Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP022894 Staphylococcus aureus strain 191 chromosome, complete genome 10 crisprs cas3,DEDDh,csa3,DinG,RT,WYL 10 3 9 0

Results visualization

1. CP022894
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022894_1 170208-170292 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022894_2 429998-430099 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022894_3 787384-787466 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022894_4 830171-830249 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022894_5 835626-835895 Unclear NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022894_6 897455-897536 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022894_7 984239-984320 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022894_8 1420868-1420952 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022894_9 2292137-2292217 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022894_11 2412500-2412580 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP022894_1 1.1|170234|33|CP022894|CRISPRCasFinder 170234-170266 33 CP022894.1 1693589-1693621 0 1.0
CP022894_4 4.1|830195|31|CP022894|CRISPRCasFinder 830195-830225 31 CP022894.1 295110-295140 0 1.0
CP022894_5 5.1|835662|22|CP022894|CRT 835662-835683 22 CP022894.1 170195-170216 0 1.0
CP022894_5 5.1|835662|22|CP022894|CRT 835662-835683 22 CP022894.1 295035-295056 0 1.0
CP022894_5 5.1|835662|22|CP022894|CRT 835662-835683 22 CP022894.1 295145-295166 0 1.0
CP022894_5 5.1|835662|22|CP022894|CRT 835662-835683 22 CP022894.1 660672-660693 0 1.0
CP022894_5 5.1|835662|22|CP022894|CRT 835662-835683 22 CP022894.1 786425-786446 0 1.0
CP022894_5 5.1|835662|22|CP022894|CRT 835662-835683 22 CP022894.1 897528-897549 0 1.0
CP022894_5 5.1|835662|22|CP022894|CRT 835662-835683 22 CP022894.1 1086531-1086552 0 1.0
CP022894_5 5.1|835662|22|CP022894|CRT 835662-835683 22 CP022894.1 1406321-1406342 0 1.0
CP022894_5 5.1|835662|22|CP022894|CRT 835662-835683 22 CP022894.1 1420855-1420876 0 1.0
CP022894_5 5.1|835662|22|CP022894|CRT 835662-835683 22 CP022894.1 1693697-1693718 0 1.0
CP022894_5 5.3|835779|22|CP022894|CRT 835779-835800 22 CP022894.1 170195-170216 0 1.0
CP022894_5 5.3|835779|22|CP022894|CRT 835779-835800 22 CP022894.1 295035-295056 0 1.0
CP022894_5 5.3|835779|22|CP022894|CRT 835779-835800 22 CP022894.1 295145-295166 0 1.0
CP022894_5 5.3|835779|22|CP022894|CRT 835779-835800 22 CP022894.1 660672-660693 0 1.0
CP022894_5 5.3|835779|22|CP022894|CRT 835779-835800 22 CP022894.1 786425-786446 0 1.0
CP022894_5 5.3|835779|22|CP022894|CRT 835779-835800 22 CP022894.1 897528-897549 0 1.0
CP022894_5 5.3|835779|22|CP022894|CRT 835779-835800 22 CP022894.1 1086531-1086552 0 1.0
CP022894_5 5.3|835779|22|CP022894|CRT 835779-835800 22 CP022894.1 1406321-1406342 0 1.0
CP022894_5 5.3|835779|22|CP022894|CRT 835779-835800 22 CP022894.1 1420855-1420876 0 1.0
CP022894_5 5.3|835779|22|CP022894|CRT 835779-835800 22 CP022894.1 1693697-1693718 0 1.0
CP022894_7 7.1|984263|34|CP022894|CRISPRCasFinder 984263-984296 34 CP022894.1 830170-830203 0 1.0
CP022894_7 7.1|984263|34|CP022894|CRISPRCasFinder 984263-984296 34 CP022894.1 1906605-1906638 0 1.0
CP022894_4 4.1|830195|31|CP022894|CRISPRCasFinder 830195-830225 31 CP022894.1 295055-295085 1 0.968
CP022894_4 4.1|830195|31|CP022894|CRISPRCasFinder 830195-830225 31 CP022894.1 1386440-1386470 1 0.968
CP022894_5 5.1|835662|22|CP022894|CRT 835662-835683 22 CP022894.1 1386361-1386382 1 0.955
CP022894_5 5.1|835662|22|CP022894|CRT 835662-835683 22 CP022894.1 1386594-1386615 1 0.955
CP022894_5 5.1|835662|22|CP022894|CRT 835662-835683 22 CP022894.1 2176812-2176833 1 0.955
CP022894_5 5.2|835720|23|CP022894|CRT 835720-835742 23 CP022894.1 787375-787397 1 0.957
CP022894_5 5.2|835720|23|CP022894|CRT 835720-835742 23 CP022894.1 787653-787675 1 0.957
CP022894_5 5.2|835720|23|CP022894|CRT 835720-835742 23 CP022894.1 1086472-1086494 1 0.957
CP022894_5 5.2|835720|23|CP022894|CRT 835720-835742 23 CP022894.1 1693580-1693602 1 0.957
CP022894_5 5.2|835720|23|CP022894|CRT 835720-835742 23 CP022894.1 2401671-2401693 1 0.957
CP022894_5 5.3|835779|22|CP022894|CRT 835779-835800 22 CP022894.1 1386361-1386382 1 0.955
CP022894_5 5.3|835779|22|CP022894|CRT 835779-835800 22 CP022894.1 1386594-1386615 1 0.955
CP022894_5 5.3|835779|22|CP022894|CRT 835779-835800 22 CP022894.1 2176812-2176833 1 0.955
CP022894_5 5.4|835837|23|CP022894|CRT 835837-835859 23 CP022894.1 787375-787397 1 0.957
CP022894_5 5.4|835837|23|CP022894|CRT 835837-835859 23 CP022894.1 787653-787675 1 0.957
CP022894_5 5.4|835837|23|CP022894|CRT 835837-835859 23 CP022894.1 1086472-1086494 1 0.957
CP022894_5 5.4|835837|23|CP022894|CRT 835837-835859 23 CP022894.1 1693580-1693602 1 0.957
CP022894_5 5.4|835837|23|CP022894|CRT 835837-835859 23 CP022894.1 2401671-2401693 1 0.957
CP022894_6 6.1|897479|34|CP022894|CRISPRCasFinder 897479-897512 34 CP022894.1 1693589-1693622 1 0.971
CP022894_7 7.1|984263|34|CP022894|CRISPRCasFinder 984263-984296 34 CP022894.1 1294321-1294354 1 0.971
CP022894_8 8.1|1420894|33|CP022894|CRISPRCasFinder 1420894-1420926 33 CP022894.1 1693589-1693621 1 0.97
CP022894_11 11.1|2412525|31|CP022894|CRISPRCasFinder 2412525-2412555 31 CP022894.1 842914-842944 1 0.968
CP022894_1 1.1|170234|33|CP022894|CRISPRCasFinder 170234-170266 33 CP022894.1 1605267-1605299 2 0.939
CP022894_5 5.2|835720|23|CP022894|CRT 835720-835742 23 CP022894.1 984217-984239 2 0.913
CP022894_5 5.2|835720|23|CP022894|CRT 835720-835742 23 CP022894.1 1605286-1605308 2 0.913
CP022894_5 5.4|835837|23|CP022894|CRT 835837-835859 23 CP022894.1 984217-984239 2 0.913
CP022894_5 5.4|835837|23|CP022894|CRT 835837-835859 23 CP022894.1 1605286-1605308 2 0.913
CP022894_7 7.1|984263|34|CP022894|CRISPRCasFinder 984263-984296 34 CP022894.1 1689215-1689248 2 0.941
CP022894_7 7.1|984263|34|CP022894|CRISPRCasFinder 984263-984296 34 CP022894.1 2870526-2870559 2 0.941
CP022894_11 11.1|2412525|31|CP022894|CRISPRCasFinder 2412525-2412555 31 CP022894.1 70386-70416 2 0.935
CP022894_11 11.1|2412525|31|CP022894|CRISPRCasFinder 2412525-2412555 31 CP022894.1 374984-375014 2 0.935
CP022894_11 11.1|2412525|31|CP022894|CRISPRCasFinder 2412525-2412555 31 CP022894.1 660727-660757 2 0.935
CP022894_11 11.1|2412525|31|CP022894|CRISPRCasFinder 2412525-2412555 31 CP022894.1 897790-897820 2 0.935
CP022894_11 11.1|2412525|31|CP022894|CRISPRCasFinder 2412525-2412555 31 CP022894.1 1087870-1087900 2 0.935
CP022894_11 11.1|2412525|31|CP022894|CRISPRCasFinder 2412525-2412555 31 CP022894.1 1406258-1406288 2 0.935
CP022894_11 11.1|2412525|31|CP022894|CRISPRCasFinder 2412525-2412555 31 CP022894.1 1605225-1605255 2 0.935
CP022894_11 11.1|2412525|31|CP022894|CRISPRCasFinder 2412525-2412555 31 CP022894.1 1693633-1693663 2 0.935
CP022894_11 11.1|2412525|31|CP022894|CRISPRCasFinder 2412525-2412555 31 CP022894.1 1899675-1899705 2 0.935
CP022894_11 11.1|2412525|31|CP022894|CRISPRCasFinder 2412525-2412555 31 CP022894.1 2401724-2401754 2 0.935
CP022894_11 11.1|2412525|31|CP022894|CRISPRCasFinder 2412525-2412555 31 CP022894.1 2577269-2577299 2 0.935

1. spacer 1.1|170234|33|CP022894|CRISPRCasFinder matches to position: 1693589-1693621, mismatch: 0, identity: 1.0

tgggccccaacaaagagaaattggattcccaat	CRISPR spacer
tgggccccaacaaagagaaattggattcccaat	Protospacer
*********************************

2. spacer 4.1|830195|31|CP022894|CRISPRCasFinder matches to position: 295110-295140, mismatch: 0, identity: 1.0

ctgtgttggggccccgccaacttgcattgcc	CRISPR spacer
ctgtgttggggccccgccaacttgcattgcc	Protospacer
*******************************

3. spacer 5.1|835662|22|CP022894|CRT matches to position: 170195-170216, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

4. spacer 5.1|835662|22|CP022894|CRT matches to position: 295035-295056, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

5. spacer 5.1|835662|22|CP022894|CRT matches to position: 295145-295166, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

6. spacer 5.1|835662|22|CP022894|CRT matches to position: 660672-660693, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

7. spacer 5.1|835662|22|CP022894|CRT matches to position: 786425-786446, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

8. spacer 5.1|835662|22|CP022894|CRT matches to position: 897528-897549, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

9. spacer 5.1|835662|22|CP022894|CRT matches to position: 1086531-1086552, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

10. spacer 5.1|835662|22|CP022894|CRT matches to position: 1406321-1406342, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

11. spacer 5.1|835662|22|CP022894|CRT matches to position: 1420855-1420876, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

12. spacer 5.1|835662|22|CP022894|CRT matches to position: 1693697-1693718, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

13. spacer 5.3|835779|22|CP022894|CRT matches to position: 170195-170216, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

14. spacer 5.3|835779|22|CP022894|CRT matches to position: 295035-295056, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

15. spacer 5.3|835779|22|CP022894|CRT matches to position: 295145-295166, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

16. spacer 5.3|835779|22|CP022894|CRT matches to position: 660672-660693, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

17. spacer 5.3|835779|22|CP022894|CRT matches to position: 786425-786446, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

18. spacer 5.3|835779|22|CP022894|CRT matches to position: 897528-897549, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

19. spacer 5.3|835779|22|CP022894|CRT matches to position: 1086531-1086552, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

20. spacer 5.3|835779|22|CP022894|CRT matches to position: 1406321-1406342, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

21. spacer 5.3|835779|22|CP022894|CRT matches to position: 1420855-1420876, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

22. spacer 5.3|835779|22|CP022894|CRT matches to position: 1693697-1693718, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

23. spacer 7.1|984263|34|CP022894|CRISPRCasFinder matches to position: 830170-830203, mismatch: 0, identity: 1.0

ccaacacagagaatttcgaaaagaaattctacaa	CRISPR spacer
ccaacacagagaatttcgaaaagaaattctacaa	Protospacer
**********************************

24. spacer 7.1|984263|34|CP022894|CRISPRCasFinder matches to position: 1906605-1906638, mismatch: 0, identity: 1.0

ccaacacagagaatttcgaaaagaaattctacaa	CRISPR spacer
ccaacacagagaatttcgaaaagaaattctacaa	Protospacer
**********************************

25. spacer 4.1|830195|31|CP022894|CRISPRCasFinder matches to position: 295055-295085, mismatch: 1, identity: 0.968

ctgtgttggggccccgccaacttgcattgcc	CRISPR spacer
ctgtgttggggccccgccaacttgcattacc	Protospacer
****************************.**

26. spacer 4.1|830195|31|CP022894|CRISPRCasFinder matches to position: 1386440-1386470, mismatch: 1, identity: 0.968

ctgtgttggggccccgccaacttgcattgcc	CRISPR spacer
ctgtgttggggccccgccaacttccattgcc	Protospacer
*********************** *******

27. spacer 5.1|835662|22|CP022894|CRT matches to position: 1386361-1386382, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

28. spacer 5.1|835662|22|CP022894|CRT matches to position: 1386594-1386615, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

29. spacer 5.1|835662|22|CP022894|CRT matches to position: 2176812-2176833, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttagaaa	Protospacer
***************** ****

30. spacer 5.2|835720|23|CP022894|CRT matches to position: 787375-787397, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

31. spacer 5.2|835720|23|CP022894|CRT matches to position: 787653-787675, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

32. spacer 5.2|835720|23|CP022894|CRT matches to position: 1086472-1086494, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

33. spacer 5.2|835720|23|CP022894|CRT matches to position: 1693580-1693602, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

34. spacer 5.2|835720|23|CP022894|CRT matches to position: 2401671-2401693, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

35. spacer 5.3|835779|22|CP022894|CRT matches to position: 1386361-1386382, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

36. spacer 5.3|835779|22|CP022894|CRT matches to position: 1386594-1386615, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

37. spacer 5.3|835779|22|CP022894|CRT matches to position: 2176812-2176833, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttagaaa	Protospacer
***************** ****

38. spacer 5.4|835837|23|CP022894|CRT matches to position: 787375-787397, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

39. spacer 5.4|835837|23|CP022894|CRT matches to position: 787653-787675, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

40. spacer 5.4|835837|23|CP022894|CRT matches to position: 1086472-1086494, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

41. spacer 5.4|835837|23|CP022894|CRT matches to position: 1693580-1693602, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

42. spacer 5.4|835837|23|CP022894|CRT matches to position: 2401671-2401693, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

43. spacer 6.1|897479|34|CP022894|CRISPRCasFinder matches to position: 1693589-1693622, mismatch: 1, identity: 0.971

attgagaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
****.*****************************

44. spacer 7.1|984263|34|CP022894|CRISPRCasFinder matches to position: 1294321-1294354, mismatch: 1, identity: 0.971

ccaacacagagaatttcgaaaagaaattctacaa	CRISPR spacer
ccaacacaaagaatttcgaaaagaaattctacaa	Protospacer
********.*************************

45. spacer 8.1|1420894|33|CP022894|CRISPRCasFinder matches to position: 1693589-1693621, mismatch: 1, identity: 0.97

tgggccccaacacagagaaattggattcccaat	CRISPR spacer
tgggccccaacaaagagaaattggattcccaat	Protospacer
************ ********************

46. spacer 11.1|2412525|31|CP022894|CRISPRCasFinder matches to position: 842914-842944, mismatch: 1, identity: 0.968

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgtcagct	Protospacer
***********************.*******

47. spacer 1.1|170234|33|CP022894|CRISPRCasFinder matches to position: 1605267-1605299, mismatch: 2, identity: 0.939

tgggccccaacaaagagaaattggattcccaat	CRISPR spacer
tggaccccaacaaagagaaattgtattcccaat	Protospacer
***.******************* *********

48. spacer 5.2|835720|23|CP022894|CRT matches to position: 984217-984239, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgttgaaattgggaatccaat	Protospacer
***** ********.********

49. spacer 5.2|835720|23|CP022894|CRT matches to position: 1605286-1605308, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatacaat	Protospacer
**************.*** ****

50. spacer 5.4|835837|23|CP022894|CRT matches to position: 984217-984239, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgttgaaattgggaatccaat	Protospacer
***** ********.********

51. spacer 5.4|835837|23|CP022894|CRT matches to position: 1605286-1605308, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatacaat	Protospacer
**************.*** ****

52. spacer 7.1|984263|34|CP022894|CRISPRCasFinder matches to position: 1689215-1689248, mismatch: 2, identity: 0.941

ccaacacagagaatttcgaaaagaaattctacaa	CRISPR spacer
ccaacacagagaatttcgataagaaattccacaa	Protospacer
******************* *********.****

53. spacer 7.1|984263|34|CP022894|CRISPRCasFinder matches to position: 2870526-2870559, mismatch: 2, identity: 0.941

ccaacacagagaatttcgaaaagaaattctacaa	CRISPR spacer
ccaacaaaaagaatttcgaaaagaaattctacaa	Protospacer
****** *.*************************

54. spacer 11.1|2412525|31|CP022894|CRISPRCasFinder matches to position: 70386-70416, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

55. spacer 11.1|2412525|31|CP022894|CRISPRCasFinder matches to position: 374984-375014, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

56. spacer 11.1|2412525|31|CP022894|CRISPRCasFinder matches to position: 660727-660757, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

57. spacer 11.1|2412525|31|CP022894|CRISPRCasFinder matches to position: 897790-897820, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

58. spacer 11.1|2412525|31|CP022894|CRISPRCasFinder matches to position: 1087870-1087900, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

59. spacer 11.1|2412525|31|CP022894|CRISPRCasFinder matches to position: 1406258-1406288, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

60. spacer 11.1|2412525|31|CP022894|CRISPRCasFinder matches to position: 1605225-1605255, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

61. spacer 11.1|2412525|31|CP022894|CRISPRCasFinder matches to position: 1693633-1693663, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

62. spacer 11.1|2412525|31|CP022894|CRISPRCasFinder matches to position: 1899675-1899705, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

63. spacer 11.1|2412525|31|CP022894|CRISPRCasFinder matches to position: 2401724-2401754, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

64. spacer 11.1|2412525|31|CP022894|CRISPRCasFinder matches to position: 2577269-2577299, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP022894_5 5.2|835720|23|CP022894|CRT 835720-835742 23 AP014226 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS *** 28490-28512 3 0.87
CP022894_5 5.2|835720|23|CP022894|CRT 835720-835742 23 AP014225 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS *** 24653-24675 3 0.87
CP022894_5 5.4|835837|23|CP022894|CRT 835837-835859 23 AP014226 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS *** 28490-28512 3 0.87
CP022894_5 5.4|835837|23|CP022894|CRT 835837-835859 23 AP014225 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS *** 24653-24675 3 0.87
CP022894_10 10.1|2304484|34|CP022894|CRISPRCasFinder 2304484-2304517 34 JN882286 Cronobacter phage vB_CsaP_GAP52, complete genome 23034-23067 8 0.765
CP022894_10 10.1|2304484|34|CP022894|CRISPRCasFinder 2304484-2304517 34 CP030544 Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence 7567-7600 8 0.765

1. spacer 5.2|835720|23|CP022894|CRT matches to AP014226 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

2. spacer 5.2|835720|23|CP022894|CRT matches to AP014225 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

3. spacer 5.4|835837|23|CP022894|CRT matches to AP014226 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

4. spacer 5.4|835837|23|CP022894|CRT matches to AP014225 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

5. spacer 10.1|2304484|34|CP022894|CRISPRCasFinder matches to JN882286 (Cronobacter phage vB_CsaP_GAP52, complete genome) position: , mismatch: 8, identity: 0.765

ttgcatatctttagctttattgtttgcaactggg	CRISPR spacer
ttgcatatctttagctttatagcttttatatgct	Protospacer
******************** *.** .*  **  

6. spacer 10.1|2304484|34|CP022894|CRISPRCasFinder matches to CP030544 (Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.765

ttgcatatctttagctttattgtttgcaactggg	CRISPR spacer
ttgaataactttagctttattgttataaacagta	Protospacer
*** *** ****************   *** * .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 398473 : 415727 27 Staphylococcus_phage(76.19%) NA NA
DBSCAN-SWA_2 765503 : 773324 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_3 788113 : 801776 11 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_4 852628 : 869590 25 Staphylococcus_phage(81.25%) integrase attL 854000:854015|attR 861398:861413
DBSCAN-SWA_5 986102 : 1033492 67 Staphylococcus_phage(98.51%) holin,portal,tail,protease,capsid NA
DBSCAN-SWA_6 1166653 : 1232347 60 Staphylococcus_phage(94.12%) tRNA,protease NA
DBSCAN-SWA_7 1362238 : 1371281 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_8 1939795 : 1985507 72 Staphylococcus_phage(75.36%) holin,head,portal,tail NA
DBSCAN-SWA_9 2748033 : 2758387 11 Streptococcus_phage(80.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage