Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP030195 Salmonella enterica strain SA20080453 plasmid pSA20080453.1, complete sequence 1 crisprs NA 0 1 0 0
CP030194 Salmonella enterica strain SA20080453 chromosome, complete genome 1 crisprs WYL,csa3,cas3,DEDDh,DinG 1 2 6 0

Results visualization

1. CP030195
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030195_1 116-235 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP030195 Salmonella enterica strain SA20080453 plasmid pSA20080453.1, complete sequence 159-192 0 1.0
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_KX518744 Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence 63874-63907 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP041286 Escherichia coli strain 54 plasmid p54-tetX, complete sequence 64169-64202 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_KU321583 Escherichia coli strain E80 plasmid pE80, complete sequence 38215-38248 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_KT990220 Escherichia coli strain 42-2 plasmid p42-2, complete sequence 37006-37039 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP010164 Escherichia coli strain H2 plasmid A, complete sequence 20751-20784 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP019647 Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence 239581-239614 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP022964 Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal1, complete sequence 30266-30299 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP024467 Shigella dysenteriae strain BU53M1 plasmid unnamed1, complete sequence 17630-17663 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_LS999563 Escherichia coli isolate EC-TO143 plasmid 4, complete sequence 16611-16644 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_LS999563 Escherichia coli isolate EC-TO143 plasmid 4, complete sequence 53074-53107 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP019284 Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence 32601-32634 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP047093 Salmonella sp. S13 plasmid pS13-4, complete sequence 1762-1795 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP051432 Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence 23725-23758 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP046002 Escherichia coli strain 1916D6 plasmid p1916D6-2, complete sequence 35337-35370 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP045188 Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence 26770-26803 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 41390-41423 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 60962-60995 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP032386 Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_2, complete sequence 39391-39424 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP032389 Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_2, complete sequence 9889-9922 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_LT904873 Salmonella enterica subsp. enterica serovar Typhi strain ERL11909 plasmid 2 5696-5729 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_KT754163 Shigella dysenteriae 1 strain A5468 plasmid pA5468, complete sequence 12265-12298 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP033383 Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-2, complete sequence 7366-7399 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP020836 Escherichia coli strain CFSAN051542 plasmid pCFSAN051542, complete sequence 20407-20440 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP038140 Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence 93494-93527 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP043216 Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.2-IncX1, complete sequence 32193-32226 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP042617 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence 25537-25570 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP031361 Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p2, complete sequence 27033-27066 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP044153 Shigella flexneri strain AR-0425 plasmid pAR-0425-1, complete sequence 25749-25782 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP040929 Escherichia coli strain YY76-1 plasmid pYY76-1-2, complete sequence 2187-2220 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP033386 Salmonella enterica subsp. enterica strain CFSA1007 plasmid pCFSA1007-2, complete sequence 34721-34754 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP041177 Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence 4942-4975 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP034761 Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence 47580-47613 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP050707 Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence 14631-14664 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP047339 Klebsiella pneumoniae strain 2019036D plasmid p2019036D-35kb, complete sequence 28949-28982 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NC_010860 Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSE34, complete sequence 32623-32656 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP022453 Salmonella enterica subsp. enterica serovar Indiana strain D90 plasmid pD90-3, complete sequence 5893-5926 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP024153 Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence 53536-53569 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP030208 Salmonella enterica strain SA19992307 plasmid pSA19992307.1, complete sequence 39815-39848 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP005994 Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 plasmid unnamed, complete sequence 30028-30061 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP032450 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 plasmid pSDU1-USMARC-69838, complete sequence 29110-29143 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP010155 Escherichia coli strain D9 plasmid C, complete genome 14497-14530 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP050174 Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence 58667-58700 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP029061 Escherichia coli strain FORC_081 plasmid pFORC_081_4, complete sequence 10786-10819 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP042589 Escherichia coli strain PK6 plasmid pRHEcCUB-1, complete sequence 29459-29492 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP025677 Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence 79278-79311 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP041453 Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence 54169-54202 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 MN816373 Escherichia coli strain A127 plasmid pA127-X1, complete sequence 29459-29492 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP052879 Escherichia coli strain C21 plasmid pC21-2, complete sequence 61147-61180 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP033379 Escherichia coli strain L73 plasmid pL73-2, complete sequence 99797-99830 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 88012-88045 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP050724 Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-1, complete sequence 41949-41982 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP047573 Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence 53619-53652 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NC_019106 Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_77, complete sequence 32551-32584 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP010127 Escherichia coli strain C8 plasmid B, complete genome 33248-33281 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP027138 Escherichia coli strain AR_0369 plasmid unnamed2 85971-86004 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP022072 Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed2, complete sequence 18650-18683 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP043935 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence 20398-20431 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP043935 Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence 147056-147089 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP045998 Escherichia coli strain 1916D18 plasmid p1916D18-1, complete sequence 35339-35372 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP032394 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_2, complete sequence 32800-32833 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NC_019256 Shigella sp. LN126 plasmid pLN126_33, complete sequence 2112-2145 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 MH884649 Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence 16816-16849 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 MH884651 Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence 68260-68293 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 MH229869 Escherichia coli plasmid pKANJ7, complete sequence 90-123 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP050713 Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-1, complete sequence 33434-33467 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP041439 Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence 96892-96925 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP041443 Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence 63333-63366 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_MK461931 Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence 238663-238696 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_MK656937 Escherichia coli strain T3 plasmid pT3, complete sequence 37880-37913 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_MK731977 Escherichia coli strain ENV103 plasmid pSGMCR103, complete sequence 22155-22188 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_MK673546 Salmonella enterica subsp. enterica serovar Typhimurium strain GDD27-24 plasmid pGDD27-24, complete sequence 28203-28236 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP032447 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU1-USMARC-69840, complete sequence 18380-18413 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_MH179305 Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence 118004-118037 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_MH179305 Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence 151970-152003 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_MH287085 Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence 243053-243086 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_MH287084 Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence 241163-241196 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP025558 Salmonella enterica subsp. enterica serovar Enteritidis strain PIR00532 plasmid p2PIR00532, complete sequence 11939-11972 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 MT219825 Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence 90443-90476 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 MT219826 Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence 43726-43759 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_MG904998 Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence 48918-48951 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_MG197491 Escherichia coli strain FKU92 plasmid pHNFKU92, complete sequence 33352-33385 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_MG197498 Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence 58347-58380 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_MG197503 Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence 61256-61289 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_MG197495 Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence 61256-61289 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_MF589339 Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence 27964-27997 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_MG197502 Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence 61256-61289 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 MT219818 Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence 43736-43769 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 MT219820 Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence 80789-80822 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 MT219822 Escherichia coli strain RF14-1 plasmid pRF14-1_50k_tetX, complete sequence 38970-39003 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 MT219823 Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence 73817-73850 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NC_023323 Escherichia coli ACN001 plasmid pACN001-A, complete sequence 18865-18898 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 MF554637 uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence 14942-14975 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP016575 Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 plasmid pAMR588-04-00435_37, complete sequence 296-329 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP020060 Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence 30572-30605 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP032994 Escherichia coli strain W5-6 plasmid p2_W5-6, complete sequence 10049-10082 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 MN783746 Escherichia coli plasmid pIncX1_p1, complete sequence 5290-5323 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_KX815983 Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence 40397-40430 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_KU254580 Escherichia coli strain YD786 plasmid pYD786-3, complete sequence 25507-25540 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP042633 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence 38916-38949 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP032392 Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_2, complete sequence 67739-67772 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP019272 Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence 35028-35061 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP053728 Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence 69102-69135 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP037995 Salmonella enterica subsp. enterica serovar Brancaster strain sg_ww281 plasmid psg_ww281 7255-7288 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP053740 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncX1, complete sequence 9971-10004 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP016580 Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-006 plasmid pSH13-006_37, complete sequence 23703-23736 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP046001 Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence 49989-50022 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP021103 Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence 56470-56503 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP029182 Escherichia coli strain H9Ecoli plasmid p3-H9, complete sequence 2302-2335 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 MN086778 Escherichia coli plasmid p16EC-IncN, complete sequence 90173-90206 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP053047 Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-tetX4, complete sequence 9874-9907 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP014974 Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY3-1898, complete sequence 295-328 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP032397 Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence 220331-220364 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP035774 Klebsiella pneumoniae strain R46 plasmid pR46-27, complete sequence 12757-12790 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP044182 Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-1, complete sequence 25543-25576 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP042608 Escherichia coli strain NCYU-29-19 plasmid pNCYU-29-19-2_MCR3, complete sequence 7171-7204 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 MK461930 Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence 45261-45294 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NC_019046 Escherichia coli plasmid pNMEC31_31, complete sequence 31361-31394 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP047460 Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence 89191-89224 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP047466 Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence 30748-30781 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP035315 Escherichia coli strain D72 plasmid pD72-IncX1, complete sequence 28493-28526 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP050748 Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-3, complete sequence 5878-5911 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NC_024961 Escherichia coli plasmid pIS15_43, strain ISI5, complete sequence 905-938 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NC_021842 Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_02, complete sequence 4017-4050 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_LT985261 Escherichia coli strain 657 plasmid RCS50_p, complete sequence 42585-42618 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_AP019678 Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-3, complete sequence 49115-49148 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP009074 Escherichia coli ATCC 25922 plasmid unnamed, complete sequence 21137-21170 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP010168 Escherichia coli strain H3 plasmid A, complete genome 25682-25715 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NC_010378 Escherichia coli plasmid pOLA52, complete sequence 34562-34595 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 CP016512 Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 plasmid pSH14-028_37, complete sequence 23704-23737 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP016529 Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_42, complete sequence 23704-23737 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP016518 Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_37, complete sequence 23705-23738 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP032988 Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence 50710-50743 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP017633 Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence 23885-23918 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP012922 Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_37, complete sequence 23704-23737 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP033093 Escherichia coli strain CP53 plasmid pCP53-38k, complete sequence 19532-19565 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP012926 Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_37, complete sequence 37369-37402 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP023360 Escherichia coli strain 1943 plasmid p54, complete sequence 52726-52759 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 CP043734 Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence 37807-37840 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP039600 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014867 plasmid p12-6334.1, complete sequence 32872-32905 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP030283 Escherichia coli strain E308 plasmid pLKSZ02, complete sequence 49947-49980 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NC_011204 Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 plasmid pCT02021853_74, complete sequence 70648-70681 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NC_017624 Salmonella enterica subsp. enterica serovar Heidelberg str. B182 plasmid pB182_37, complete sequence 23689-23722 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP050710 Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-1, complete sequence 15569-15602 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP024290 Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed1, complete sequence 33653-33686 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP048777 Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-X, complete sequence 1446-1479 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP041631 Escherichia coli strain PE15 plasmid pPE15-27K, complete sequence 4799-4832 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP050773 Salmonella enterica subsp. enterica serovar Indiana strain SI102 plasmid pSI102-2, complete sequence 30707-30740 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP041444 Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence 38005-38038 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP019180 Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence 24566-24599 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP050765 Salmonella enterica subsp. enterica serovar Indiana strain SI111 plasmid pSI111-1, complete sequence 6593-6626 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NC_010422 Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1115, complete sequence 59434-59467 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP050759 Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-2, complete sequence 5734-5767 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_AP022652 Escherichia coli strain 09-02E plasmid p2-09-02E, complete sequence 295-328 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP024136 Escherichia coli strain 14EC017 plasmid p14EC017b, complete sequence 79478-79511 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_LT985315 Escherichia coli strain ECOR 70 plasmid RCS99_p, complete sequence 47119-47152 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 MN436006 Escherichia coli strain JS1-EC05 plasmid pEC05-X4, complete sequence 27492-27525 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 MN436007 Escherichia coli strain JS3-EC12 plasmid pEC12-X4, complete sequence 27131-27164 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_MK360096 Salmonella enterica strain 13-SA02717 plasmid pSE13-SA02717, complete sequence 44664-44697 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP045839 Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence 48284-48317 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP032381 Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU2-USMARC-69807, complete sequence 12454-12487 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_MG825381 Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence 43402-43435 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 MT197111 Escherichia coli strain RB3-1 plasmid pRB3-1_31K_tetX, complete sequence 12897-12930 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 MT219817 Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence 59284-59317 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 MT219819 Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence 118931-118964 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 MT219821 Escherichia coli strain RF45-1 plasmid pRF45-1_31k_tetX, complete sequence 3734-3767 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_MG288677 Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence 29004-29037 1 0.971
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 CP031285 Escherichia fergusonii strain 40A plasmid p46_40A, complete sequence 9827-9860 2 0.941
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP022502 Salmonella enterica subsp. enterica serovar Kentucky str. SA20030505 plasmid unnamed2, complete sequence 19165-19198 2 0.941
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP022502 Salmonella enterica subsp. enterica serovar Kentucky str. SA20030505 plasmid unnamed2, complete sequence 66613-66646 2 0.941
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP033353 Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence 78450-78483 3 0.912
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP050780 Salmonella enterica subsp. enterica serovar Indiana strain SI85 plasmid pSI85-1, complete sequence 203947-203980 3 0.912
CP030195_1 1.1|159|34|CP030195|CRISPRCasFinder 159-192 34 NZ_CP044292 Escherichia coli strain P43A plasmid pP43A-1, complete sequence 44259-44292 5 0.853

1. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP030195 (Salmonella enterica strain SA20080453 plasmid pSA20080453.1, complete sequence) position: , mismatch: 0, identity: 1.0

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtgattttcatgaaaggtggatggctgcgcac	Protospacer
**********************************

2. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_KX518744 (Escherichia coli strain HYEC7 plasmid pHYEC7-110, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

3. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP041286 (Escherichia coli strain 54 plasmid p54-tetX, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

4. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_KU321583 (Escherichia coli strain E80 plasmid pE80, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

5. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_KT990220 (Escherichia coli strain 42-2 plasmid p42-2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

6. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP010164 (Escherichia coli strain H2 plasmid A, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

7. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP019647 (Salmonella enterica subsp. enterica serovar Typhimurium strain TW-Stm6 plasmid pSTM6-275, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

8. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP022964 (Salmonella enterica subsp. enterica serovar Pullorum strain QJ-2D-Sal plasmid pQJDsal1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

9. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP024467 (Shigella dysenteriae strain BU53M1 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

10. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_LS999563 (Escherichia coli isolate EC-TO143 plasmid 4, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

11. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_LS999563 (Escherichia coli isolate EC-TO143 plasmid 4, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

12. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP019284 (Escherichia coli strain 13P484A plasmid p13P484A-4, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

13. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP047093 (Salmonella sp. S13 plasmid pS13-4, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

14. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP051432 (Escherichia sp. SCLE84 plasmid pSCLE2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

15. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP046002 (Escherichia coli strain 1916D6 plasmid p1916D6-2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

16. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP045188 (Escherichia coli strain NT1F31 plasmid pNT1F31-tetX4, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

17. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

18. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

19. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP032386 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N53043 plasmid pN53043_2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

20. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP032389 (Salmonella enterica subsp. enterica serovar Dublin strain CVM N45955 plasmid pN45955_2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

21. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_LT904873 (Salmonella enterica subsp. enterica serovar Typhi strain ERL11909 plasmid 2) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

22. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_KT754163 (Shigella dysenteriae 1 strain A5468 plasmid pA5468, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

23. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP033383 (Salmonella enterica subsp. enterica strain CFSA300 plasmid pCFSA300-2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

24. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP020836 (Escherichia coli strain CFSAN051542 plasmid pCFSAN051542, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

25. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP038140 (Escherichia coli strain G3X16-2 plasmid pG3X16-2-3, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

26. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP043216 (Salmonella enterica subsp. enterica serovar Heidelberg strain SL-312 plasmid pET8.2-IncX1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

27. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP042617 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

28. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP031361 (Salmonella enterica subsp. enterica serovar Heidelberg strain 5 plasmid p2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

29. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP044153 (Shigella flexneri strain AR-0425 plasmid pAR-0425-1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

30. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP040929 (Escherichia coli strain YY76-1 plasmid pYY76-1-2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

31. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP033386 (Salmonella enterica subsp. enterica strain CFSA1007 plasmid pCFSA1007-2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

32. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP041177 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

33. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP034761 (Klebsiella pneumoniae strain NB5306 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

34. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP050707 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

35. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP047339 (Klebsiella pneumoniae strain 2019036D plasmid p2019036D-35kb, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

36. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NC_010860 (Salmonella enterica subsp. enterica serovar Enteritidis plasmid pSE34, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

37. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP022453 (Salmonella enterica subsp. enterica serovar Indiana strain D90 plasmid pD90-3, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

38. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP024153 (Escherichia coli strain 14EC033 plasmid p14EC033f, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

39. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP030208 (Salmonella enterica strain SA19992307 plasmid pSA19992307.1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

40. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP005994 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

41. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP032450 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69838 plasmid pSDU1-USMARC-69838, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

42. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP010155 (Escherichia coli strain D9 plasmid C, complete genome) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

43. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP050174 (Escherichia coli strain STB20-1 plasmid pSTB20-1T, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

44. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP029061 (Escherichia coli strain FORC_081 plasmid pFORC_081_4, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

45. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP042589 (Escherichia coli strain PK6 plasmid pRHEcCUB-1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

46. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP025677 (Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

47. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP041453 (Escherichia coli strain YPE3 plasmid pYPE3-92k-tetX4, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

48. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to MN816373 (Escherichia coli strain A127 plasmid pA127-X1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

49. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP052879 (Escherichia coli strain C21 plasmid pC21-2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

50. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP033379 (Escherichia coli strain L73 plasmid pL73-2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

51. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

52. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP050724 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE74 plasmid pSE74-1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

53. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP047573 (Escherichia coli strain 2EC1 plasmid p2EC1-2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

54. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NC_019106 (Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_77, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

55. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP010127 (Escherichia coli strain C8 plasmid B, complete genome) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

56. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP027138 (Escherichia coli strain AR_0369 plasmid unnamed2) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

57. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP022072 (Salmonella enterica subsp. enterica serovar Typhimurium strain FDAARGOS_321 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

58. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

59. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP043935 (Klebsiella pneumoniae strain 555 plasmid pSCKLB555-3, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

60. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP045998 (Escherichia coli strain 1916D18 plasmid p1916D18-1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

61. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP032394 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

62. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NC_019256 (Shigella sp. LN126 plasmid pLN126_33, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

63. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to MH884649 (Salmonella sp. strain Sa21 plasmid pSa21-IncX1-28K, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

64. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to MH884651 (Salmonella sp. strain Sa21 plasmid pSa21-TC-CIP, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

65. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to MH229869 (Escherichia coli plasmid pKANJ7, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

66. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP050713 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE104 plasmid pSE104-1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

67. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP041439 (Escherichia coli strain YPE12 plasmid pYPE12-106k, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

68. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP041443 (Escherichia coli strain YPE12 plasmid pYPE12-101k-tetX4, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

69. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_MK461931 (Escherichia coli strain F2_14D plasmid pF2_14D_HI2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

70. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_MK656937 (Escherichia coli strain T3 plasmid pT3, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

71. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_MK731977 (Escherichia coli strain ENV103 plasmid pSGMCR103, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

72. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_MK673546 (Salmonella enterica subsp. enterica serovar Typhimurium strain GDD27-24 plasmid pGDD27-24, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

73. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP032447 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69840 plasmid pSDU1-USMARC-69840, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

74. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_MH179305 (Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

75. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_MH179305 (Salmonella enterica subsp. enterica serovar Indiana strain JT01 plasmid pJT01, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

76. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_MH287085 (Escherichia coli strain F2_12B plasmid pSDC-F2_12BHI2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

77. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_MH287084 (Escherichia coli O157 strain SvETEC plasmid pSDE-SvHI2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

78. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP025558 (Salmonella enterica subsp. enterica serovar Enteritidis strain PIR00532 plasmid p2PIR00532, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

79. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to MT219825 (Escherichia coli strain RW7-1 plasmid pRW7-1_235k_tetX, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

80. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to MT219826 (Escherichia coli strain RW8-1 plasmid pRW8-1_122k_tetX, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

81. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_MG904998 (Escherichia coli strain 15OD0495 plasmid p15ODTXV, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

82. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_MG197491 (Escherichia coli strain FKU92 plasmid pHNFKU92, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

83. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_MG197498 (Escherichia coli strain HZMCC14 plasmid pHNMCC14, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

84. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_MG197503 (Escherichia coli strain ZYTM118 plasmid pHNZY118, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

85. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_MG197495 (Escherichia coli strain AHC24 plasmid pHNAH24, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

86. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_MF589339 (Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

87. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_MG197502 (Escherichia coli strain ZYTF32 plasmid pHNZY32, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

88. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to MT219818 (Escherichia coli strain RF148-1 plasmid pRF148-1_119k_tetX, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

89. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to MT219820 (Escherichia coli strain RF108-2 plasmid pRF108-2_97k_tetX, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

90. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to MT219822 (Escherichia coli strain RF14-1 plasmid pRF14-1_50k_tetX, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

91. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to MT219823 (Escherichia coli strain RF10-1 plasmid pRF10-1_119k_tetX, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

92. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NC_023323 (Escherichia coli ACN001 plasmid pACN001-A, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

93. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to MF554637 (uncultured bacterium clone AA-100 plasmid pPIMMR, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

94. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP016575 (Salmonella enterica subsp. enterica serovar Heidelberg strain AMR588-04-00435 plasmid pAMR588-04-00435_37, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

95. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP020060 (Escherichia coli strain AR_0061 plasmid unitig_2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

96. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP032994 (Escherichia coli strain W5-6 plasmid p2_W5-6, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

97. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to MN783746 (Escherichia coli plasmid pIncX1_p1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

98. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_KX815983 (Salmonella enterica subsp. enterica serovar Dublin strain N13-01125 plasmid pN13-01125, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

99. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_KU254580 (Escherichia coli strain YD786 plasmid pYD786-3, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

100. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP042633 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-6, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

101. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP032392 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 34981 plasmid p34981_2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

102. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP019272 (Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

103. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP053728 (Escherichia coli strain CP61_Sichuan plasmid pCP61-IncN, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

104. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP037995 (Salmonella enterica subsp. enterica serovar Brancaster strain sg_ww281 plasmid psg_ww281) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

105. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP053740 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncX1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

106. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP016580 (Salmonella enterica subsp. enterica serovar Heidelberg strain SH13-006 plasmid pSH13-006_37, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

107. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP046001 (Escherichia coli strain 1916D6 plasmid p1916D6-1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

108. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP021103 (Escherichia coli strain 13P477T plasmid p13P477T-7, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

109. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP029182 (Escherichia coli strain H9Ecoli plasmid p3-H9, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

110. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to MN086778 (Escherichia coli plasmid p16EC-IncN, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

111. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP053047 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-tetX4, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

112. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP014974 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY3-1898, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

113. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP032397 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22429 plasmid p22429, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

114. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP035774 (Klebsiella pneumoniae strain R46 plasmid pR46-27, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

115. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP044182 (Salmonella enterica subsp. enterica serovar Heidelberg strain AR-0404 plasmid pAR-0404-1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

116. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP042608 (Escherichia coli strain NCYU-29-19 plasmid pNCYU-29-19-2_MCR3, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

117. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to MK461930 (Escherichia coli strain 2009_36 plasmid p2009_36_HI2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

118. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NC_019046 (Escherichia coli plasmid pNMEC31_31, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

119. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP047460 (Escherichia coli strain ZF31 plasmid pZF31-tetX-119kb, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

120. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP047466 (Escherichia coli strain ZF34 plasmid pZF34-tetX-114kb, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

121. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP035315 (Escherichia coli strain D72 plasmid pD72-IncX1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

122. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP050748 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST53 plasmid pST53-3, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

123. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NC_024961 (Escherichia coli plasmid pIS15_43, strain ISI5, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

124. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NC_021842 (Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 plasmid pCFSAN002069_02, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

125. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_LT985261 (Escherichia coli strain 657 plasmid RCS50_p, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

126. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_AP019678 (Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-3, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

127. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP009074 (Escherichia coli ATCC 25922 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

128. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP010168 (Escherichia coli strain H3 plasmid A, complete genome) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

129. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NC_010378 (Escherichia coli plasmid pOLA52, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

130. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to CP016512 (Salmonella enterica subsp. enterica serovar Heidelberg strain SH14-028 plasmid pSH14-028_37, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

131. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP016529 (Salmonella enterica subsp. enterica serovar Heidelberg strain 09-036813-1A plasmid p09-036813-1A_42, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

132. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP016518 (Salmonella enterica subsp. enterica serovar Heidelberg strain CE-R2-11-0435 plasmid pCE-R2-11-0435_37, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

133. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP032988 (Escherichia coli strain BE2-5 plasmid p2_BE2-5, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

134. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP017633 (Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

135. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP012922 (Salmonella enterica subsp. enterica serovar Heidelberg strain SA02DT10168701 plasmid pSA02DT10168701_37, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

136. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP033093 (Escherichia coli strain CP53 plasmid pCP53-38k, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

137. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP012926 (Salmonella enterica subsp. enterica serovar Heidelberg strain 12-4374 plasmid p12-4374_37, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

138. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP023360 (Escherichia coli strain 1943 plasmid p54, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

139. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to CP043734 (Escherichia coli strain CVM N17EC1164 plasmid pN17EC1164-1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

140. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP039600 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014867 plasmid p12-6334.1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

141. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP030283 (Escherichia coli strain E308 plasmid pLKSZ02, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

142. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NC_011204 (Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 plasmid pCT02021853_74, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

143. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NC_017624 (Salmonella enterica subsp. enterica serovar Heidelberg str. B182 plasmid pB182_37, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

144. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP050710 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE109 plasmid pSE109-1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

145. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP024290 (Escherichia coli O178:H19 strain 2012C-4431 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

146. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP048777 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-X, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

147. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP041631 (Escherichia coli strain PE15 plasmid pPE15-27K, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

148. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP050773 (Salmonella enterica subsp. enterica serovar Indiana strain SI102 plasmid pSI102-2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

149. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP041444 (Escherichia coli strain YPE10 plasmid pYPE10-78k, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

150. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP019180 (Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 plasmid pATCC39184, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

151. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP050765 (Salmonella enterica subsp. enterica serovar Indiana strain SI111 plasmid pSI111-1, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

152. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NC_010422 (Salmonella enterica subsp. enterica serovar Dublin plasmid pOU1115, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

153. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP050759 (Salmonella enterica subsp. enterica serovar Indiana strain SI173 plasmid pSI173-2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

154. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_AP022652 (Escherichia coli strain 09-02E plasmid p2-09-02E, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

155. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP024136 (Escherichia coli strain 14EC017 plasmid p14EC017b, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

156. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_LT985315 (Escherichia coli strain ECOR 70 plasmid RCS99_p, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

157. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to MN436006 (Escherichia coli strain JS1-EC05 plasmid pEC05-X4, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

158. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to MN436007 (Escherichia coli strain JS3-EC12 plasmid pEC12-X4, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

159. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_MK360096 (Salmonella enterica strain 13-SA02717 plasmid pSE13-SA02717, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

160. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP045839 (Citrobacter sp. H12-3-2 plasmid pH12-2, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

161. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP032381 (Salmonella enterica subsp. enterica serovar Dublin strain USMARC-69807 plasmid pSDU2-USMARC-69807, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

162. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_MG825381 (Escherichia coli strain 1108 plasmid p1108-NDM, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

163. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to MT197111 (Escherichia coli strain RB3-1 plasmid pRB3-1_31K_tetX, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

164. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to MT219817 (Escherichia coli strain RF148-2 plasmid pRF148-2_101k_tetX, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

165. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to MT219819 (Escherichia coli strain RF52-1 plasmid pRF52-1_119k_tetX, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

166. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to MT219821 (Escherichia coli strain RF45-1 plasmid pRF45-1_31k_tetX, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

167. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_MG288677 (Klebsiella pneumoniae strain F160070 plasmid p160070-CTXM, complete sequence) position: , mismatch: 1, identity: 0.971

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgcac	Protospacer
****.*****************************

168. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to CP031285 (Escherichia fergusonii strain 40A plasmid p46_40A, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtgattttcatcaaaggtggatggctgtgcac	Protospacer
************* ***************.****

169. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP022502 (Salmonella enterica subsp. enterica serovar Kentucky str. SA20030505 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtgattttcatcaaaggtggatggctgtgcac	Protospacer
************* ***************.****

170. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP022502 (Salmonella enterica subsp. enterica serovar Kentucky str. SA20030505 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.941

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtgattttcatcaaaggtggatggctgtgcac	Protospacer
************* ***************.****

171. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP033353 (Salmonella enterica subsp. enterica strain CFSA664 plasmid pCFSA664-1, complete sequence) position: , mismatch: 3, identity: 0.912

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgggc	Protospacer
****.************************** .*

172. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP050780 (Salmonella enterica subsp. enterica serovar Indiana strain SI85 plasmid pSI85-1, complete sequence) position: , mismatch: 3, identity: 0.912

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgcgggc	Protospacer
****.************************** .*

173. spacer 1.1|159|34|CP030195|CRISPRCasFinder matches to NZ_CP044292 (Escherichia coli strain P43A plasmid pP43A-1, complete sequence) position: , mismatch: 5, identity: 0.853

ctgtgattttcatgaaaggtggatggctgcgcac	CRISPR spacer
ctgtaattttcatgaaaggtggatggctgttcga	Protospacer
****.************************. *. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP030194
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030194_1 892119-892206 Orphan I-E
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP030194_3 3.2|3138298|36|CP030194|CRISPRCasFinder 3138298-3138333 36 CP030194.1 3138343-3138378 1 0.972

1. spacer 3.2|3138298|36|CP030194|CRISPRCasFinder matches to position: 3138343-3138378, mismatch: 1, identity: 0.972

ttcttcgcgtccgccgccgctttcgccgcctcggct	CRISPR spacer
ttcttcgcatccgccgccgctttcgccgcctcggct	Protospacer
********.***************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP030194_3 3.1|3138232|33|CP030194|CRISPRCasFinder 3138232-3138264 33 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2757373-2757405 7 0.788
CP030194_3 3.2|3138298|36|CP030194|CRISPRCasFinder 3138298-3138333 36 NZ_CP054618 Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence 416538-416573 9 0.75
CP030194_3 3.2|3138298|36|CP030194|CRISPRCasFinder 3138298-3138333 36 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 904593-904628 9 0.75
CP030194_3 3.2|3138298|36|CP030194|CRISPRCasFinder 3138298-3138333 36 NZ_CP016453 Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence 374342-374377 9 0.75
CP030194_3 3.2|3138298|36|CP030194|CRISPRCasFinder 3138298-3138333 36 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 121077-121112 11 0.694

1. spacer 3.1|3138232|33|CP030194|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.788

gccgcctcggcctccgctctcttcttcgcctca	CRISPR spacer
gccgcctcggcctccgcttccttctgggacgcc	Protospacer
******************..*****  * * * 

2. spacer 3.2|3138298|36|CP030194|CRISPRCasFinder matches to NZ_CP054618 (Azospirillum oryzae strain KACC 14407 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.75

ttcttcgcgtccgccgccgctttcgccgcctcggct	CRISPR spacer
cgcatggcgtccgccgccgcttccgccgcctccagc	Protospacer
. * * ****************.********* . .

3. spacer 3.2|3138298|36|CP030194|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 9, identity: 0.75

ttcttcgcgtccgccgccgctttcgccgcctcggct	CRISPR spacer
cgcatggcgtccgccgccgcttccgccgcctccagc	Protospacer
. * * ****************.********* . .

4. spacer 3.2|3138298|36|CP030194|CRISPRCasFinder matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 9, identity: 0.75

ttcttcgcgtccgccgccgctttcgccgcctcggct	CRISPR spacer
agcgccgcgtccgccgccgcgatcgccgcctgcgtt	Protospacer
  * .***************  *********  *.*

5. spacer 3.2|3138298|36|CP030194|CRISPRCasFinder matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 11, identity: 0.694

ttcttcgcgtccgccgccgctttcgccgcctcggct	CRISPR spacer
cttccgagatccgccgccgctttcccggcctcggcc	Protospacer
.*... . .*************** * ********.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1060296 : 1123643 65 Salmonella_phage(88.64%) tRNA,lysis,tail,portal,integrase,transposase,capsid,head,plate attL 1048742:1048757|attR 1077939:1077954
DBSCAN-SWA_2 1561092 : 1602564 58 Salmonella_phage(66.04%) plate,holin,tail,portal,transposase,capsid,head,protease,terminase NA
DBSCAN-SWA_3 1676030 : 1684587 9 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_4 1929576 : 1991504 58 Phage_Gifsy-2(18.18%) tail,tRNA,integrase,transposase attL 1964795:1964811|attR 1978797:1978813
DBSCAN-SWA_5 3331367 : 3342006 7 Salmonella_phage(42.86%) tail,transposase NA
DBSCAN-SWA_6 3551600 : 3586245 30 Wolbachia_phage(20.0%) plate,integrase,transposase attL 3585071:3585086|attR 3589306:3589321
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage