Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP024942 Paraburkholderia terricola strain mHS1 chromosome mHS1_B, complete sequence 3 crisprs PD-DExK,RT,csa3,cas3,DinG 1 0 5 0
CP024941 Paraburkholderia terricola strain mHS1 chromosome mHS1_A, complete sequence 1 crisprs cas3,PD-DExK,WYL,DinG,csa3,DEDDh 0 0 5 0

Results visualization

1. CP024942
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024942_1 1167585-1167756 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024942_2 2115249-2115372 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024942_3 2690675-2690748 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP024942_2 2.1|2115295|32|CP024942|CRISPRCasFinder 2115295-2115326 32 CP024942.1 2115374-2115405 1 0.969

1. spacer 2.1|2115295|32|CP024942|CRISPRCasFinder matches to position: 2115374-2115405, mismatch: 1, identity: 0.969

cagcgaccgcagggagcatgggggtcgtttca	CRISPR spacer
cagcgaccgcagggagcgtgggggtcgtttca	Protospacer
*****************.**************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 21716 : 48765 20 Cronobacter_phage(100.0%) transposase,plate NA
DBSCAN-SWA_2 243811 : 305995 50 Stx2-converting_phage(50.0%) integrase,transposase attL 243279:243294|attR 268668:268683
DBSCAN-SWA_3 345260 : 445046 84 Bacillus_phage(33.33%) integrase,transposase attL 396630:396654|attR 399997:400021
DBSCAN-SWA_4 2325473 : 2366090 36 uncultured_virus(33.33%) bacteriocin,transposase NA
DBSCAN-SWA_5 2782184 : 2843194 39 Bacillus_phage(60.0%) integrase,transposase,protease attL 2841174:2841198|attR 2844539:2844563
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP024941
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024941_1 2342461-2342547 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 966702 : 1014587 60 uncultured_Caudovirales_phage(32.35%) terminase,head,portal,integrase,tail,capsid,transposase,plate attL 976976:976995|attR 1023879:1023898
DBSCAN-SWA_2 2499865 : 2605569 97 uncultured_Caudovirales_phage(30.95%) terminase,head,tRNA,protease,tail,portal,integrase,capsid,transposase,plate attL 2538361:2538391|attR 2588938:2588968
DBSCAN-SWA_3 2833961 : 2867585 25 Bacillus_phage(28.57%) transposase,tRNA NA
DBSCAN-SWA_4 3225163 : 3237484 11 Methanothermobacter_phage(12.5%) protease NA
DBSCAN-SWA_5 3909663 : 3940114 40 Burkholderia_phage(94.74%) terminase,head,portal,tail,integrase,capsid,plate attL 3902898:3902938|attR 3940173:3940213
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage