Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP030024 Salmonella enterica subsp. enterica strain SA20120345 chromosome, complete genome 2 crisprs PD-DExK,WYL,cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3,c2c9_V-U4,DEDDh,DinG 0 22 5 0
CP030025 Salmonella enterica subsp. enterica strain SA20120345 plasmid pSA20120345.1, complete sequence 0 crisprs DEDDh,cas14j 0 0 0 0

Results visualization

1. CP030024
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030024_2 951330-952701 TypeI-E I-E
22 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030024_3 968988-970481 TypeI-E I-E
24 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP030024_4 4.1|1482180|42|CP030024|CRISPRCasFinder 1482180-1482221 42 MW013502 Salmonella virus L cI-40 13-am43, complete genome 31672-31713 0 1.0
CP030024_4 4.1|1482180|42|CP030024|CRISPRCasFinder 1482180-1482221 42 NC_004348 Enterobacteria phage ST64T, complete genome 14874-14915 0 1.0
CP030024_4 4.1|1482180|42|CP030024|CRISPRCasFinder 1482180-1482221 42 MW013503 Salmonella virus L cII-101, complete genome 31673-31714 0 1.0
CP030024_4 4.1|1482180|42|CP030024|CRISPRCasFinder 1482180-1482221 42 AY052766 Salmonella typhimurium bacteriophage ST64T, complete genome 14874-14915 0 1.0
CP030024_4 4.1|1482180|42|CP030024|CRISPRCasFinder 1482180-1482221 42 MF188997 Salmonella phage vB_SalP_PM43, complete genome 14769-14810 0 1.0
CP030024_2 2.15|952214|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 952214-952245 32 NZ_CP034699 Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence 177960-177991 1 0.969
CP030024_2 2.15|952214|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 952214-952245 32 NZ_CP034710 Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence 67131-67162 1 0.969
CP030024_3 3.3|969139|32|CP030024|CRISPRCasFinder,CRT 969139-969170 32 NZ_CP039495 Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000669 plasmid pCFSAN000669_2, complete sequence 16537-16568 2 0.938
CP030024_3 3.3|969139|32|CP030024|CRISPRCasFinder,CRT 969139-969170 32 KC139516 Salmonella phage FSL SP-016, partial genome 44540-44571 2 0.938
CP030024_3 3.3|969139|32|CP030024|CRISPRCasFinder,CRT 969139-969170 32 NC_042346 Salmonella virus BTP1 genome assembly, chromosome: BTP1 23602-23633 2 0.938
CP030024_4 4.1|1482180|42|CP030024|CRISPRCasFinder 1482180-1482221 42 NC_011802 Salmonella enterica bacteriophage SE1, complete genome 15034-15075 2 0.952
CP030024_4 4.1|1482180|42|CP030024|CRISPRCasFinder 1482180-1482221 42 CP051278 Salmonella phage ST-87, complete genome 25843-25884 2 0.952
CP030024_4 4.1|1482180|42|CP030024|CRISPRCasFinder 1482180-1482221 42 CP051288 Salmonella phage ST-29, complete genome 38685-38726 2 0.952
CP030024_4 4.1|1482180|42|CP030024|CRISPRCasFinder 1482180-1482221 42 CP051285 Salmonella phage ST-32, complete genome 31779-31820 2 0.952
CP030024_4 4.1|1482180|42|CP030024|CRISPRCasFinder 1482180-1482221 42 NC_014900 Salmonella phage ST160, complete genome 15102-15143 2 0.952
CP030024_4 4.1|1482180|42|CP030024|CRISPRCasFinder 1482180-1482221 42 CP051272 Salmonella phage SW-70, complete genome 35832-35873 2 0.952
CP030024_3 3.11|969627|32|CP030024|CRISPRCasFinder,CRT 969627-969658 32 NZ_CP032813 Escherichia coli strain ERL03-1416 plasmid pERL03-1416-2, complete sequence 54708-54739 4 0.875
CP030024_4 4.1|1482180|42|CP030024|CRISPRCasFinder 1482180-1482221 42 NC_016160 Escherichia phage HK75, complete genome 28592-28633 6 0.857
CP030024_4 4.1|1482180|42|CP030024|CRISPRCasFinder 1482180-1482221 42 NC_019705 Enterobacteria phage mEpX2, complete genome 29046-29087 6 0.857
CP030024_4 4.1|1482180|42|CP030024|CRISPRCasFinder 1482180-1482221 42 KY979108 Escherichia phage ECP1, complete genome 427-468 6 0.857
CP030024_4 4.1|1482180|42|CP030024|CRISPRCasFinder 1482180-1482221 42 NC_019719 Enterobacteria phage HK633, complete genome 31740-31781 6 0.857
CP030024_4 4.1|1482180|42|CP030024|CRISPRCasFinder 1482180-1482221 42 JF974339 Enterobacteria phage IME10, complete genome 9723-9764 6 0.857
CP030024_4 4.1|1482180|42|CP030024|CRISPRCasFinder 1482180-1482221 42 NC_005344 Enterobacteria phage Sf6, complete genome 28410-28451 6 0.857
CP030024_2 2.2|951420|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 951420-951451 32 NZ_CP016452 Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence 1032808-1032839 7 0.781
CP030024_2 2.8|951786|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 951786-951817 32 MN693026 Marine virus AFVG_117M72, complete genome 24435-24466 7 0.781
CP030024_2 2.10|951908|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 951908-951939 32 NC_016767 Erwinia phage PEp14, complete genome 12046-12077 7 0.781
CP030024_2 2.19|952458|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 952458-952489 32 NZ_CP021170 Paenibacillus bovis strain BD3526 plasmid unnamed1, complete sequence 47959-47990 7 0.781
CP030024_3 3.19|970116|32|CP030024|CRISPRCasFinder,CRT 970116-970147 32 KR093648 Moraxella phage Mcat24, complete genome 11348-11379 7 0.781
CP030024_3 3.19|970116|32|CP030024|CRISPRCasFinder,CRT 970116-970147 32 KR093648 Moraxella phage Mcat24, complete genome 11914-11945 7 0.781
CP030024_2 2.4|951542|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 951542-951573 32 NZ_LR134460 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence 60437-60468 8 0.75
CP030024_2 2.4|951542|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 951542-951573 32 NZ_AP014580 Burkholderia sp. RPE67 plasmid p2, complete sequence 360413-360444 8 0.75
CP030024_2 2.10|951908|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 951908-951939 32 NZ_CP025552 Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence 33549-33580 8 0.75
CP030024_2 2.11|951969|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 951969-952000 32 CP001770 Spirosoma linguale DSM 74 plasmid pSLIN01, complete sequence 145771-145802 8 0.75
CP030024_3 3.6|969322|32|CP030024|CRISPRCasFinder,CRT 969322-969353 32 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 312409-312440 8 0.75
CP030024_3 3.15|969872|32|CP030024|CRISPRCasFinder,CRT 969872-969903 32 NZ_CP045296 Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence 287242-287273 8 0.75
CP030024_3 3.23|970360|32|CP030024|CRISPRCasFinder,CRT 970360-970391 32 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 713251-713282 8 0.75
CP030024_3 3.23|970360|32|CP030024|CRISPRCasFinder,CRT 970360-970391 32 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 712366-712397 8 0.75
CP030024_3 3.23|970360|32|CP030024|CRISPRCasFinder,CRT 970360-970391 32 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 713238-713269 8 0.75
CP030024_3 3.23|970360|32|CP030024|CRISPRCasFinder,CRT 970360-970391 32 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 713257-713288 8 0.75
CP030024_3 3.23|970360|32|CP030024|CRISPRCasFinder,CRT 970360-970391 32 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 713235-713266 8 0.75
CP030024_2 2.2|951420|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 951420-951451 32 AY986977 Xanthomonas campestris pv. pelargonii phage Xp15, complete genome 47238-47269 9 0.719
CP030024_2 2.2|951420|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 951420-951451 32 NC_007024 Xanthomonas phage Xp15, complete genome 47238-47269 9 0.719
CP030024_2 2.7|951725|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 951725-951756 32 NC_015905 Borreliella bissettii DN127 plasmid cp32-6, complete sequence 9532-9563 9 0.719
CP030024_2 2.7|951725|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 951725-951756 32 NC_015909 Borreliella bissettii DN127 plasmid cp32-5, complete sequence 9531-9562 9 0.719
CP030024_2 2.10|951908|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 951908-951939 32 NZ_MK036885 Leclercia adecarboxylata strain 16005813 plasmid p16005813C, complete sequence 56020-56051 9 0.719
CP030024_2 2.12|952030|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 952030-952061 32 NZ_CP051686 Duganella sp. GN2-R2 plasmid unnamed1, complete sequence 45237-45268 9 0.719
CP030024_2 2.22|952641|32|CP030024|CRISPRCasFinder,CRT 952641-952672 32 NC_047851 Brevibacterium phage LuckyBarnes, complete genome 31262-31293 9 0.719
CP030024_3 3.5|969261|32|CP030024|CRISPRCasFinder,CRT 969261-969292 32 AP018399 Xanthomonas phage XacN1 DNA, complete genome 184880-184911 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 MK761195 Salmonella phage SF4, complete genome 21294-21325 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 MK761199 Salmonella phage SI2, complete genome 32559-32590 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 MT074481 Salmonella phage sidste, complete genome 28769-28800 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 MK761197 Salmonella phage SS4, complete genome 13374-13405 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 MT677934 Salmonella phage NBSal007, complete genome 16757-16788 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 MK972702 Salmonella phage SS5, complete genome 11333-11364 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 MK759883 Salmonella phage vB_SenS_SB15, complete genome 22660-22691 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 MK972706 Salmonella phage SS8, complete genome 3726-3757 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 MK578530 Salmonella phage vB_SenS_SB3, complete genome 22681-22712 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 MK931446 Salmonella phage Shelanagig, complete genome 23338-23369 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 MK770409 Salmonella phage SF1, complete genome 8845-8876 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 MK972703 Salmonella phage SS7, complete genome 9477-9508 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 MK972700 Salmonella phage SS1, complete genome 9964-9995 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 MK761196 Salmonella phage SF5, complete genome 26503-26534 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 MK761198 Salmonella phage SS10, complete genome 32376-32407 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 MF158037 Salmonella phage St162, complete genome 41350-41381 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 MF158037 Salmonella phage St162, complete genome 41606-41637 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 MK972691 Salmonella phage SI1, complete genome 19104-19135 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 NC_041991 Salmonella phage vB_SenS_AG11, complete genome 22623-22654 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 MK972701 Salmonella phage SS6, complete genome 22270-22301 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 MK972705 Salmonella phage SF2, complete genome 14311-14342 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 216014-216045 9 0.719
CP030024_3 3.10|969566|32|CP030024|CRISPRCasFinder,CRT 969566-969597 32 KT962832 Salmonella phage fSE1C, complete genome 31784-31815 9 0.719
CP030024_3 3.13|969750|32|CP030024|CRISPRCasFinder,CRT 969750-969781 32 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 192991-193022 9 0.719
CP030024_3 3.24|970421|32|CP030024|CRISPRCasFinder,CRT 970421-970452 32 NZ_MG266000 Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence 5501-5532 9 0.719
CP030024_2 2.2|951420|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 951420-951451 32 NZ_CP012101 Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence 271482-271513 10 0.688
CP030024_2 2.2|951420|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 951420-951451 32 NZ_CP020952 Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence 475651-475682 10 0.688
CP030024_2 2.2|951420|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 951420-951451 32 NZ_CP031072 Bacillus mycoides strain BPN401 plasmid pl395, complete sequence 119722-119753 10 0.688
CP030024_2 2.2|951420|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 951420-951451 32 NZ_CP020744 Bacillus mycoides strain Gnyt1 plasmid unnamed1, complete sequence 232616-232647 10 0.688
CP030024_2 2.2|951420|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 951420-951451 32 NC_018688 Bacillus thuringiensis MC28 plasmid pMC319, complete sequence 147891-147922 10 0.688
CP030024_2 2.2|951420|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 951420-951451 32 NZ_CP009691 Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence 163526-163557 10 0.688
CP030024_2 2.2|951420|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 951420-951451 32 CP037991 Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence 422132-422163 10 0.688
CP030024_2 2.16|952275|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 952275-952306 32 NZ_CP044072 Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence 99817-99848 10 0.688
CP030024_2 2.19|952458|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 952458-952489 32 NZ_KU254577 Pseudomonas aeruginosa strain HN39 plasmid pHN39-SIM, complete sequence 224438-224469 10 0.688
CP030024_2 2.19|952458|32|CP030024|PILER-CR,CRISPRCasFinder,CRT 952458-952489 32 NZ_CP010826 Thermus aquaticus Y51MC23 plasmid pTA78, complete sequence 18643-18674 10 0.688
CP030024_3 3.6|969322|32|CP030024|CRISPRCasFinder,CRT 969322-969353 32 NC_007974 Cupriavidus metallidurans CH34 megaplasmid, complete sequence 810485-810516 10 0.688
CP030024_3 3.6|969322|32|CP030024|CRISPRCasFinder,CRT 969322-969353 32 NZ_CP046333 Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3 2176123-2176154 10 0.688
CP030024_3 3.13|969750|32|CP030024|CRISPRCasFinder,CRT 969750-969781 32 NZ_CP053709 Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence 58448-58479 10 0.688
CP030024_3 3.13|969750|32|CP030024|CRISPRCasFinder,CRT 969750-969781 32 NZ_CP016618 Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence 501692-501723 10 0.688
CP030024_3 3.3|969139|32|CP030024|CRISPRCasFinder,CRT 969139-969170 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 704733-704764 11 0.656
CP030024_3 3.3|969139|32|CP030024|CRISPRCasFinder,CRT 969139-969170 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1427651-1427682 11 0.656

1. spacer 4.1|1482180|42|CP030024|CRISPRCasFinder matches to MW013502 (Salmonella virus L cI-40 13-am43, complete genome) position: , mismatch: 0, identity: 1.0

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	Protospacer
******************************************

2. spacer 4.1|1482180|42|CP030024|CRISPRCasFinder matches to NC_004348 (Enterobacteria phage ST64T, complete genome) position: , mismatch: 0, identity: 1.0

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	Protospacer
******************************************

3. spacer 4.1|1482180|42|CP030024|CRISPRCasFinder matches to MW013503 (Salmonella virus L cII-101, complete genome) position: , mismatch: 0, identity: 1.0

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	Protospacer
******************************************

4. spacer 4.1|1482180|42|CP030024|CRISPRCasFinder matches to AY052766 (Salmonella typhimurium bacteriophage ST64T, complete genome) position: , mismatch: 0, identity: 1.0

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	Protospacer
******************************************

5. spacer 4.1|1482180|42|CP030024|CRISPRCasFinder matches to MF188997 (Salmonella phage vB_SalP_PM43, complete genome) position: , mismatch: 0, identity: 1.0

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	Protospacer
******************************************

6. spacer 2.15|952214|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034699 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence) position: , mismatch: 1, identity: 0.969

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

7. spacer 2.15|952214|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034710 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence) position: , mismatch: 1, identity: 0.969

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

8. spacer 3.3|969139|32|CP030024|CRISPRCasFinder,CRT matches to NZ_CP039495 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000669 plasmid pCFSAN000669_2, complete sequence) position: , mismatch: 2, identity: 0.938

agaatattcaactccagcgggggaaagacgca	CRISPR spacer
agaatattcaactccagcgggaaaaagacgca	Protospacer
*********************..*********

9. spacer 3.3|969139|32|CP030024|CRISPRCasFinder,CRT matches to KC139516 (Salmonella phage FSL SP-016, partial genome) position: , mismatch: 2, identity: 0.938

agaatattcaactccagcgggggaaagacgca	CRISPR spacer
agaatattcaactccagcgggaaaaagacgca	Protospacer
*********************..*********

10. spacer 3.3|969139|32|CP030024|CRISPRCasFinder,CRT matches to NC_042346 (Salmonella virus BTP1 genome assembly, chromosome: BTP1) position: , mismatch: 2, identity: 0.938

agaatattcaactccagcgggggaaagacgca	CRISPR spacer
agaatattcaactccagcgggaaaaagacgca	Protospacer
*********************..*********

11. spacer 4.1|1482180|42|CP030024|CRISPRCasFinder matches to NC_011802 (Salmonella enterica bacteriophage SE1, complete genome) position: , mismatch: 2, identity: 0.952

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatgacgcggatcacagcgaatg	Protospacer
***************************** *******.****

12. spacer 4.1|1482180|42|CP030024|CRISPRCasFinder matches to CP051278 (Salmonella phage ST-87, complete genome) position: , mismatch: 2, identity: 0.952

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatgacgcggatcacagcgaatg	Protospacer
***************************** *******.****

13. spacer 4.1|1482180|42|CP030024|CRISPRCasFinder matches to CP051288 (Salmonella phage ST-29, complete genome) position: , mismatch: 2, identity: 0.952

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatgacgcggatcacagcgaatg	Protospacer
***************************** *******.****

14. spacer 4.1|1482180|42|CP030024|CRISPRCasFinder matches to CP051285 (Salmonella phage ST-32, complete genome) position: , mismatch: 2, identity: 0.952

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatgacgcggatcacagcgaatg	Protospacer
***************************** *******.****

15. spacer 4.1|1482180|42|CP030024|CRISPRCasFinder matches to NC_014900 (Salmonella phage ST160, complete genome) position: , mismatch: 2, identity: 0.952

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatgacgcggatcacagcgaatg	Protospacer
***************************** *******.****

16. spacer 4.1|1482180|42|CP030024|CRISPRCasFinder matches to CP051272 (Salmonella phage SW-70, complete genome) position: , mismatch: 2, identity: 0.952

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatgacgcggatcacagcgaatg	Protospacer
***************************** *******.****

17. spacer 3.11|969627|32|CP030024|CRISPRCasFinder,CRT matches to NZ_CP032813 (Escherichia coli strain ERL03-1416 plasmid pERL03-1416-2, complete sequence) position: , mismatch: 4, identity: 0.875

-ggcctcacatcggcgcccgctggtcacgacca	CRISPR spacer
tggcctc-cgtcagcgcccgctgctcacgacca	Protospacer
 ****** *.**.********** *********

18. spacer 4.1|1482180|42|CP030024|CRISPRCasFinder matches to NC_016160 (Escherichia phage HK75, complete genome) position: , mismatch: 6, identity: 0.857

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatggcgcggctctcagcggaga	Protospacer
***********************.******** ****..* .

19. spacer 4.1|1482180|42|CP030024|CRISPRCasFinder matches to NC_019705 (Enterobacteria phage mEpX2, complete genome) position: , mismatch: 6, identity: 0.857

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatggcgcggctctcagcggaga	Protospacer
***********************.******** ****..* .

20. spacer 4.1|1482180|42|CP030024|CRISPRCasFinder matches to KY979108 (Escherichia phage ECP1, complete genome) position: , mismatch: 6, identity: 0.857

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatggcgcggctctcagcggaga	Protospacer
***********************.******** ****..* .

21. spacer 4.1|1482180|42|CP030024|CRISPRCasFinder matches to NC_019719 (Enterobacteria phage HK633, complete genome) position: , mismatch: 6, identity: 0.857

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatggcgcggctctcagcggaga	Protospacer
***********************.******** ****..* .

22. spacer 4.1|1482180|42|CP030024|CRISPRCasFinder matches to JF974339 (Enterobacteria phage IME10, complete genome) position: , mismatch: 6, identity: 0.857

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatggcgcggctctcagcggaga	Protospacer
***********************.******** ****..* .

23. spacer 4.1|1482180|42|CP030024|CRISPRCasFinder matches to NC_005344 (Enterobacteria phage Sf6, complete genome) position: , mismatch: 6, identity: 0.857

gtccaacgcaaacaccagtaatgacgcggctcacagcaaatg	CRISPR spacer
gtccaacgcaaacaccagtaatggcgcggctctcagcggaga	Protospacer
***********************.******** ****..* .

24. spacer 2.2|951420|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 7, identity: 0.781

ccgggatccgtcatcggtcgtggttcactgca	CRISPR spacer
ccggtatccgtcatcggtcttggcgtgcagca	Protospacer
**** ************** ***. ..* ***

25. spacer 2.8|951786|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to MN693026 (Marine virus AFVG_117M72, complete genome) position: , mismatch: 7, identity: 0.781

atgcggag---aaaatggaatcagagctacaggaa	CRISPR spacer
---tggagctcaaaatggaataagagttacaggag	Protospacer
   .****   ********** ****.*******.

26. spacer 2.10|951908|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to NC_016767 (Erwinia phage PEp14, complete genome) position: , mismatch: 7, identity: 0.781

gtttcagcgtggagctgcatgatgttcgcgcc	CRISPR spacer
gctttgcggtggcgctgcatgatggtcgcgcc	Protospacer
*.**..  **** *********** *******

27. spacer 2.19|952458|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021170 (Paenibacillus bovis strain BD3526 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

cgtttctggcgggggtagggaacgcccagaaa	CRISPR spacer
tgctgcgggctggggtagggaacgctcagata	Protospacer
.*.* * *** **************.**** *

28. spacer 3.19|970116|32|CP030024|CRISPRCasFinder,CRT matches to KR093648 (Moraxella phage Mcat24, complete genome) position: , mismatch: 7, identity: 0.781

ttagccatccccataccaaagttaa--agtcgta	CRISPR spacer
ccagccatcaccataccaatgttaaatagtct--	Protospacer
..******* ********* *****  ****   

29. spacer 3.19|970116|32|CP030024|CRISPRCasFinder,CRT matches to KR093648 (Moraxella phage Mcat24, complete genome) position: , mismatch: 7, identity: 0.781

ttagccatccccataccaaagttaa--agtcgta	CRISPR spacer
ccagccatcaccataccaatgttaaatagtct--	Protospacer
..******* ********* *****  ****   

30. spacer 2.4|951542|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 8, identity: 0.75

gacgcgtcgctcgcgtccggccagcgtgcagg	CRISPR spacer
cgcgcgtcgctcgcgcccggccagggtttcgc	Protospacer
 .*************.******** ** . * 

31. spacer 2.4|951542|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014580 (Burkholderia sp. RPE67 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75

gacgcgtcgctcgcgtccggccagcgtgcagg	CRISPR spacer
ttcgcgtcgatcgcgcccggccagcacgaacg	Protospacer
  ******* *****.*********..* * *

32. spacer 2.10|951908|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025552 (Streptomyces rimosus strain WT5260 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

gtttcagcgtggagctgcatgatgttcgcgcc	CRISPR spacer
cggccggcgtggagctgctggatgttcgcggc	Protospacer
   .*.************  ********** *

33. spacer 2.11|951969|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to CP001770 (Spirosoma linguale DSM 74 plasmid pSLIN01, complete sequence) position: , mismatch: 8, identity: 0.75

cggaggatggaatatttccgaggctggcgatt	CRISPR spacer
tgggagatggaatacttccggggctggcaacc	Protospacer
.**..*********.*****.*******.*..

34. spacer 3.6|969322|32|CP030024|CRISPRCasFinder,CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 8, identity: 0.75

tgcggatttaccgtcggcaaaaccg-cgctgat	CRISPR spacer
gcaggatataccgccggcaaaaccgccaccga-	Protospacer
   **** *****.*********** *.*.** 

35. spacer 3.15|969872|32|CP030024|CRISPRCasFinder,CRT matches to NZ_CP045296 (Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cgtgggggcggctgattgatgatgcggagaaa	CRISPR spacer
cgtgggagcggctgattgatcatgcccatttg	Protospacer
******.************* ****  *   .

36. spacer 3.23|970360|32|CP030024|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

agcgccgatccggtggtgtccaaca-caacgaa	CRISPR spacer
gacgccgagccggtggtggccaacagcgatgt-	Protospacer
..****** ********* ****** *.*.*  

37. spacer 3.23|970360|32|CP030024|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75

agcgccgatccggtggtgtccaaca-caacgaa	CRISPR spacer
gacgccgagccggtggtggccaacagcgatgt-	Protospacer
..****** ********* ****** *.*.*  

38. spacer 3.23|970360|32|CP030024|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

agcgccgatccggtggtgtccaaca-caacgaa	CRISPR spacer
gacgccgagccggtggtggccaacagcgatgt-	Protospacer
..****** ********* ****** *.*.*  

39. spacer 3.23|970360|32|CP030024|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

agcgccgatccggtggtgtccaaca-caacgaa	CRISPR spacer
gacgccgagccggtggtggccaacagcgatgt-	Protospacer
..****** ********* ****** *.*.*  

40. spacer 3.23|970360|32|CP030024|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

agcgccgatccggtggtgtccaaca-caacgaa	CRISPR spacer
gacgccgagccggtggtggccaacagcgatgt-	Protospacer
..****** ********* ****** *.*.*  

41. spacer 2.2|951420|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to AY986977 (Xanthomonas campestris pv. pelargonii phage Xp15, complete genome) position: , mismatch: 9, identity: 0.719

ccgggatccgtcatcggtcgtggttcactgca	CRISPR spacer
ttgcgatccatcatcggtcgaggttcaaacga	Protospacer
..* *****.********** ******    *

42. spacer 2.2|951420|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to NC_007024 (Xanthomonas phage Xp15, complete genome) position: , mismatch: 9, identity: 0.719

ccgggatccgtcatcggtcgtggttcactgca	CRISPR spacer
ttgcgatccatcatcggtcgaggttcaaacga	Protospacer
..* *****.********** ******    *

43. spacer 2.7|951725|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to NC_015905 (Borreliella bissettii DN127 plasmid cp32-6, complete sequence) position: , mismatch: 9, identity: 0.719

cgtataactattttgcgttgtcgtgtgattca	CRISPR spacer
cccataagtatttttcgttgtcgtgttgaata	Protospacer
* .**** ****** *********** .  .*

44. spacer 2.7|951725|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to NC_015909 (Borreliella bissettii DN127 plasmid cp32-5, complete sequence) position: , mismatch: 9, identity: 0.719

cgtataactattttgcgttgtcgtgtgattca	CRISPR spacer
cccataagtatttttcgttgtcgtgttgaata	Protospacer
* .**** ****** *********** .  .*

45. spacer 2.10|951908|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MK036885 (Leclercia adecarboxylata strain 16005813 plasmid p16005813C, complete sequence) position: , mismatch: 9, identity: 0.719

gtttcagcgtggagctgcatgatgttcgcgcc	CRISPR spacer
taactattatggagccgcatgatgttcgcgcc	Protospacer
   ..* ..******.****************

46. spacer 2.12|952030|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051686 (Duganella sp. GN2-R2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ccccgatagcgacgcttctgtagtcactggca	CRISPR spacer
gtccgatagcgacacttcggtagtcaggcgtg	Protospacer
 .***********.**** *******   *..

47. spacer 2.22|952641|32|CP030024|CRISPRCasFinder,CRT matches to NC_047851 (Brevibacterium phage LuckyBarnes, complete genome) position: , mismatch: 9, identity: 0.719

ccggatgaaaacgcctacccggaagactacga	CRISPR spacer
gcagatgaaatcgcctaccgggaagagctggc	Protospacer
 *.******* ******** ****** .  * 

48. spacer 3.5|969261|32|CP030024|CRISPRCasFinder,CRT matches to AP018399 (Xanthomonas phage XacN1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

agcgattcatgcagcgtgatttcacatccgta	CRISPR spacer
tacgattcttccagcgtgatttcacgtagggc	Protospacer
 .****** * **************.*  *  

49. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to MK761195 (Salmonella phage SF4, complete genome) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
cgaaggtaattaccccatccttaccgccacta	Protospacer
*.  . ...************.**********

50. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to MK761199 (Salmonella phage SI2, complete genome) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
cgaaggtaattaccccatccttaccgccacta	Protospacer
*.  . ...************.**********

51. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to MT074481 (Salmonella phage sidste, complete genome) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
cgaaggtaattaccccatccttaccgccacta	Protospacer
*.  . ...************.**********

52. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to MK761197 (Salmonella phage SS4, complete genome) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
cgaaggtaattaccccatccttaccgccacta	Protospacer
*.  . ...************.**********

53. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to MT677934 (Salmonella phage NBSal007, complete genome) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
cgaaggtaattaccccatccttaccgccacta	Protospacer
*.  . ...************.**********

54. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to MK972702 (Salmonella phage SS5, complete genome) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
cgaaggtaattaccccatccttaccgccacta	Protospacer
*.  . ...************.**********

55. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to MK759883 (Salmonella phage vB_SenS_SB15, complete genome) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
cgaaggtaattaccccatccttaccgccacta	Protospacer
*.  . ...************.**********

56. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to MK972706 (Salmonella phage SS8, complete genome) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
cgaaggtaattaccccatccttaccgccacta	Protospacer
*.  . ...************.**********

57. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to MK578530 (Salmonella phage vB_SenS_SB3, complete genome) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
cgaaggtaattaccccatccttaccgccacta	Protospacer
*.  . ...************.**********

58. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to MK931446 (Salmonella phage Shelanagig, complete genome) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
cgaaggtaattaccccatccttaccgccacta	Protospacer
*.  . ...************.**********

59. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to MK770409 (Salmonella phage SF1, complete genome) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
cgaaggtaattaccccatccttaccgccacta	Protospacer
*.  . ...************.**********

60. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to MK972703 (Salmonella phage SS7, complete genome) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
cgaaggtaattaccccatccttaccgccacta	Protospacer
*.  . ...************.**********

61. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to MK972700 (Salmonella phage SS1, complete genome) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
cgaaggtaattaccccatccttaccgccacta	Protospacer
*.  . ...************.**********

62. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to MK761196 (Salmonella phage SF5, complete genome) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
cgaaggtaattaccccatccttaccgccacta	Protospacer
*.  . ...************.**********

63. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to MK761198 (Salmonella phage SS10, complete genome) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
cgaaggtaattaccccatccttaccgccacta	Protospacer
*.  . ...************.**********

64. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to MF158037 (Salmonella phage St162, complete genome) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
cgaaggtaattaccccatccttaccgccacta	Protospacer
*.  . ...************.**********

65. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to MF158037 (Salmonella phage St162, complete genome) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
cgaaggtaattaccccatccttaccgccacta	Protospacer
*.  . ...************.**********

66. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to MK972691 (Salmonella phage SI1, complete genome) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
cgaaggtaattaccccatccttaccgccacta	Protospacer
*.  . ...************.**********

67. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to NC_041991 (Salmonella phage vB_SenS_AG11, complete genome) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
cgaaggtaattaccccatccttaccgccacta	Protospacer
*.  . ...************.**********

68. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to MK972701 (Salmonella phage SS6, complete genome) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
cgaaggtaattaccccatccttaccgccacta	Protospacer
*.  . ...************.**********

69. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to MK972705 (Salmonella phage SF2, complete genome) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
cgaaggtaattaccccatccttaccgccacta	Protospacer
*.  . ...************.**********

70. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
cgccttcggttcccccatcctcaccgtcaacg	Protospacer
*... ****** **************.** ..

71. spacer 3.10|969566|32|CP030024|CRISPRCasFinder,CRT matches to KT962832 (Salmonella phage fSE1C, complete genome) position: , mismatch: 9, identity: 0.719

cattatcggttaccccatcctcaccgccacta	CRISPR spacer
caaaggtaattaccccatccttaccaccacta	Protospacer
**  . ...************.***.******

72. spacer 3.13|969750|32|CP030024|CRISPRCasFinder,CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

acgtgctcaacgagtatctggtgatcccgttc	CRISPR spacer
aactgcgcaacgagtatctggcgatctagagg	Protospacer
*  *** **************.****. *   

73. spacer 3.24|970421|32|CP030024|CRISPRCasFinder,CRT matches to NZ_MG266000 (Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence) position: , mismatch: 9, identity: 0.719

gttgggttgcatagatgacacgcttataaata	CRISPR spacer
gaattatggcatagatgacatgattataaatt	Protospacer
*    .* ************.* ******** 

74. spacer 2.2|951420|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 10, identity: 0.688

ccgggatccgtcatcggtcgtggttcactgca	CRISPR spacer
ataagatccatcatcggtcgcggttcattcgc	Protospacer
 ...*****.**********.******.*   

75. spacer 2.2|951420|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020952 (Rhizobium sp. CIAT894 plasmid pRheCIAT894e, complete sequence) position: , mismatch: 10, identity: 0.688

ccgggatccgtcatcggtcgtggttcactgca	CRISPR spacer
gtcgcggccgtcatcggtcttggttcaatggg	Protospacer
 . * . ************ ******* ** .

76. spacer 2.2|951420|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 10, identity: 0.688

ccgggatccgtcatcggtcgtggttcactgca	CRISPR spacer
agaagatccatcatcggtcgcggttcattcgc	Protospacer
  ..*****.**********.******.*   

77. spacer 2.2|951420|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020744 (Bacillus mycoides strain Gnyt1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ccgggatccgtcatcggtcgtggttcactgca	CRISPR spacer
agaagatccatcatcggtcgcggttcattcgc	Protospacer
  ..*****.**********.******.*   

78. spacer 2.2|951420|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to NC_018688 (Bacillus thuringiensis MC28 plasmid pMC319, complete sequence) position: , mismatch: 10, identity: 0.688

ccgggatccgtcatcggtcgtggttcactgca	CRISPR spacer
agaagatccatcatcggtcgcggttcattcgc	Protospacer
  ..*****.**********.******.*   

79. spacer 2.2|951420|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009691 (Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence) position: , mismatch: 10, identity: 0.688

ccgggatccgtcatcggtcgtggttcactgca	CRISPR spacer
agaagatccatcatcggtcgcggttcattcgc	Protospacer
  ..*****.**********.******.*   

80. spacer 2.2|951420|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to CP037991 (Bacillus mycoides strain TH26 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ccgggatccgtcatcggtcgtggttcactgca	CRISPR spacer
agaagatccatcatcggtcgcggttcattcgc	Protospacer
  ..*****.**********.******.*   

81. spacer 2.16|952275|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044072 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatcgagagtgcgaagaggcagaacgggca	CRISPR spacer
gaaggtggcagtgccaagagacagaacgggca	Protospacer
  .. .*. ***** *****.***********

82. spacer 2.19|952458|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KU254577 (Pseudomonas aeruginosa strain HN39 plasmid pHN39-SIM, complete sequence) position: , mismatch: 10, identity: 0.688

cgtttctggcgggggtagggaacgcccagaaa	CRISPR spacer
agggtctggcgggggtagggaagtccccaggt	Protospacer
 *  ******************  *** ... 

83. spacer 2.19|952458|32|CP030024|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010826 (Thermus aquaticus Y51MC23 plasmid pTA78, complete sequence) position: , mismatch: 10, identity: 0.688

cgtttctggcgggggtagggaacgcccagaaa	CRISPR spacer
gctttatggcgggggtaaggaacgctgattcc	Protospacer
  *** ***********.*******. *    

84. spacer 3.6|969322|32|CP030024|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688

tgcggatttaccgtcggcaaaaccgcgctgat	CRISPR spacer
ccgttgtccaccgtcgccaaaatcgcgctgat	Protospacer
.    .*..******* *****.*********

85. spacer 3.6|969322|32|CP030024|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.688

tgcggatttaccgtcggcaaaaccgcgctgat	CRISPR spacer
ccgttgtccaccgtcgccaaaatcgcgctgat	Protospacer
.    .*..******* *****.*********

86. spacer 3.13|969750|32|CP030024|CRISPRCasFinder,CRT matches to NZ_CP053709 (Acetobacteraceae bacterium strain PAMC 26569 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

acgtgctcaacgagtatctggtgatcccgttc	CRISPR spacer
cagtgctcgacgagtatctggagatgggcgac	Protospacer
  ******.************ ***      *

87. spacer 3.13|969750|32|CP030024|CRISPRCasFinder,CRT matches to NZ_CP016618 (Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

acgtgctcaacgagtatctggtgatcccgttc	CRISPR spacer
tcccgctcaacgagtatctggaaatcctcgcg	Protospacer
 * .***************** .****.  . 

88. spacer 3.3|969139|32|CP030024|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.656

agaatattcaactccagcgggggaaagacgca	CRISPR spacer
tcggcgagcaactccagcggggggaaggcgcc	Protospacer
  ....  ***************.***.*** 

89. spacer 3.3|969139|32|CP030024|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 11, identity: 0.656

agaatattcaactccagcgggggaaagacgca	CRISPR spacer
tcggcgagcaactccagcggggggaaggcgcc	Protospacer
  ....  ***************.***.*** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1316388 : 1336306 16 Enterobacter_phage(53.33%) tail NA
DBSCAN-SWA_2 1340498 : 1345590 9 Salmonella_phage(57.14%) holin NA
DBSCAN-SWA_3 1463834 : 1512798 74 Salmonella_phage(70.15%) portal,terminase,coat,lysis,integrase,tail,protease attL 1492067:1492083|attR 1513080:1513096
DBSCAN-SWA_4 1752258 : 1761429 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_5 1926557 : 1937945 12 Enterobacteria_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage