AFVG_117M11, complete genome) position: , mismatch: 10, identity: 0.667

accaccagttaaaccaccgatgatatcagt	CRISPR spacer
accaccatttaaaccaccgattgcggagag	Protospacer
******* ************* ...  .. 

11. spacer 2.7|522235|30|CP033545|CRT matches to MN692983 (Marine virus AFVG_117M11, complete genome) position: , mismatch: 10, identity: 0.667

accaccagttaaaccaccgatgatatcagt	CRISPR spacer
accaccatttaaaccaccgattgcggagag	Protospacer
******* ************* ...  .. 

12. spacer 2.8|522295|30|CP033545|CRT matches to MN692983 (Marine virus AFVG_117M11, complete genome) position: , mismatch: 10, identity: 0.667

accaccagttaaaccaccgatgatatcagt	CRISPR spacer
accaccatttaaaccaccgattgcggagag	Protospacer
******* ************* ...  .. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1188259 : 1291502 63 Acinetobacter_phage(58.06%) head,capsid,integrase,tail,terminase,protease attL 1208328:1208345|attR 1296559:1296576
DBSCAN-SWA_2 1550991 : 1568107 26 Acinetobacter_phage(77.78%) NA NA
DBSCAN-SWA_3 1574328 : 1577910 7 uncultured_Caudovirales_phage(50.0%) head,tail NA
DBSCAN-SWA_4 2687949 : 2693682 6 Acinetobacter_phage(50.0%) head NA
DBSCAN-SWA_5 3088844 : 3097689 16 Acinetobacter_phage(66.67%) NA NA
DBSCAN-SWA_6 3102262 : 3108112 6 Acinetobacter_phage(83.33%) terminase NA
DBSCAN-SWA_7 3111516 : 3114737 8 Acinetobacter_phage(57.14%) NA NA
DBSCAN-SWA_8 3162902 : 3271536 49 Acinetobacter_phage(14.29%) head,capsid,holin,tail,tRNA,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage