Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP024902 Burkholderia pyrrocinia strain mHSR5 chromosome mHSR5_A, complete sequence 2 crisprs csa3,cas3,RT,DEDDh,cas14j,DinG 2 5 5 0
CP024903 Burkholderia pyrrocinia strain mHSR5 chromosome mHSR5_B, complete sequence 0 crisprs csa3,RT,cas14j,DinG,cas3 0 0 2 0
CP024904 Burkholderia pyrrocinia strain mHSR5 chromosome mHSR5_C, complete sequence 0 crisprs WYL,RT 0 0 0 0

Results visualization

1. CP024902
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024902_1 2013635-2013706 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP024902_3 3510275-3510351 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP024902_2 2.10|2906488|18|CP024902|CRT 2906488-2906505 18 CP024902.1 2906722-2906739 0 1.0
CP024902_2 2.13|2906605|18|CP024902|CRT 2906605-2906622 18 CP024902.1 2906722-2906739 0 1.0
CP024902_2 2.10|2906488|18|CP024902|CRT 2906488-2906505 18 CP024903.1 1972604-1972621 2 0.889
CP024902_2 2.13|2906605|18|CP024902|CRT 2906605-2906622 18 CP024903.1 1972604-1972621 2 0.889

1. spacer 2.10|2906488|18|CP024902|CRT matches to position: 2906722-2906739, mismatch: 0, identity: 1.0

ccaacggtgtcggcaacg	CRISPR spacer
ccaacggtgtcggcaacg	Protospacer
******************

2. spacer 2.13|2906605|18|CP024902|CRT matches to position: 2906722-2906739, mismatch: 0, identity: 1.0

ccaacggtgtcggcaacg	CRISPR spacer
ccaacggtgtcggcaacg	Protospacer
******************

3. spacer 2.10|2906488|18|CP024902|CRT matches to position: 1972604-1972621, mismatch: 2, identity: 0.889

ccaacggtgtcggcaacg	CRISPR spacer
ccaacgctgtcggcatcg	Protospacer
****** ******** **

4. spacer 2.13|2906605|18|CP024902|CRT matches to position: 1972604-1972621, mismatch: 2, identity: 0.889

ccaacggtgtcggcaacg	CRISPR spacer
ccaacgctgtcggcatcg	Protospacer
****** ******** **

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP018472 Xanthomonas perforans strain LH3 plasmid pLH3.1, complete sequence 9951-9977 2 0.926
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP018726 Xanthomonas vesicatoria ATCC 35937 strain LMG911 plasmid pLMG911.1, complete sequence 83382-83408 2 0.926
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP018472 Xanthomonas perforans strain LH3 plasmid pLH3.1, complete sequence 9951-9977 2 0.926
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP018726 Xanthomonas vesicatoria ATCC 35937 strain LMG911 plasmid pLMG911.1, complete sequence 83382-83408 2 0.926
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP018472 Xanthomonas perforans strain LH3 plasmid pLH3.1, complete sequence 9951-9977 2 0.926
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP018726 Xanthomonas vesicatoria ATCC 35937 strain LMG911 plasmid pLMG911.1, complete sequence 83382-83408 2 0.926
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP018472 Xanthomonas perforans strain LH3 plasmid pLH3.1, complete sequence 9951-9977 2 0.926
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP018726 Xanthomonas vesicatoria ATCC 35937 strain LMG911 plasmid pLMG911.1, complete sequence 83382-83408 2 0.926
CP024902_1 1.1|2013658|26|CP024902|CRISPRCasFinder 2013658-2013683 26 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 646890-646915 3 0.885
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP018732 Xanthomonas gardneri strain ICMP 7383 plasmid pICMP7383.1, complete sequence 190521-190547 3 0.889
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 AP013940 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5B-MedDCM-OCT-S25-C20, *** SEQUENCING IN PROGRESS *** 12572-12598 3 0.889
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 AP013941 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5B-MedDCM-OCT-S32-C20, *** SEQUENCING IN PROGRESS *** 12564-12590 3 0.889
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 AP013938 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5A-MedDCM-OCT-S37-C191, *** SEQUENCING IN PROGRESS *** 8039-8065 3 0.889
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 AP013939 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5A-MedDCM-OCT-S42-C136, *** SEQUENCING IN PROGRESS *** 8038-8064 3 0.889
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP018732 Xanthomonas gardneri strain ICMP 7383 plasmid pICMP7383.1, complete sequence 190521-190547 3 0.889
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 AP013940 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5B-MedDCM-OCT-S25-C20, *** SEQUENCING IN PROGRESS *** 12572-12598 3 0.889
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 AP013941 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5B-MedDCM-OCT-S32-C20, *** SEQUENCING IN PROGRESS *** 12564-12590 3 0.889
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 AP013938 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5A-MedDCM-OCT-S37-C191, *** SEQUENCING IN PROGRESS *** 8039-8065 3 0.889
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 AP013939 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5A-MedDCM-OCT-S42-C136, *** SEQUENCING IN PROGRESS *** 8038-8064 3 0.889
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP018732 Xanthomonas gardneri strain ICMP 7383 plasmid pICMP7383.1, complete sequence 190521-190547 3 0.889
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 AP013940 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5B-MedDCM-OCT-S25-C20, *** SEQUENCING IN PROGRESS *** 12572-12598 3 0.889
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 AP013941 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5B-MedDCM-OCT-S32-C20, *** SEQUENCING IN PROGRESS *** 12564-12590 3 0.889
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 AP013938 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5A-MedDCM-OCT-S37-C191, *** SEQUENCING IN PROGRESS *** 8039-8065 3 0.889
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 AP013939 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5A-MedDCM-OCT-S42-C136, *** SEQUENCING IN PROGRESS *** 8038-8064 3 0.889
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP018732 Xanthomonas gardneri strain ICMP 7383 plasmid pICMP7383.1, complete sequence 190521-190547 3 0.889
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 AP013940 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5B-MedDCM-OCT-S25-C20, *** SEQUENCING IN PROGRESS *** 12572-12598 3 0.889
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 AP013941 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5B-MedDCM-OCT-S32-C20, *** SEQUENCING IN PROGRESS *** 12564-12590 3 0.889
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 AP013938 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5A-MedDCM-OCT-S37-C191, *** SEQUENCING IN PROGRESS *** 8039-8065 3 0.889
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 AP013939 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5A-MedDCM-OCT-S42-C136, *** SEQUENCING IN PROGRESS *** 8038-8064 3 0.889
CP024902_1 1.1|2013658|26|CP024902|CRISPRCasFinder 2013658-2013683 26 NZ_CP049317 Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence 1915498-1915523 4 0.846
CP024902_1 1.1|2013658|26|CP024902|CRISPRCasFinder 2013658-2013683 26 NZ_CP049157 Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence 1719556-1719581 4 0.846
CP024902_1 1.1|2013658|26|CP024902|CRISPRCasFinder 2013658-2013683 26 NZ_CP020399 Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence 448867-448892 4 0.846
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 CP027480 Pseudomonas koreensis strain P19E3 plasmid p3, complete sequence 42071-42097 4 0.852
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP013917 Sphingomonas sp. LK11 plasmid unnamed2, complete sequence 44396-44422 4 0.852
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 CP027480 Pseudomonas koreensis strain P19E3 plasmid p3, complete sequence 42071-42097 4 0.852
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP013917 Sphingomonas sp. LK11 plasmid unnamed2, complete sequence 44396-44422 4 0.852
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 CP027480 Pseudomonas koreensis strain P19E3 plasmid p3, complete sequence 42071-42097 4 0.852
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP013917 Sphingomonas sp. LK11 plasmid unnamed2, complete sequence 44396-44422 4 0.852
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 CP027480 Pseudomonas koreensis strain P19E3 plasmid p3, complete sequence 42071-42097 4 0.852
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP013917 Sphingomonas sp. LK11 plasmid unnamed2, complete sequence 44396-44422 4 0.852
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 799815-799841 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1443822-1443848 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 714076-714102 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 871237-871263 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 890120-890146 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 KU318419 Enterbacter aerogenes strain EA49 plasmid pEA49-KPC, complete sequence 87186-87212 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1066025-1066051 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 627075-627101 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP017185 Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence 62779-62805 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1218983-1219009 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 788067-788093 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 875583-875609 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 380485-380511 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 803300-803326 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 801901-801927 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 988999-989025 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 799105-799131 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 875572-875598 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 988966-988992 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 865087-865113 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 988967-988993 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 890162-890188 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 865087-865113 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 988980-989006 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 865087-865113 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 865091-865117 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 988980-989006 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 988969-988995 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 804446-804472 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 785139-785165 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 839373-839399 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 876255-876281 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 988969-988995 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 865087-865113 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 988965-988991 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 988980-989006 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 988991-989017 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 988969-988995 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1842851-1842877 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 MN175388 Cronobacter sp. strain CR-13-12 plasmid pCR-13-12-NDM-1, complete sequence 43154-43180 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_KU987453 Klebsiella pneumoniae strain 05K0261 plasmid F5111, complete sequence 351-377 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1228030-1228056 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1824718-1824744 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1389326-1389352 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 280429-280455 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1186189-1186215 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1162332-1162358 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1189138-1189164 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1189138-1189164 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_AP019635 Enterobacter sp. 18A13 plasmid pECC18A13-1, complete sequence 45080-45106 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_MF190369 Enterobacter cloacae strain A1137 plasmid pA1137, complete sequence 26175-26201 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 217503-217529 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 1010324-1010350 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 985681-985707 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 880746-880772 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 1010324-1010350 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 880745-880771 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP019241 Rhodoferax antarcticus strain DSMZ24876 plasmid unnamed1 12626-12652 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 MN694102 Marine virus AFVG_250M795, complete genome 18888-18914 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 799815-799841 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1443822-1443848 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 714076-714102 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 871237-871263 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 890120-890146 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 KU318419 Enterbacter aerogenes strain EA49 plasmid pEA49-KPC, complete sequence 87186-87212 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1066025-1066051 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 627075-627101 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP017185 Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence 62779-62805 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1218983-1219009 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 788067-788093 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 875583-875609 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 380485-380511 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 803300-803326 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 801901-801927 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 988999-989025 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 799105-799131 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 875572-875598 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 988966-988992 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 865087-865113 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 988967-988993 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 890162-890188 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 865087-865113 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 988980-989006 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 865087-865113 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 865091-865117 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 988980-989006 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 988969-988995 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 804446-804472 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 785139-785165 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 839373-839399 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 876255-876281 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 988969-988995 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 865087-865113 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 988965-988991 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 988980-989006 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 988991-989017 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 988969-988995 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1842851-1842877 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 MN175388 Cronobacter sp. strain CR-13-12 plasmid pCR-13-12-NDM-1, complete sequence 43154-43180 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_KU987453 Klebsiella pneumoniae strain 05K0261 plasmid F5111, complete sequence 351-377 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1228030-1228056 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1824718-1824744 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1389326-1389352 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 280429-280455 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1186189-1186215 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1162332-1162358 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1189138-1189164 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1189138-1189164 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_AP019635 Enterobacter sp. 18A13 plasmid pECC18A13-1, complete sequence 45080-45106 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_MF190369 Enterobacter cloacae strain A1137 plasmid pA1137, complete sequence 26175-26201 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 217503-217529 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 1010324-1010350 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 985681-985707 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 880746-880772 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 1010324-1010350 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 880745-880771 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP019241 Rhodoferax antarcticus strain DSMZ24876 plasmid unnamed1 12626-12652 5 0.815
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 MN694102 Marine virus AFVG_250M795, complete genome 18888-18914 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 799815-799841 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1443822-1443848 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 714076-714102 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 871237-871263 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 890120-890146 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 KU318419 Enterbacter aerogenes strain EA49 plasmid pEA49-KPC, complete sequence 87186-87212 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1066025-1066051 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 627075-627101 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP017185 Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence 62779-62805 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1218983-1219009 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 788067-788093 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 875583-875609 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 380485-380511 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 803300-803326 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 801901-801927 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 988999-989025 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 799105-799131 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 875572-875598 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 988966-988992 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 865087-865113 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 988967-988993 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 890162-890188 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 865087-865113 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 988980-989006 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 865087-865113 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 865091-865117 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 988980-989006 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 988969-988995 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 804446-804472 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 785139-785165 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 839373-839399 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 876255-876281 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 988969-988995 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 865087-865113 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 988965-988991 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 988980-989006 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 988991-989017 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 988969-988995 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1842851-1842877 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 MN175388 Cronobacter sp. strain CR-13-12 plasmid pCR-13-12-NDM-1, complete sequence 43154-43180 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_KU987453 Klebsiella pneumoniae strain 05K0261 plasmid F5111, complete sequence 351-377 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1228030-1228056 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1824718-1824744 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1389326-1389352 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 280429-280455 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1186189-1186215 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1162332-1162358 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1189138-1189164 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1189138-1189164 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_AP019635 Enterobacter sp. 18A13 plasmid pECC18A13-1, complete sequence 45080-45106 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_MF190369 Enterobacter cloacae strain A1137 plasmid pA1137, complete sequence 26175-26201 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 217503-217529 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 1010324-1010350 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 985681-985707 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 880746-880772 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 1010324-1010350 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 880745-880771 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP019241 Rhodoferax antarcticus strain DSMZ24876 plasmid unnamed1 12626-12652 5 0.815
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 MN694102 Marine virus AFVG_250M795, complete genome 18888-18914 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 799815-799841 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 1443822-1443848 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 714076-714102 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 871237-871263 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP021763 Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence 890120-890146 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 KU318419 Enterbacter aerogenes strain EA49 plasmid pEA49-KPC, complete sequence 87186-87212 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 1066025-1066051 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 627075-627101 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP017185 Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence 62779-62805 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 1218983-1219009 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 788067-788093 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 875583-875609 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 380485-380511 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 803300-803326 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 801901-801927 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 988999-989025 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 799105-799131 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 875572-875598 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 988966-988992 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 865087-865113 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 988967-988993 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP021765 Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence 890162-890188 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 865087-865113 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 988980-989006 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 865087-865113 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 865091-865117 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 988980-989006 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 988969-988995 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 804446-804472 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 785139-785165 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 839373-839399 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 876255-876281 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 988969-988995 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 865087-865113 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 988965-988991 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 988980-989006 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 988991-989017 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 988969-988995 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 1842851-1842877 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 MN175388 Cronobacter sp. strain CR-13-12 plasmid pCR-13-12-NDM-1, complete sequence 43154-43180 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_KU987453 Klebsiella pneumoniae strain 05K0261 plasmid F5111, complete sequence 351-377 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 1228030-1228056 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 1824718-1824744 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 1389326-1389352 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 280429-280455 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 1186189-1186215 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 1162332-1162358 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 1189138-1189164 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 1189138-1189164 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_AP019635 Enterobacter sp. 18A13 plasmid pECC18A13-1, complete sequence 45080-45106 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_MF190369 Enterobacter cloacae strain A1137 plasmid pA1137, complete sequence 26175-26201 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 217503-217529 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP013556 Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence 1010324-1010350 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP013562 Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence 985681-985707 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP013531 Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence 880746-880772 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP013567 Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence 1010324-1010350 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP013584 Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence 880745-880771 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP019241 Rhodoferax antarcticus strain DSMZ24876 plasmid unnamed1 12626-12652 5 0.815
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 MN694102 Marine virus AFVG_250M795, complete genome 18888-18914 5 0.815
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 114161-114187 6 0.778
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 901380-901406 6 0.778
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP013523 Rhizobium phaseoli strain R744 plasmid pRphaR744a, complete sequence 68628-68654 6 0.778
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 1008428-1008454 6 0.778
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 902809-902835 6 0.778
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 1008428-1008454 6 0.778
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP022518 Pantoea vagans strain FBS135 plasmid pPant2, complete sequence 141164-141190 6 0.778
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 114161-114187 6 0.778
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 901380-901406 6 0.778
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP013523 Rhizobium phaseoli strain R744 plasmid pRphaR744a, complete sequence 68628-68654 6 0.778
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 1008428-1008454 6 0.778
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 902809-902835 6 0.778
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 1008428-1008454 6 0.778
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP022518 Pantoea vagans strain FBS135 plasmid pPant2, complete sequence 141164-141190 6 0.778
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 114161-114187 6 0.778
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 901380-901406 6 0.778
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP013523 Rhizobium phaseoli strain R744 plasmid pRphaR744a, complete sequence 68628-68654 6 0.778
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 1008428-1008454 6 0.778
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 902809-902835 6 0.778
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 1008428-1008454 6 0.778
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP022518 Pantoea vagans strain FBS135 plasmid pPant2, complete sequence 141164-141190 6 0.778
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP029209 Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence 114161-114187 6 0.778
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 901380-901406 6 0.778
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP013523 Rhizobium phaseoli strain R744 plasmid pRphaR744a, complete sequence 68628-68654 6 0.778
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP013579 Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence 1008428-1008454 6 0.778
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP013546 Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence 902809-902835 6 0.778
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP013573 Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence 1008428-1008454 6 0.778
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP022518 Pantoea vagans strain FBS135 plasmid pPant2, complete sequence 141164-141190 6 0.778
CP024902_2 2.6|2906302|27|CP024902|CRT 2906302-2906328 27 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 620675-620701 8 0.704
CP024902_2 2.9|2906443|27|CP024902|CRT 2906443-2906469 27 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 620675-620701 8 0.704
CP024902_2 2.12|2906560|27|CP024902|CRT 2906560-2906586 27 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 620675-620701 8 0.704
CP024902_2 2.15|2906677|27|CP024902|CRT 2906677-2906703 27 NZ_CP029452 Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence 620675-620701 8 0.704

1. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP018472 (Xanthomonas perforans strain LH3 plasmid pLH3.1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcggtggcg	Protospacer
**********.*********.******

2. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP018726 (Xanthomonas vesicatoria ATCC 35937 strain LMG911 plasmid pLMG911.1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcggtggcg	Protospacer
**********.*********.******

3. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP018472 (Xanthomonas perforans strain LH3 plasmid pLH3.1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcggtggcg	Protospacer
**********.*********.******

4. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP018726 (Xanthomonas vesicatoria ATCC 35937 strain LMG911 plasmid pLMG911.1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcggtggcg	Protospacer
**********.*********.******

5. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP018472 (Xanthomonas perforans strain LH3 plasmid pLH3.1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcggtggcg	Protospacer
**********.*********.******

6. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP018726 (Xanthomonas vesicatoria ATCC 35937 strain LMG911 plasmid pLMG911.1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcggtggcg	Protospacer
**********.*********.******

7. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP018472 (Xanthomonas perforans strain LH3 plasmid pLH3.1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcggtggcg	Protospacer
**********.*********.******

8. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP018726 (Xanthomonas vesicatoria ATCC 35937 strain LMG911 plasmid pLMG911.1, complete sequence) position: , mismatch: 2, identity: 0.926

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcggtggcg	Protospacer
**********.*********.******

9. spacer 1.1|2013658|26|CP024902|CRISPRCasFinder matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 3, identity: 0.885

cgttagtgcttcagcacttacgctgg	CRISPR spacer
agttagcgcttcagcacttactctgg	Protospacer
 *****.************** ****

10. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP018732 (Xanthomonas gardneri strain ICMP 7383 plasmid pICMP7383.1, complete sequence) position: , mismatch: 3, identity: 0.889

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
tcaacggcaacggcaacggcggtggcg	Protospacer
 *********.*********.******

11. spacer 2.6|2906302|27|CP024902|CRT matches to AP013940 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5B-MedDCM-OCT-S25-C20, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.889

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaatggcaatggcaatggca	Protospacer
****************.****.****.

12. spacer 2.6|2906302|27|CP024902|CRT matches to AP013941 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5B-MedDCM-OCT-S32-C20, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.889

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaatggcaatggcaatggca	Protospacer
****************.****.****.

13. spacer 2.6|2906302|27|CP024902|CRT matches to AP013938 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5A-MedDCM-OCT-S37-C191, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.889

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaatggcaatggcaatggca	Protospacer
****************.****.****.

14. spacer 2.6|2906302|27|CP024902|CRT matches to AP013939 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5A-MedDCM-OCT-S42-C136, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.889

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaatggcaatggcaatggca	Protospacer
****************.****.****.

15. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP018732 (Xanthomonas gardneri strain ICMP 7383 plasmid pICMP7383.1, complete sequence) position: , mismatch: 3, identity: 0.889

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
tcaacggcaacggcaacggcggtggcg	Protospacer
 *********.*********.******

16. spacer 2.9|2906443|27|CP024902|CRT matches to AP013940 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5B-MedDCM-OCT-S25-C20, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.889

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaatggcaatggcaatggca	Protospacer
****************.****.****.

17. spacer 2.9|2906443|27|CP024902|CRT matches to AP013941 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5B-MedDCM-OCT-S32-C20, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.889

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaatggcaatggcaatggca	Protospacer
****************.****.****.

18. spacer 2.9|2906443|27|CP024902|CRT matches to AP013938 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5A-MedDCM-OCT-S37-C191, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.889

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaatggcaatggcaatggca	Protospacer
****************.****.****.

19. spacer 2.9|2906443|27|CP024902|CRT matches to AP013939 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5A-MedDCM-OCT-S42-C136, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.889

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaatggcaatggcaatggca	Protospacer
****************.****.****.

20. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP018732 (Xanthomonas gardneri strain ICMP 7383 plasmid pICMP7383.1, complete sequence) position: , mismatch: 3, identity: 0.889

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
tcaacggcaacggcaacggcggtggcg	Protospacer
 *********.*********.******

21. spacer 2.12|2906560|27|CP024902|CRT matches to AP013940 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5B-MedDCM-OCT-S25-C20, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.889

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaatggcaatggcaatggca	Protospacer
****************.****.****.

22. spacer 2.12|2906560|27|CP024902|CRT matches to AP013941 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5B-MedDCM-OCT-S32-C20, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.889

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaatggcaatggcaatggca	Protospacer
****************.****.****.

23. spacer 2.12|2906560|27|CP024902|CRT matches to AP013938 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5A-MedDCM-OCT-S37-C191, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.889

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaatggcaatggcaatggca	Protospacer
****************.****.****.

24. spacer 2.12|2906560|27|CP024902|CRT matches to AP013939 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5A-MedDCM-OCT-S42-C136, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.889

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaatggcaatggcaatggca	Protospacer
****************.****.****.

25. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP018732 (Xanthomonas gardneri strain ICMP 7383 plasmid pICMP7383.1, complete sequence) position: , mismatch: 3, identity: 0.889

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
tcaacggcaacggcaacggcggtggcg	Protospacer
 *********.*********.******

26. spacer 2.15|2906677|27|CP024902|CRT matches to AP013940 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5B-MedDCM-OCT-S25-C20, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.889

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaatggcaatggcaatggca	Protospacer
****************.****.****.

27. spacer 2.15|2906677|27|CP024902|CRT matches to AP013941 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5B-MedDCM-OCT-S32-C20, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.889

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaatggcaatggcaatggca	Protospacer
****************.****.****.

28. spacer 2.15|2906677|27|CP024902|CRT matches to AP013938 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5A-MedDCM-OCT-S37-C191, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.889

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaatggcaatggcaatggca	Protospacer
****************.****.****.

29. spacer 2.15|2906677|27|CP024902|CRT matches to AP013939 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C5A-MedDCM-OCT-S42-C136, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.889

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaatggcaatggcaatggca	Protospacer
****************.****.****.

30. spacer 1.1|2013658|26|CP024902|CRISPRCasFinder matches to NZ_CP049317 (Caballeronia sp. SBC2 plasmid pSBC2-1, complete sequence) position: , mismatch: 4, identity: 0.846

cgttagtgcttcagcacttacgctgg	CRISPR spacer
cgttagtgcttcagcacttatggatg	Protospacer
********************.*   *

31. spacer 1.1|2013658|26|CP024902|CRISPRCasFinder matches to NZ_CP049157 (Caballeronia sp. SBC1 plasmid pSBC1_1, complete sequence) position: , mismatch: 4, identity: 0.846

cgttagtgcttcagcacttacgctgg	CRISPR spacer
cgttagtgcttcagcacttatggatg	Protospacer
********************.*   *

32. spacer 1.1|2013658|26|CP024902|CRISPRCasFinder matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.846

cgttagtgcttcagcacttacgctgg	CRISPR spacer
cgttagtgctttagcacttacacgga	Protospacer
***********.*********.* *.

33. spacer 2.6|2906302|27|CP024902|CRT matches to CP027480 (Pseudomonas koreensis strain P19E3 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.852

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacggag	Protospacer
**********.**********..** *

34. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP013917 (Sphingomonas sp. LK11 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtagcggcaatggcgacggcagcggcg	Protospacer
*.*.**********.*******.****

35. spacer 2.9|2906443|27|CP024902|CRT matches to CP027480 (Pseudomonas koreensis strain P19E3 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.852

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacggag	Protospacer
**********.**********..** *

36. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP013917 (Sphingomonas sp. LK11 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtagcggcaatggcgacggcagcggcg	Protospacer
*.*.**********.*******.****

37. spacer 2.12|2906560|27|CP024902|CRT matches to CP027480 (Pseudomonas koreensis strain P19E3 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.852

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacggag	Protospacer
**********.**********..** *

38. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP013917 (Sphingomonas sp. LK11 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtagcggcaatggcgacggcagcggcg	Protospacer
*.*.**********.*******.****

39. spacer 2.15|2906677|27|CP024902|CRT matches to CP027480 (Pseudomonas koreensis strain P19E3 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.852

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacggag	Protospacer
**********.**********..** *

40. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP013917 (Sphingomonas sp. LK11 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtagcggcaatggcgacggcagcggcg	Protospacer
*.*.**********.*******.****

41. spacer 2.6|2906302|27|CP024902|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

42. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

43. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

44. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

45. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

46. spacer 2.6|2906302|27|CP024902|CRT matches to KU318419 (Enterbacter aerogenes strain EA49 plasmid pEA49-KPC, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

47. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

48. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

49. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

50. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

51. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

52. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

53. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgagg	Protospacer
**********.**********..*. *

54. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

55. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

56. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

57. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

58. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

59. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

60. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

61. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

62. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcat	Protospacer
*.********************.*   

63. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

64. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

65. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

66. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

67. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

68. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

69. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

70. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

71. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

72. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

73. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

74. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

75. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

76. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

77. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

78. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

79. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

80. spacer 2.6|2906302|27|CP024902|CRT matches to MN175388 (Cronobacter sp. strain CR-13-12 plasmid pCR-13-12-NDM-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

81. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_KU987453 (Klebsiella pneumoniae strain 05K0261 plasmid F5111, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

82. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

83. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

84. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtggcggcaatggcaacggcaatggag	Protospacer
*...*****************.*** *

85. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

86. spacer 2.6|2906302|27|CP024902|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

87. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

88. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

89. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

90. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_AP019635 (Enterobacter sp. 18A13 plasmid pECC18A13-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

91. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_MF190369 (Enterobacter cloacae strain A1137 plasmid pA1137, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

92. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacagcaatggcaacggcaaggtgg	Protospacer
*****.***************. *  *

93. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatcccg	Protospacer
..*******************.*  **

94. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatcccg	Protospacer
..*******************.*  **

95. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatcccg	Protospacer
..*******************.*  **

96. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatcccg	Protospacer
..*******************.*  **

97. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatcccg	Protospacer
..*******************.*  **

98. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP019241 (Rhodoferax antarcticus strain DSMZ24876 plasmid unnamed1) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcagcggcaacggcagtttca	Protospacer
*********..************  *.

99. spacer 2.6|2906302|27|CP024902|CRT matches to MN694102 (Marine virus AFVG_250M795, complete genome) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gaggcggcaatggcaatggcagtggag	Protospacer
* ..************.******** *

100. spacer 2.9|2906443|27|CP024902|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

101. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

102. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

103. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

104. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

105. spacer 2.9|2906443|27|CP024902|CRT matches to KU318419 (Enterbacter aerogenes strain EA49 plasmid pEA49-KPC, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

106. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

107. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

108. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

109. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

110. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

111. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

112. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgagg	Protospacer
**********.**********..*. *

113. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

114. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

115. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

116. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

117. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

118. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

119. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

120. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

121. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcat	Protospacer
*.********************.*   

122. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

123. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

124. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

125. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

126. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

127. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

128. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

129. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

130. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

131. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

132. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

133. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

134. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

135. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

136. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

137. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

138. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

139. spacer 2.9|2906443|27|CP024902|CRT matches to MN175388 (Cronobacter sp. strain CR-13-12 plasmid pCR-13-12-NDM-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

140. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_KU987453 (Klebsiella pneumoniae strain 05K0261 plasmid F5111, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

141. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

142. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

143. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtggcggcaatggcaacggcaatggag	Protospacer
*...*****************.*** *

144. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

145. spacer 2.9|2906443|27|CP024902|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

146. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

147. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

148. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

149. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_AP019635 (Enterobacter sp. 18A13 plasmid pECC18A13-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

150. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_MF190369 (Enterobacter cloacae strain A1137 plasmid pA1137, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

151. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacagcaatggcaacggcaaggtgg	Protospacer
*****.***************. *  *

152. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatcccg	Protospacer
..*******************.*  **

153. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatcccg	Protospacer
..*******************.*  **

154. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatcccg	Protospacer
..*******************.*  **

155. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatcccg	Protospacer
..*******************.*  **

156. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatcccg	Protospacer
..*******************.*  **

157. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP019241 (Rhodoferax antarcticus strain DSMZ24876 plasmid unnamed1) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcagcggcaacggcagtttca	Protospacer
*********..************  *.

158. spacer 2.9|2906443|27|CP024902|CRT matches to MN694102 (Marine virus AFVG_250M795, complete genome) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gaggcggcaatggcaatggcagtggag	Protospacer
* ..************.******** *

159. spacer 2.12|2906560|27|CP024902|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

160. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

161. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

162. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

163. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

164. spacer 2.12|2906560|27|CP024902|CRT matches to KU318419 (Enterbacter aerogenes strain EA49 plasmid pEA49-KPC, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

165. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

166. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

167. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

168. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

169. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

170. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

171. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgagg	Protospacer
**********.**********..*. *

172. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

173. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

174. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

175. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

176. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

177. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

178. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

179. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

180. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcat	Protospacer
*.********************.*   

181. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

182. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

183. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

184. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

185. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

186. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

187. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

188. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

189. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

190. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

191. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

192. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

193. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

194. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

195. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

196. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

197. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

198. spacer 2.12|2906560|27|CP024902|CRT matches to MN175388 (Cronobacter sp. strain CR-13-12 plasmid pCR-13-12-NDM-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

199. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_KU987453 (Klebsiella pneumoniae strain 05K0261 plasmid F5111, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

200. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

201. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

202. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtggcggcaatggcaacggcaatggag	Protospacer
*...*****************.*** *

203. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

204. spacer 2.12|2906560|27|CP024902|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

205. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

206. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

207. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

208. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_AP019635 (Enterobacter sp. 18A13 plasmid pECC18A13-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

209. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_MF190369 (Enterobacter cloacae strain A1137 plasmid pA1137, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

210. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacagcaatggcaacggcaaggtgg	Protospacer
*****.***************. *  *

211. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatcccg	Protospacer
..*******************.*  **

212. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatcccg	Protospacer
..*******************.*  **

213. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatcccg	Protospacer
..*******************.*  **

214. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatcccg	Protospacer
..*******************.*  **

215. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatcccg	Protospacer
..*******************.*  **

216. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP019241 (Rhodoferax antarcticus strain DSMZ24876 plasmid unnamed1) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcagcggcaacggcagtttca	Protospacer
*********..************  *.

217. spacer 2.12|2906560|27|CP024902|CRT matches to MN694102 (Marine virus AFVG_250M795, complete genome) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gaggcggcaatggcaatggcagtggag	Protospacer
* ..************.******** *

218. spacer 2.15|2906677|27|CP024902|CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

219. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

220. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

221. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

222. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

223. spacer 2.15|2906677|27|CP024902|CRT matches to KU318419 (Enterbacter aerogenes strain EA49 plasmid pEA49-KPC, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

224. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

225. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

226. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP017185 (Enterobacter roggenkampii strain DSM 16690 plasmid pDSMZ16690, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

227. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

228. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

229. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

230. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgagg	Protospacer
**********.**********..*. *

231. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

232. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

233. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

234. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

235. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

236. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

237. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

238. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

239. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcat	Protospacer
*.********************.*   

240. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

241. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

242. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

243. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

244. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

245. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

246. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

247. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

248. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

249. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

250. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

251. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

252. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

253. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

254. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

255. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

256. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

257. spacer 2.15|2906677|27|CP024902|CRT matches to MN175388 (Cronobacter sp. strain CR-13-12 plasmid pCR-13-12-NDM-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

258. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_KU987453 (Klebsiella pneumoniae strain 05K0261 plasmid F5111, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

259. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

260. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

261. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtggcggcaatggcaacggcaatggag	Protospacer
*...*****************.*** *

262. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

263. spacer 2.15|2906677|27|CP024902|CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

264. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

265. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

266. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gtaacggcaatggcaacggcagcgcgt	Protospacer
*.********************.*   

267. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_AP019635 (Enterobacter sp. 18A13 plasmid pECC18A13-1, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

268. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_MF190369 (Enterobacter cloacae strain A1137 plasmid pA1137, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaacgcag	Protospacer
**********.**********..*  *

269. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacagcaatggcaacggcaaggtgg	Protospacer
*****.***************. *  *

270. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatcccg	Protospacer
..*******************.*  **

271. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatcccg	Protospacer
..*******************.*  **

272. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatcccg	Protospacer
..*******************.*  **

273. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatcccg	Protospacer
..*******************.*  **

274. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatcccg	Protospacer
..*******************.*  **

275. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP019241 (Rhodoferax antarcticus strain DSMZ24876 plasmid unnamed1) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcagcggcaacggcagtttca	Protospacer
*********..************  *.

276. spacer 2.15|2906677|27|CP024902|CRT matches to MN694102 (Marine virus AFVG_250M795, complete genome) position: , mismatch: 5, identity: 0.815

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gaggcggcaatggcaatggcagtggag	Protospacer
* ..************.******** *

277. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaaaagat	Protospacer
**********.**********. .*  

278. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaatctgc	Protospacer
**********.**********.*    

279. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP013523 (Rhizobium phaseoli strain R744 plasmid pRphaR744a, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatccca	Protospacer
..*******************.*  *.

280. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatccca	Protospacer
..*******************.*  *.

281. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatccca	Protospacer
..*******************.*  *.

282. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatccca	Protospacer
..*******************.*  *.

283. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP022518 (Pantoea vagans strain FBS135 plasmid pPant2, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ctgacggcactggcaacggcaatggca	Protospacer
 ..****** ***********.****.

284. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaaaagat	Protospacer
**********.**********. .*  

285. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaatctgc	Protospacer
**********.**********.*    

286. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP013523 (Rhizobium phaseoli strain R744 plasmid pRphaR744a, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatccca	Protospacer
..*******************.*  *.

287. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatccca	Protospacer
..*******************.*  *.

288. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatccca	Protospacer
..*******************.*  *.

289. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatccca	Protospacer
..*******************.*  *.

290. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP022518 (Pantoea vagans strain FBS135 plasmid pPant2, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ctgacggcactggcaacggcaatggca	Protospacer
 ..****** ***********.****.

291. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaaaagat	Protospacer
**********.**********. .*  

292. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaatctgc	Protospacer
**********.**********.*    

293. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP013523 (Rhizobium phaseoli strain R744 plasmid pRphaR744a, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatccca	Protospacer
..*******************.*  *.

294. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatccca	Protospacer
..*******************.*  *.

295. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatccca	Protospacer
..*******************.*  *.

296. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatccca	Protospacer
..*******************.*  *.

297. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP022518 (Pantoea vagans strain FBS135 plasmid pPant2, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ctgacggcactggcaacggcaatggca	Protospacer
 ..****** ***********.****.

298. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaaaagat	Protospacer
**********.**********. .*  

299. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
gcaacggcaacggcaacggcaatctgc	Protospacer
**********.**********.*    

300. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP013523 (Rhizobium phaseoli strain R744 plasmid pRphaR744a, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatccca	Protospacer
..*******************.*  *.

301. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatccca	Protospacer
..*******************.*  *.

302. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatccca	Protospacer
..*******************.*  *.

303. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ataacggcaatggcaacggcaatccca	Protospacer
..*******************.*  *.

304. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP022518 (Pantoea vagans strain FBS135 plasmid pPant2, complete sequence) position: , mismatch: 6, identity: 0.778

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
ctgacggcactggcaacggcaatggca	Protospacer
 ..****** ***********.****.

305. spacer 2.6|2906302|27|CP024902|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.704

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
tgaacggcaatggcaacggcaacctga	Protospacer
  *******************..   .

306. spacer 2.9|2906443|27|CP024902|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.704

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
tgaacggcaatggcaacggcaacctga	Protospacer
  *******************..   .

307. spacer 2.12|2906560|27|CP024902|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.704

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
tgaacggcaatggcaacggcaacctga	Protospacer
  *******************..   .

308. spacer 2.15|2906677|27|CP024902|CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.704

gcaacggcaatggcaacggcagtggcg	CRISPR spacer
tgaacggcaatggcaacggcaacctga	Protospacer
  *******************..   .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 419008 : 480244 45 uncultured_Caudovirales_phage(42.86%) protease,plate,transposase NA
DBSCAN-SWA_2 780056 : 790466 8 Hokovirus(14.29%) transposase NA
DBSCAN-SWA_3 1117395 : 1125679 8 Bacillus_phage(16.67%) NA NA
DBSCAN-SWA_4 1752116 : 1831200 103 Burkholderia_virus(29.31%) tail,terminase,integrase,head,portal,plate,capsid,tRNA,holin attL 1761892:1761924|attR 1815808:1815840
DBSCAN-SWA_5 2714495 : 2756049 48 uncultured_Caudovirales_phage(35.48%) tail,terminase,integrase,head,portal,plate,capsid,holin,transposase attL 2719996:2720011|attR 2758123:2758138
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP024903
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 616147 : 674919 46 Cronobacter_phage(16.67%) plate,protease,transposase NA
DBSCAN-SWA_2 1415840 : 1499221 83 Burkholderia_phage(82.14%) plate,terminase,tail,portal,capsid,head,transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage