Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP022601 Streptococcus pluranimalium strain 14A0014 chromosome, complete genome 1 crisprs cas3,csm6,DinG,csa3,DEDDh 3 0 10 0

Results visualization

1. CP022601
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022601_3 1212254-1212343 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP022601_1 1.1|509683|26|CP022601|CRISPRCasFinder 509683-509708 26 CP022601.1 509449-509474 0 1.0
CP022601_1 1.1|509683|26|CP022601|CRISPRCasFinder 509683-509708 26 CP022601.1 509566-509591 0 1.0
CP022601_1 1.1|509683|26|CP022601|CRISPRCasFinder 509683-509708 26 CP022601.1 529711-529736 0 1.0
CP022601_1 1.1|509683|26|CP022601|CRISPRCasFinder 509683-509708 26 CP022601.1 529828-529853 0 1.0
CP022601_2 2.1|529945|26|CP022601|CRISPRCasFinder 529945-529970 26 CP022601.1 509449-509474 0 1.0
CP022601_2 2.1|529945|26|CP022601|CRISPRCasFinder 529945-529970 26 CP022601.1 509566-509591 0 1.0
CP022601_2 2.1|529945|26|CP022601|CRISPRCasFinder 529945-529970 26 CP022601.1 529711-529736 0 1.0
CP022601_2 2.1|529945|26|CP022601|CRISPRCasFinder 529945-529970 26 CP022601.1 529828-529853 0 1.0
CP022601_3 3.1|1212283|32|CP022601|CRISPRCasFinder 1212283-1212314 32 CP022601.1 1567549-1567580 0 1.0

1. spacer 1.1|509683|26|CP022601|CRISPRCasFinder matches to position: 509449-509474, mismatch: 0, identity: 1.0

tctctgtccctagagcctcaataggg	CRISPR spacer
tctctgtccctagagcctcaataggg	Protospacer
**************************

2. spacer 1.1|509683|26|CP022601|CRISPRCasFinder matches to position: 509566-509591, mismatch: 0, identity: 1.0

tctctgtccctagagcctcaataggg	CRISPR spacer
tctctgtccctagagcctcaataggg	Protospacer
**************************

3. spacer 1.1|509683|26|CP022601|CRISPRCasFinder matches to position: 529711-529736, mismatch: 0, identity: 1.0

tctctgtccctagagcctcaataggg	CRISPR spacer
tctctgtccctagagcctcaataggg	Protospacer
**************************

4. spacer 1.1|509683|26|CP022601|CRISPRCasFinder matches to position: 529828-529853, mismatch: 0, identity: 1.0

tctctgtccctagagcctcaataggg	CRISPR spacer
tctctgtccctagagcctcaataggg	Protospacer
**************************

5. spacer 2.1|529945|26|CP022601|CRISPRCasFinder matches to position: 509449-509474, mismatch: 0, identity: 1.0

tctctgtccctagagcctcaataggg	CRISPR spacer
tctctgtccctagagcctcaataggg	Protospacer
**************************

6. spacer 2.1|529945|26|CP022601|CRISPRCasFinder matches to position: 509566-509591, mismatch: 0, identity: 1.0

tctctgtccctagagcctcaataggg	CRISPR spacer
tctctgtccctagagcctcaataggg	Protospacer
**************************

7. spacer 2.1|529945|26|CP022601|CRISPRCasFinder matches to position: 529711-529736, mismatch: 0, identity: 1.0

tctctgtccctagagcctcaataggg	CRISPR spacer
tctctgtccctagagcctcaataggg	Protospacer
**************************

8. spacer 2.1|529945|26|CP022601|CRISPRCasFinder matches to position: 529828-529853, mismatch: 0, identity: 1.0

tctctgtccctagagcctcaataggg	CRISPR spacer
tctctgtccctagagcctcaataggg	Protospacer
**************************

9. spacer 3.1|1212283|32|CP022601|CRISPRCasFinder matches to position: 1567549-1567580, mismatch: 0, identity: 1.0

ctctatcttaggactactgctttaagcgggta	CRISPR spacer
ctctatcttaggactactgctttaagcgggta	Protospacer
********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 50525 : 62541 9 Microbacterium_phage(14.29%) NA NA
DBSCAN-SWA_2 439075 : 445131 7 Paenibacillus_phage(33.33%) NA NA
DBSCAN-SWA_3 464788 : 473132 10 Streptococcus_phage(75.0%) NA NA
DBSCAN-SWA_4 491306 : 563515 109 Streptococcus_phage(61.19%) NA NA
DBSCAN-SWA_5 668713 : 684588 25 Streptococcus_phage(82.35%) NA NA
DBSCAN-SWA_6 893514 : 902068 9 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_7 1035186 : 1043547 11 Paenibacillus_phage(37.5%) NA NA
DBSCAN-SWA_8 1627285 : 1635355 8 Paenibacillus_phage(33.33%) NA NA
DBSCAN-SWA_9 1658648 : 1666253 15 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_10 1847407 : 1855541 10 Streptococcus_phage(83.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage