Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP030783 Escherichia albertii strain 2012EL-1823B chromosome, complete genome 3 crisprs NA 0 7 0 0
CP030785 Escherichia albertii strain 2012EL-1823B plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
CP030784 Escherichia albertii strain 2012EL-1823B plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0
CP030786 Escherichia albertii strain 2012EL-1823B plasmid unnamed3, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP030783
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030783_1 2731815-2731954 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030783_2 3064306-3064761 Orphan I-E
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030783_3 4760385-4760512 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP021754 Klebsiella pneumoniae strain AR_0113 plasmid unitig_3, complete sequence 43957-43988 0 1.0
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP011978 Klebsiella pneumoniae DMC1097 plasmid pDMC1097-77.775kb, complete sequence 9711-9742 0 1.0
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_LS992189 Escherichia coli isolate Escherichia coli str. 3426 plasmid 5 38795-38826 0 1.0
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038337 Escherichia coli O157:H7 strain LSU61 plasmid pLSU61-2, complete sequence 27210-27241 0 1.0
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038337 Escherichia coli O157:H7 strain LSU61 plasmid pLSU61-2, complete sequence 29109-29140 0 1.0
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP021546 Klebsiella pneumoniae strain AR_0112 plasmid tig00000002, complete sequence 44892-44923 0 1.0
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP007599 Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 plasmid pCFSAN000111_01, complete sequence 32447-32478 0 1.0
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP007599 Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 plasmid pCFSAN000111_01, complete sequence 34346-34377 0 1.0
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP042249 Escherichia coli strain BCE049 plasmid pBCE049-3, complete sequence 19724-19755 0 1.0
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 CP045935 Shigella sonnei strain AUSMDU00010534 plasmid pAUSMDU00010534_03, complete sequence 5703-5734 0 1.0
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP021861 Klebsiella pneumoniae strain AR_0125 plasmid tig00000009_pilon, complete sequence 34961-34992 0 1.0
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP011645 Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-78, complete sequence 9723-9754 0 1.0
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP015845 Escherichia coli O157:H7 strain FRIK2455 plasmid p35K, complete sequence 105-136 0 1.0
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP053083 Escherichia coli strain HB37 plasmid pHB37-3, complete sequence 5227-5258 0 1.0
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP053083 Escherichia coli strain HB37 plasmid pHB37-3, complete sequence 8179-8210 0 1.0
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG904994 Escherichia coli strain 14OD0056 plasmid p14ODV, complete sequence 29240-29271 0 1.0
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NC_022520 Klebsiella pneumoniae plasmid pBK15692, complete sequence 9760-9791 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP015086 Escherichia coli O25b:H4 plasmid unnamed, complete sequence 86816-86847 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP025949 Escherichia coli strain SCEC020023 plasmid pCTXM55_020023, complete sequence 62413-62444 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KU987452 Citrobacter freundii strain AC2901 plasmid AC2901, complete sequence 69935-69966 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KX928752 Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence 144508-144539 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KX608544 Escherichia coli strain FA27 plasmid pFA27_2, complete sequence 56063-56094 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KX683283 Escherichia coli strain EcU443 plasmid pECSE_01, complete sequence 94571-94602 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KY751926 Klebsiella pneumoniae strain HK02-026 plasmid pHK02-026, complete sequence 36117-36148 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KY288024 Klebsiella pneumoniae strain ST709 plasmid pCC1410-2, complete sequence 38838-38869 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KY416992 Escherichia coli strain FAM21805 plasmid unnamed, complete sequence 79319-79350 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_017627 Escherichia coli 042 plasmid pAA, complete sequence 58517-58548 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP025626 Escherichia coli strain SCEC020007 plasmid pNDM5_020007, complete sequence 129046-129077 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP028541 Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence 66800-66831 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 AP018456 Escherichia coli O25b:H4-ST131 plasmid pMRY09-581ECO_1 MRY09-581 DNA, complete sequence 89284-89315 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 AP018457 Escherichia coli O25b:H4-ST131 plasmid pMRY09-592ECO_1 MRY09-592 DNA, complete sequence 30981-31012 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 AP018458 Escherichia coli O25b:H4-ST131 plasmid pMRY09-597ECO_1 MRY09-597 DNA, complete sequence 47536-47567 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 MN783745 Escherichia coli plasmid pFII-FIB, complete sequence 102190-102221 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP023854 Escherichia coli strain 2/0 plasmid p2_0.1, complete sequence 50959-50990 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 MF679146 Escherichia coli plasmid pBJ114-141, complete sequence 133035-133066 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 MF679147 Escherichia coli plasmid pBJ114T-190, complete sequence 181354-181385 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LR213453 Shigella flexneri strain AUSMDU00008355 isolate AUSMDU00008355 plasmid 2 36803-36834 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KU664810 Escherichia coli strain 11.3-R3 plasmid pCERC5, complete sequence 65736-65767 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KT988018 Escherichia coli strain V282 plasmid pEcoV282, complete sequence 37346-37377 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KU288634 Escherichia coli strain FAM22321 plasmid pFAM22321, complete sequence 68179-68210 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KY007017 Escherichia coli strain 14.3-R4 plasmid pCERC9, complete sequence 60780-60811 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KU321583 Escherichia coli strain E80 plasmid pE80, complete sequence 128386-128417 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KT879914 Escherichia coli strain HNEC55 plasmid pHNEC55, complete sequence 62209-62240 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KU043115 Escherichia coli strain Y5 plasmid pECY55, complete sequence 4170-4201 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KX839209 Klebsiella pneumoniae strain KP1814 plasmid pKP1814-3, complete sequence 80805-80836 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KU254579 Escherichia coli strain YD786 plasmid pYD786-2, complete sequence 12474-12505 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KX503323 Escherichia coli strain HNEC46 plasmid PHNEC46, complete sequence 63960-63991 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP015077 Escherichia coli strain Ecol_448 plasmid pEC448_1, complete sequence 108934-108965 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP032991 Escherichia coli strain W2-5 plasmid p2_W2-5, complete sequence 58640-58671 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP015070 Escherichia coli strain Ecol_743 plasmid pEC743_1, complete sequence 53079-53110 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP015072 Escherichia coli strain Ecol_743 plasmid pEC743_3, complete sequence 21562-21593 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KT185451 Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence 68296-68327 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KT818627 Klebsiella pneumoniae strain U25 plasmid U25P002, complete sequence 6366-6397 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KT725788 Klebsiella pneumoniae strain ST147 plasmid pCC1410-1, complete sequence 53545-53576 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KT725789 Klebsiella pneumoniae strain ST147 plasmid pCC1409-1, complete sequence 53545-53576 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KR653209 Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence 81071-81102 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KT002541 Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence 67350-67381 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KT990220 Escherichia coli strain 42-2 plasmid p42-2, complete sequence 96025-96056 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KT845955 Escherichia coli strain EP28 plasmid pHNEP28_cfr, complete sequence 48085-48116 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KP398867 Escherichia coli strain DB04277 plasmid pDB4277, complete sequence 123988-124019 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KR078259 Escherichia coli strain YD472 plasmid pYHCC, complete sequence 68599-68630 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 AP019526 Escherichia coli O25b:H4-ST131 B0018 plasmid pB0018 DNA, complete sequence 22997-23028 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP042629 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-2, complete sequence 137627-137658 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP042630 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-3, complete sequence 128642-128673 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP041339 Escherichia coli strain CCUG 73778 plasmid pSUH-2, complete sequence 74721-74752 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP023850 Escherichia coli strain 4/0 plasmid p4_0.1, complete sequence 11553-11584 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP035517 Escherichia coli strain U14A plasmid pU14A_A, complete sequence 122626-122657 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP035518 Escherichia coli strain U14A plasmid pU14A_B, complete sequence 61151-61182 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP048368 Escherichia coli strain 163 plasmid pC-F-164_A-OXA140, complete sequence 116273-116304 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP040995 Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed3, complete sequence 56835-56866 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_AP017611 Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_1, complete sequence 99691-99722 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LR130565 Escherichia coli strain MS14387 isolate MS14387 plasmid 2 75675-75706 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP042338 Escherichia coli strain GZ04-0086 plasmid pNDM5-GZ04_B, complete sequence 56922-56953 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_014232 Escherichia coli ETEC 1392/75 plasmid p1081, complete sequence 24990-25021 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP022460 Shigella sonnei strain 2015C-3807 plasmid unnamed1, complete sequence 56120-56151 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP010158 Escherichia coli strain D10 plasmid A, complete genome 4634-4665 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP040124 Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-2, complete sequence 38686-38717 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP028484 Escherichia coli strain E41-1 plasmid p1, complete sequence 120239-120270 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP010138 Escherichia coli strain D2 plasmid A, complete sequence 41464-41495 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP025857 Escherichia coli strain 504838 plasmid p504838_108, complete sequence 15043-15074 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP025852 Escherichia coli strain 510016 plasmid p510016_29, complete sequence 9935-9966 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP025844 Escherichia coli strain 720632 plasmid p720632_94, complete sequence 3637-3668 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP035478 Escherichia coli strain U13A plasmid pU13A_A, complete sequence 17355-17386 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP035479 Escherichia coli strain U13A plasmid pU13A_B, complete sequence 64662-64693 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP034401 Escherichia coli strain CRE10 plasmid pCRE10.1, complete sequence 116170-116201 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP014493 Escherichia coli strain MVAST0167 plasmid pMVAST0167_1, complete sequence 11651-11682 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP031918 Escherichia coli O45:H2 strain FWSEC0003 plasmid unnamed12, complete sequence 20358-20389 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KX646543 Shigella boydii strain 2246 plasmid p2246-CTXM, complete sequence 100468-100499 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_013354 Escherichia coli O103:H2 str. 12009 plasmid pO103, complete sequence 41834-41865 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_013655 Escherichia coli SE15 plasmid pECSF1, complete sequence 35807-35838 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_020278 Escherichia coli strain 3A11 plasmid pHN3A11, complete sequence 65789-65820 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP043219 Escherichia coli O80:H26 strain EC-107 plasmid pET6.2-IncFII, complete sequence 83781-83812 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP018113 Escherichia coli strain MRSN346595 plasmid pMRSN346595_62.2, complete sequence 50221-50252 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP042601 Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-2, complete sequence 66440-66471 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP048331 Escherichia coli strain 10 plasmid p010_A, complete sequence 61392-61423 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP026131 Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence 88824-88855 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP049351 Escherichia coli strain 3R plasmid p3R-3, complete sequence 44596-44627 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 KY130431 Klebsiella pneumoniae plasmid pABC143C-NDM, complete sequence 75711-75742 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP038182 Escherichia coli strain 2 HS-C plasmid p2HS-C-2, complete sequence 22892-22923 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KT754160 Shigella dysenteriae strain 80-547 plasmid p80-547, complete sequence 91845-91876 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KT754164 Shigella dysenteriae 1 strain 3099-85 plasmid p3099-85, complete sequence 43441-43472 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP054329 Escherichia coli strain SCU-121 plasmid pSCU-121-1, complete sequence 3524-3555 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP019272 Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence 116526-116557 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP011135 Escherichia coli VR50 plasmid pVR50A, complete sequence 1621-1652 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP011136 Escherichia coli VR50 plasmid pVR50B, complete sequence 89887-89918 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP048338 Escherichia coli strain 142 plasmid p142_A-OXA181, complete sequence 89497-89528 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP010174 Escherichia coli strain H8 plasmid B, complete sequence 91324-91355 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP031909 Escherichia coli O103:H2 strain FWSEC0007 plasmid unnamed16, complete sequence 21735-21766 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LS992188 Escherichia coli isolate Escherichia coli str. 3426 plasmid 4, complete sequence 6634-6665 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LS992188 Escherichia coli isolate Escherichia coli str. 3426 plasmid 4, complete sequence 87514-87545 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP053732 Escherichia coli strain CP55_Sichuan plasmid pCP55-IncFIB, complete sequence 96827-96858 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP053734 Escherichia coli strain CP55_Sichuan plasmid pCP55-IncFII, complete sequence 59174-59205 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_MK878892 Escherichia coli strain J53 plasmid pMG333, complete sequence 35182-35213 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_023315 Escherichia coli strain EQ011 plasmid pEQ011, complete sequence 11543-11574 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_025106 Escherichia coli strain NMI5428/11 plasmid pMC-NDM, complete sequence 62067-62098 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP021289 Escherichia coli strain PA45B plasmid pPA45B, complete sequence 63415-63446 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP020510 Escherichia coli strain 165 plasmid unnamed1, complete sequence 97576-97607 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP020546 Escherichia coli strain ZJ3920 plasmid pZJ3920-1, complete sequence 92542-92573 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP010316 Escherichia coli strain 789 plasmid pAPEC-O78-ColV 108522-108553 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP029734 Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed6, complete sequence 55625-55656 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP033394 Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence 80569-80600 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP033395 Klebsiella pneumoniae strain WCHKP015625 plasmid pKPC12_015625, complete sequence 35696-35727 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP034964 Escherichia coli strain WCHEC020032 plasmid pCTXM3_020032, complete sequence 76108-76139 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LS999561 Escherichia coli isolate EC-TO143 plasmid 2, complete sequence 13100-13131 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LS999561 Escherichia coli isolate EC-TO143 plasmid 2, complete sequence 128652-128683 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LS992167 Escherichia coli isolate Escherichia coli str. TO6 plasmid 2, complete sequence 156043-156074 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 161107-161138 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP053737 Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFII, complete sequence 75502-75533 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP053722 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncFIB, complete sequence 88145-88176 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP053725 Escherichia coli strain CP66-6_Sichuan plasmid pCP66-6-IncFII, complete sequence 62384-62415 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KJ020575 Escherichia coli strain FP460 plasmid pHNFP460-1, complete sequence 89636-89667 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP044404 Escherichia coli strain NMBU-W10C18 plasmid pNMBU-W10C18_01, complete sequence 49458-49489 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 170263-170294 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LN824138 Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_E_Kpneumoniae_MS6671 33965-33996 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP021847 Escherichia coli strain EC1515 plasmid pEC1515-3, complete sequence 75659-75690 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP047091 Salmonella sp. S13 plasmid pS13-2, complete sequence 78279-78310 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP012626 Escherichia coli strain SF-468 plasmid pSF-468-1, complete sequence 80244-80275 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 MT077882 Escherichia coli plasmid p4, complete sequence 36087-36118 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 MT077885 Escherichia coli plasmid p37, complete sequence 63406-63437 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 MT077887 Escherichia coli plasmid p62, complete sequence 22887-22918 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 MT077889 Escherichia coli plasmid p77, complete sequence 58673-58704 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 MN007141 Escherichia coli strain 91 plasmid p91_NDM5, complete sequence 111224-111255 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LS992181 Escherichia coli isolate Escherichia coli str. TO124 plasmid 2, complete sequence 89881-89912 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LS992182 Escherichia coli isolate Escherichia coli str. TO124 plasmid 3, complete sequence 117950-117981 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 KX023260 Escherichia coli plasmid pSCE516-3, complete sequence 74877-74908 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051433 Escherichia sp. SCLE84 plasmid pSCLE3, complete sequence 84845-84876 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP026826 Shigella dysenteriae strain ATCC 12021 plasmid unnamed 86343-86374 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024475 Shigella flexneri 7b strain 94-3007 plasmid unnamed2, complete sequence 68026-68057 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LR213457 Shigella flexneri strain AUSMDU00008332 isolate AUSMDU00008332 plasmid 3 33192-33223 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP044156 Shigella flexneri strain AR-0424 plasmid pAR-0424-1, complete sequence 49940-49971 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LT838198 Escherichia coli isolate WI1 isolate plasmid pWI1-incFII, complete sequence 49055-49086 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LR130556 Escherichia coli strain MS14385 isolate MS14385 plasmid 2 68515-68546 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LR130558 Escherichia coli strain MS14385 isolate MS14385 plasmid 4 41229-41260 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP054369 Escherichia coli strain SCU-115 plasmid pSCU-115-1, complete sequence 95709-95740 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP054364 Escherichia coli strain SCU-171 plasmid pSCU-171-1, complete sequence 73160-73191 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP048296 Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-2, complete sequence 60336-60367 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP014496 Escherichia coli strain SaT040 plasmid pSaT040, complete sequence 42988-43019 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP013836 Escherichia coli strain JJ1897 plasmid pJJ1897_1, complete sequence 11527-11558 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP046678 Escherichia coli strain 152661 plasmid p152661_p2, complete sequence 41375-41406 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP026724 Escherichia coli strain 266917_2 plasmid p266917_2_01, complete sequence 54313-54344 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP021728 Escherichia coli strain Combat11I9 plasmid pCombat11I9-2, complete sequence 158793-158824 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP020517 Escherichia coli strain 222 plasmid unnamed3, complete sequence 70716-70747 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP019276 Escherichia coli strain 13P477T plasmid p13P477T-3, complete sequence 46766-46797 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP033629 Klebsiella pneumoniae strain 4743 plasmid unnamed4, complete sequence 56253-56284 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP036301 Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence 70285-70316 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP036362 Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence 8930-8961 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP049078 Escherichia coli strain p11A plasmid p11A_p1, complete sequence 18107-18138 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP051693 Escherichia coli strain SCU-318 plasmid pSCU-318-1, complete sequence 86144-86175 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP030770 Escherichia coli strain 2017C-4173W12 plasmid p2017C-4173W12, complete sequence 32022-32053 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP054942 Escherichia coli strain MS6192 plasmid pMS6192B, complete sequence 50747-50778 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP012683 Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33673_IncF, complete sequence 103735-103766 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024284 Escherichia albertii strain 2014C-4356 plasmid unnamed2, complete sequence 5551-5582 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024286 Escherichia albertii strain 2014C-4356 plasmid unnamed4, complete sequence 51650-51681 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024287 Escherichia albertii strain 2014C-4356 plasmid unnamed5, complete sequence 27588-27619 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP025952 Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence 10218-10249 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP027326 Escherichia coli strain 2013C-4830 plasmid unnamed1, complete sequence 53292-53323 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP026854 Escherichia coli strain MS7163 plasmid pMS7163A, complete sequence 56656-56687 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP019261 Escherichia coli strain 13C1065T plasmid p13C1065T-2, complete sequence 39351-39382 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP019244 Escherichia coli strain Combat2C1 plasmid pCombat2C1-1, complete sequence 61409-61440 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP012634 Escherichia coli strain SF-166 plasmid pSF-166-1, complete sequence 42132-42163 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 91887-91918 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP031548 Escherichia coli strain cq9 plasmid unnamed2, complete sequence 172392-172423 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP036244 Escherichia coli strain S65EC plasmid pS65EC, complete sequence 78058-78089 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP036372 Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence 66800-66831 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP012139 Shigella flexneri 2a strain 981 plasmid 981p2, complete sequence 74841-74872 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_018998 Escherichia coli F18+ plasmid pTC1, complete sequence 78599-78630 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP042642 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-4_MCR3, complete sequence 64572-64603 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP045279 Escherichia coli strain LAU-OXA plasmid pLAU-OXA2, complete sequence 27136-27167 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP021843 Escherichia coli strain EC974 plasmid pEC974-3, complete sequence 68097-68128 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 MN061455 Escherichia coli strain EC-15-3 plasmid pEC-15-3-NDM-1, complete sequence 97502-97533 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 MN891682 Klebsiella pneumoniae strain 116753 plasmid p116753-KPC, complete sequence 44643-44674 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 LC549806 Escherichia coli VNCEc57 plasmid pVNCEc57 DNA, complete sequence 68183-68214 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP038393 Escherichia coli O157:H7 strain DEC5B plasmid pDEC5B-5, complete sequence 5411-5442 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_009602 Escherichia coli plasmid pSFO157, complete sequence 113210-113241 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP021180 Escherichia coli strain 81009 plasmid pEC-81009, complete sequence 107586-107617 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP041957 Escherichia coli strain EC2 plasmid pEC2_2, complete sequence 72602-72633 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP041948 Klebsiella pneumoniae strain KP2 plasmid pKP2_2, complete sequence 64261-64292 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CM019851 Escherichia coli strain CVM N17EC0326 plasmid pN17EC0326-1, complete sequence, whole genome shotgun sequence 116855-116886 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP023350 Escherichia coli strain ETEC-2264 plasmid unnamed1, complete sequence 85667-85698 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP023351 Escherichia coli strain ETEC-2264 plasmid unnamed2, complete sequence 12267-12298 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP027460 Escherichia coli strain 90-3040 plasmid unnamed, complete sequence 16495-16526 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP027385 Escherichia coli strain 2013C-3250 plasmid unnamed5, complete sequence 87053-87084 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP041414 Escherichia coli strain STEC719 plasmid pSTEC719_3, complete sequence 27830-27861 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP041415 Escherichia coli strain STEC719 plasmid pSTEC719_4, complete sequence 4114-4145 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP041434 Escherichia coli strain STEC313 plasmid pSTEC313, complete sequence 25481-25512 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP041428 Escherichia coli strain STEC388 plasmid pSTEC388_3, complete sequence 45084-45115 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP041430 Escherichia coli strain STEC367 plasmid pSTEC367, complete sequence 50181-50212 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP012632 Escherichia coli strain SF-173 plasmid pSF-173-1, complete sequence 84051-84082 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP015160 Escherichia coli strain Eco889 plasmid pECO-fce, complete sequence 86675-86706 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP015160 Escherichia coli strain Eco889 plasmid pECO-fce, complete sequence 154049-154080 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP035752 Escherichia coli E110019 plasmid pE110019_66, complete sequence 32369-32400 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 MN641485 Escherichia coli strain SDCRK18-7 plasmid pNDM-SDCRK18-7, complete sequence 61651-61682 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP047380 Escherichia coli strain CAU16175 plasmid pCAU16175_2, complete sequence 108451-108482 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP047381 Escherichia coli strain CAU16175 plasmid pCAU16175_3, complete sequence 65727-65758 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP038385 Escherichia coli O157:H7 strain DEC5E plasmid pDEC5E-2, complete sequence 69573-69604 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP045525 Shigella sonnei strain 6904.27 plasmid p6904-27 81488-81519 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP033091 Escherichia coli DSM 30083 = JCM 1649 = ATCC 11775 plasmid unnamed, complete sequence 62642-62673 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_008460 Escherichia coli plasmid pO86A1, complete sequence 90077-90108 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP019696 Shigella sonnei strain 75/02 plasmid pInv_75_02_1, complete sequence 102398-102429 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 LT906556 Escherichia coli isolate E. coli RL465 genome assembly, plasmid: I 107490-107521 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP040922 Escherichia coli strain FC853_EC plasmid p853EC3, complete sequence 25853-25884 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP014523 Escherichia coli strain ZH063 plasmid pZH063_1, complete sequence 11479-11510 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024281 Escherichia coli strain ATCC 43896 plasmid unnamed3, complete sequence 12884-12915 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024055 Escherichia coli strain SMN197SH3 plasmid pO177A3, complete sequence 82006-82037 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024617 Escherichia coli strain SMN152SH1 plasmid pO177A1, complete sequence 31875-31906 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP007150 Escherichia coli RS218 plasmid pRS218, complete sequence 104111-104142 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP029580 Escherichia coli strain DA33137 plasmid pDA33137-178, complete sequence 121100-121131 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP030329 Escherichia coli strain AR_452 plasmid unnamed1, complete sequence 107729-107760 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP014498 Escherichia coli strain ZH193 plasmid pZH193, complete sequence 12606-12637 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP053248 Escherichia coli strain SCU-482 plasmid pSCU-482-1, complete sequence 87325-87356 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP053246 Escherichia coli strain SCU-485 plasmid pSCU-485-1, complete sequence 54124-54155 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_007941 Escherichia coli UTI89 plasmid pUTI89, complete sequence 104113-104144 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP015503 Klebsiella pneumoniae strain SKGH01 plasmid unnamed 3, complete sequence 31831-31862 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP013832 Escherichia coli strain CD306 plasmid pCD306, complete sequence 90339-90370 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP013833 Escherichia coli strain JJ2434 plasmid pJJ2434_1, complete sequence 54770-54801 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP013834 Escherichia coli strain JJ2434 plasmid pJJ2434_2, complete sequence 51270-51301 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP027357 Escherichia coli strain 2013C-4991 plasmid unnamed2 117648-117679 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP027389 Escherichia coli strain 2011C-4251 plasmid unnamed 15048-15079 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP041421 Escherichia coli strain STEC711 plasmid pSTEC711_5, complete sequence 7616-7647 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP041432 Escherichia coli strain STEC316 plasmid pSTEC316, complete sequence 9765-9796 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP041438 Escherichia coli strain STEC005 plasmid pSTEC005, complete sequence 67808-67839 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP039562 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014847 plasmid p08-5333.1, complete sequence 35424-35455 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP029577 Escherichia coli strain DA33135 plasmid pDA33135-139, complete sequence 14487-14518 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP029578 Escherichia coli strain DA33135 plasmid pDA33135-70, complete sequence 14474-14505 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024652 Escherichia coli strain BH100 substr. MG2014 plasmid pBH100-1, complete sequence 80455-80486 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP049937 Escherichia coli strain JL05 plasmid pARG01, complete sequence 35523-35554 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP016389 Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid pESBL931, complete sequence 67263-67294 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP042619 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-4, complete sequence 56619-56650 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP042621 Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-6, complete sequence 60878-60909 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP014753 Escherichia coli strain PSUO103 plasmid, complete sequence 40597-40628 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP019007 Escherichia coli strain Ecol_AZ159 plasmid pECAZ159_1, complete sequence 37365-37396 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP011916 Escherichia coli strain PSUO2 plasmid pPSUO2, complete sequence 96491-96522 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024888 Escherichia coli strain AR_0019 plasmid tig00000138_pilon, complete sequence 20915-20946 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP019456 Escherichia coli strain FHI_NMBU_03 plasmid pFHI_NMBU_03_1, complete sequence 126842-126873 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP041436 Escherichia coli strain STEC309 plasmid pSTEC309, complete sequence 14738-14769 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP018994 Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_1, complete sequence 39840-39871 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP037912 Escherichia coli strain YSP8-1 plasmid pYSP8-1-CTX-M-14, complete sequence 105352-105383 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP038338 Escherichia coli O157:H7 strain LSU61 plasmid pLSU61-1, complete sequence 77699-77730 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP038413 Escherichia coli O157:H7 strain 493/89 plasmid p493-89-1, complete sequence 41003-41034 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP041102 Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed3, complete sequence 81269-81300 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 MK492260 Escherichia coli strain MG1655 K12 plasmid F-Tn10, complete sequence 99943-99974 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP028193 Escherichia coli strain CFSAN018748 plasmid pGMI14-004_2, complete sequence 8095-8126 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP043415 Escherichia coli strain EC42405 plasmid pNTEC2-42405, complete sequence 72756-72787 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP010882 Escherichia coli strain MNCRE44 plasmid pMNCRE44_6, complete sequence 56614-56645 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP011019 Escherichia coli strain CI5 plasmid unnamed, complete sequence 104425-104456 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LT985217 Escherichia coli strain 715 plasmid RCS103_p, complete sequence 32333-32364 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP030198 Salmonella enterica strain SA20051401 plasmid pSA20051401.2, complete sequence 85876-85907 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP034324 Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence 84243-84274 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 KU318420 Klebsiella pneumoniae strain KP04 plasmid pKP04CTXM, complete sequence 58687-58718 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP053752 Shigella sonnei strain 506 plasmid pMHMC-001, complete sequence 36129-36160 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP053755 Shigella sonnei strain 506 plasmid pMHMC-004, complete sequence 1314-1345 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP040547 Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence 51012-51043 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 AP014876 Escherichia coli plasmid pV021-b DNA, complete sequence, strain: V021 59645-59676 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 AP014877 Escherichia coli plasmid pV085-c DNA, complete sequence, strain: V085 2796-2827 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP015131 Klebsiella pneumoniae strain Kpn555 plasmid pKPN-7c3, complete sequence 138771-138802 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP046260 Escherichia coli strain ECO2947 plasmid p2974-D, complete sequence 67483-67514 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP046261 Escherichia coli strain ECO2947 plasmid p2947-NDM5, complete sequence 54439-54470 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP027439 Escherichia coli strain 2012C-4221 plasmid unnamed2, complete sequence 67392-67423 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP032242 Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence 19537-19568 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP039820 Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence 69066-69097 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP034254 Escherichia coli strain IVRI Kol CP4 plasmid p1ESCUMpO83_CORR 45277-45308 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP035314 Escherichia coli strain D72 plasmid pD72-F33, complete sequence 59670-59701 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP046718 Escherichia coli strain T16R plasmid pT16R-2, complete sequence 114211-114242 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 KY463220 Escherichia coli plasmid pNDM5-IBAC, complete sequence 49937-49968 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP034932 Shigella flexneri strain 2013C-3749 plasmid p2013C-3749-1, complete sequence 36229-36260 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP041177 Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence 67242-67273 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051655 Escherichia coli strain RM13745 plasmid pRM13745-2 36029-36060 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051653 Escherichia coli strain RM13752 plasmid pRM13752 58159-58190 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051657 Escherichia coli strain SJ7 plasmid pSJ7-1 25569-25600 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051656 Escherichia coli strain RM11911 plasmid pRM11911 42004-42035 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP039513 Salmonella enterica subsp. enterica serovar Worthington strain 7102.58 plasmid p7102_58-6, complete sequence 70001-70032 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP010181 Escherichia coli strain M1 plasmid A, complete sequence 142295-142326 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP008715 Escherichia coli strain ST648 plasmid pEC648_1, complete sequence 109549-109580 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP043748 Escherichia coli strain CVM N16EC0140 plasmid pN16EC0140-1, complete sequence 68793-68824 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP021684 Escherichia coli strain AR_0162 plasmid tig00008015, complete sequence 82884-82915 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024836 Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_2, complete sequence 83786-83817 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP026201 Escherichia coli strain ECONIH6 plasmid pNDM-d2e9, complete sequence 11232-11263 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP026754 Escherichia coli strain AR_0077 plasmid tig00000042_pilon, complete sequence 53588-53619 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP039810 Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence 69124-69155 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP012636 Escherichia coli strain SF-088 plasmid pSF-088-1, complete sequence 109476-109507 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP031804 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed4, complete sequence 58017-58048 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP032202 Escherichia coli strain AR_0086 plasmid unnamed1, complete sequence 3458-3489 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP050707 Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence 97529-97560 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP009233 Escherichia coli strain CA08 plasmid pCA08, complete sequence 47316-47347 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP021203 Escherichia coli strain Z1002 plasmid p1002-1, complete sequence 164362-164393 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP021210 Escherichia coli strain strain Z247 plasmid p2474-NDM1, complete sequence 66583-66614 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP022731 Escherichia coli strain SA186 plasmid pSA186_2, complete sequence 195677-195708 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP022732 Escherichia coli strain SA186 plasmid pSA186_3, complete sequence 4650-4681 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_004998 Escherichia coli plasmid p1658/97, complete sequence 26774-26805 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LT985319 Escherichia coli strain ECOR 30 genome assembly, plasmid: RCS96_pII 26757-26788 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP031852 Klebsiella pneumoniae strain 121 plasmid pKP121-3, complete sequence 55152-55183 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP033404 Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence 69451-69482 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP025850 Escherichia coli strain 600468 plasmid p600468_158, complete sequence 91578-91609 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP035468 Escherichia coli strain U12A plasmid pU12A_A, complete sequence 17355-17386 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP035470 Escherichia coli strain U12A plasmid pU12A_C, complete sequence 64662-64693 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051707 Escherichia coli strain SCU-124 plasmid pSCU-124-1, complete sequence 56457-56488 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051708 Escherichia coli strain SCU-124 plasmid pSCU-124-2, complete sequence 60013-60044 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LR130563 Escherichia coli strain MS14384 isolate MS14384 plasmid 2 56520-56551 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051701 Escherichia coli strain SCU-125 plasmid pSCU-125-1, complete sequence 62348-62379 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_AP019677 Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-2, complete sequence 65309-65340 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_024956 Escherichia coli strain K-12 plasmid pDM0133, complete sequence 55784-55815 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP010830 Shigella sonnei strain FORC_011 plasmid pFORC11.1, complete sequence 102402-102433 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP006001 Escherichia coli B7A plasmid pEB3, complete sequence 43677-43708 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP027448 Escherichia coli strain 2014C-3075 plasmid unnamed, complete sequence 108927-108958 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP029104 Escherichia coli strain AR437 plasmid unnamed2, complete sequence 48895-48926 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_AP018147 Escherichia coli strain M217 isolate M217 plasmid pM217_FII, complete sequence 86989-87020 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP033159 Escherichia coli strain CM IVRI KOL-1 plasmid p1ESCUMpO83_CORR 79287-79318 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP048372 Escherichia coli strain 164 plasmid pC-F-163_A, complete sequence 58071-58102 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051728 Escherichia coli strain SCU-111 plasmid pSCU-111-1, complete sequence 105396-105427 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051729 Escherichia coli strain SCU-111 plasmid pSCU-111-2, complete sequence 54625-54656 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051712 Escherichia coli strain SCU-123 plasmid pSCU-123-1, complete sequence 56520-56551 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051696 Escherichia coli strain SCU-313 plasmid pSCU-313-2, complete sequence 55242-55273 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051689 Escherichia coli strain SCU-387 plasmid pSCU-387-1, complete sequence 85452-85483 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051690 Escherichia coli strain SCU-387 plasmid pSCU-387-2, complete sequence 20769-20800 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051739 Escherichia coli strain SCU-105 plasmid pSCU-105-1, complete sequence 59705-59736 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051739 Escherichia coli strain SCU-105 plasmid pSCU-105-1, complete sequence 150812-150843 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051726 Escherichia coli strain SCU-112 plasmid pSCU-112-1, complete sequence 63886-63917 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051721 Escherichia coli strain SCU-116 plasmid pSCU-116-2, complete sequence 23588-23619 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP052528 Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-4, complete sequence 59630-59661 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_AP018811 Escherichia coli strain E2865 plasmid pE2865-3, complete sequence 65133-65164 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_AP018785 Escherichia coli strain SK1144 plasmid pSK1144 68574-68605 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_019071 Escherichia coli plasmid pHK09, complete sequence 59468-59499 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_019072 Escherichia coli plasmid pHK08, complete sequence 59083-59114 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_019089 Escherichia coli plasmid pGUE-NDM, complete sequence 14028-14059 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_019094 Escherichia coli plasmid p417H-90, complete sequence 48058-48089 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_019095 Escherichia coli plasmid pXZ, complete sequence 65535-65566 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP040807 Escherichia fergusonii strain EFCF056 plasmid pEF02, complete sequence 41437-41468 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP040808 Escherichia fergusonii strain EFCF056 plasmid pEF03, complete sequence 18251-18282 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP010241 Escherichia coli strain C7 plasmid A, complete sequence 27181-27212 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP046117 Enterobacter cloacae strain CBG15936 plasmid pTEM-CBG, complete sequence 64144-64175 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP021690 Escherichia coli strain AR_0058 plasmid tig00007555j7554, complete sequence 152068-152099 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP023389 Escherichia coli strain 1105 plasmid p74, complete sequence 63489-63520 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024823 Escherichia coli strain CREC-591 plasmid pCREC-591_2, complete sequence 3635-3666 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024975 Escherichia coli strain CV839-15 plasmid pCV839-15-p1, complete sequence 53036-53067 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP043544 Escherichia coli strain F2_81 plasmid pF2_18C_FIB, complete sequence 16234-16265 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP021536 Escherichia coli strain AR_0119 plasmid unitig_2, complete sequence 154341-154372 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024480 Escherichia coli strain 2011C-4315 plasmid unnamed1, complete sequence 51186-51217 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP030782 Escherichia albertii strain 07-3866 plasmid unnamed, complete sequence 103393-103424 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP036180 Escherichia coli strain WCHEC025970 plasmid p1_025970, complete sequence 98666-98697 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 KU932024 Escherichia coli plasmid pEC13, complete sequence 60672-60703 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 KU932025 Escherichia coli plasmid pEC14I, complete sequence 140562-140593 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 KU932028 Escherichia coli plasmid pEC14III, complete sequence 60075-60106 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024157 Escherichia coli strain 14EC047 plasmid p14EC047b, complete sequence 23319-23350 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024158 Escherichia coli strain 14EC047 plasmid p14EC047c, complete sequence 74468-74499 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP050647 Escherichia coli strain PapM-36-2 plasmid pIncFIB, complete sequence 53173-53204 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP009860 Escherichia coli strain ECONIH1 plasmid pECO-824, complete sequence 89933-89964 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP017852 Klebsiella variicola strain GJ2 plasmid pKPGJ-2c, complete sequence 36015-36046 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP017287 Klebsiella variicola strain GJ3 plasmid pKPGJ-3c, complete sequence 65183-65214 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP019954 Escherichia coli M8 plasmid unnamed1, complete sequence 23835-23866 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_025175 Escherichia coli plasmid pH2332-166, complete sequence 23219-23250 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_025177 Escherichia coli plasmid pH1519-76, complete sequence 32292-32323 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP019444 Salmonella enterica subsp. enterica serovar Typhimurium strain 81741 plasmid unnamed2, complete sequence 69657-69688 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024151 Escherichia coli strain 14EC033 plasmid p14EC033d, complete sequence 51304-51335 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LR025102 Escherichia coli isolate EC-1639 plasmid 2, complete sequence 74763-74794 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051734 Escherichia coli strain SCU-109 plasmid pSCU-109-1, complete sequence 52696-52727 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051736 Escherichia coli strain SCU-108 plasmid pSCU-108-1, complete sequence 56520-56551 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051737 Escherichia coli strain SCU-108 plasmid pSCU-108-2, complete sequence 59990-60021 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051699 Escherichia coli strain SCU-152 plasmid pSCU-152-1, complete sequence 62634-62665 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP023733 Escherichia coli strain FORC 064 plasmid pFORC64.2, complete sequence 59412-59443 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP051715 Escherichia coli strain SCU-122 plasmid pSCU-122-1, complete sequence 56520-56551 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_013175 Escherichia coli plasmid pEC14_114, complete sequence 104105-104136 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_025139 Escherichia coli plasmid pH2291-144, complete sequence 115307-115338 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_025141 Escherichia coli plasmid pH1038-142, complete sequence 104802-104833 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP042296 Escherichia coli strain RM9088 plasmid p1RM9088, complete sequence 147650-147681 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP018978 Escherichia coli strain Ecol_656 plasmid pEC656_1, complete sequence 79271-79302 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024258 Escherichia coli O25:H16 strain F5505-C1 plasmid unnamed1, complete sequence 16807-16838 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024840 Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_2, complete sequence 8300-8331 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024145 Escherichia coli strain 14EC029 plasmid p14EC029d, complete sequence 55960-55991 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP027256 Escherichia coli strain EC11 plasmid unnamed1, complete sequence 26964-26995 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP027536 Escherichia coli strain AR_0081 plasmid unnamed3, complete sequence 61310-61341 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP027537 Escherichia coli strain AR_0081 plasmid unnamed2, complete sequence 78718-78749 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP013026 Escherichia coli strain 2009C-3133 plasmid unnamed2, complete sequence 14559-14590 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP029113 Escherichia coli strain AR435 plasmid unnamed1, complete sequence 41412-41443 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP018982 Escherichia coli strain Ecol_867 plasmid pEC867_1, complete sequence 50177-50208 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP018952 Escherichia coli strain Ecol_276 plasmid pEC276_1, complete sequence 104459-104490 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP042879 Escherichia coli strain NMBU_W05E18 plasmid pNMBU-W05E18_01, complete sequence 79898-79929 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024241 Escherichia coli O114:H49 strain 90-9280 plasmid unnamed1 83939-83970 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024242 Escherichia coli O114:H49 strain 90-9280 plasmid unnamed2, complete sequence 42450-42481 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP019076 Escherichia coli strain CRE1493 plasmid p1493-5, complete sequence 1626-1657 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP023674 Escherichia coli strain SMN013SH2 plasmid pO177A2, complete sequence 56316-56347 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP015388 Klebsiella pneumoniae strain NY9 plasmid pNY9_3, complete sequence 78810-78841 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KJ201887 Shigella flexneri 4c strain 072 plasmid pSF07201, complete sequence 56105-56136 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_KX008967 Shigella sonnei strain 183660 plasmid p183660, complete sequence 88022-88053 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 LC163971 Escherichia coli O145:NM str. 12E70 plasmid pSTEC-O145-12E70-1 DNA, complete sequence, strain: 12E70 59477-59508 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP042943 Escherichia fergusonii strain ATCC 35471 plasmid pATCC-35471_1 27551-27582 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP013657 Escherichia coli strain uk_P46212 plasmid unnamed, complete sequence 104671-104702 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP037947 Escherichia coli strain CFSAN027346 plasmid pCFSAN027346-2, complete sequence 60994-61025 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP027364 Escherichia coli strain 88-3001 plasmid unnamed, complete sequence 16476-16507 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP023895 Escherichia coli strain FDAARGOS_433 plasmid unnamed2, complete sequence 18920-18951 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP017633 Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence 74567-74598 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP054455 Escherichia coli strain SCU-487 plasmid pSCU-487-1, complete sequence 76603-76634 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_014385 Escherichia coli plasmid pEC_L46, complete sequence 126799-126830 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_014384 Escherichia coli plasmid pEC_L8, complete sequence 70279-70310 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP025927 Escherichia coli strain 520873 plasmid p520873_29, complete sequence 18978-19009 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP025891 Escherichia coli strain 503046 plasmid p503046_32, complete sequence 11979-12010 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP025880 Escherichia coli strain 503458 plasmid p503458_46, complete sequence 28514-28545 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP032165 Klebsiella pneumoniae strain XJ-K1 plasmid unnamed2, complete sequence 30666-30697 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP042972 Escherichia coli strain CFSAN061769 plasmid pCFSAN061769_03, complete sequence 56846-56877 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP010120 Escherichia coli strain C3 plasmid A, complete sequence 35162-35193 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP043759 Escherichia coli strain CVM N55972 plasmid pN55972-1, complete sequence 102152-102183 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP032810 Escherichia coli strain ERL04-3476 plasmid pERL04-3476-2, complete sequence 50432-50463 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024129 Escherichia coli strain 14EC001 plasmid p14EC001b, complete sequence 83305-83336 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP027446 Escherichia coli strain 2013C-3492 plasmid unnamed, complete sequence 45484-45515 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_017640 Escherichia coli UMNK88 plasmid pUMNK88_Ent, complete sequence 32091-32122 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP016498 Escherichia coli strain UPEC 26-1 plasmid unnamed1, complete sequence 90955-90986 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024238 Escherichia coli O15:H11 strain 90-9272 plasmid unnamed 85179-85210 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024238 Escherichia coli O15:H11 strain 90-9272 plasmid unnamed 180891-180922 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 KX246267 Escherichia coli plasmid pHNHN21, complete sequence 71797-71828 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LR130554 Escherichia coli strain MS14386 isolate MS14386 plasmid 3 81494-81525 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP009167 Escherichia coli 1303 plasmid p1303_109, complete sequence 93307-93338 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024430 Klebsiella pneumoniae strain DA48896 plasmid p48896_1, complete sequence 80268-80299 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP054381 Escherichia coli strain SCU-175 plasmid pSCU-175-2, complete sequence 60013-60044 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_019424 Escherichia coli plasmid pFOS-HK151325, complete sequence 58949-58980 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP041111 Escherichia coli strain ECCTRSRTH03 plasmid unnamed1, complete sequence 38502-38533 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024237 Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed5, complete sequence 96011-96042 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP047577 Escherichia coli strain 94EC plasmid p94EC-1, complete sequence 77869-77900 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP015140 Escherichia coli strain Ecol_732 plasmid pEC732_2, complete sequence 106351-106382 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP050372 Klebsiella pneumoniae strain 50595 plasmid p50595_ERM, complete sequence 20181-20212 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP050367 Klebsiella pneumoniae strain 47733 plasmid p47733_NDM_5, complete sequence 84466-84497 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 KU578032 Escherichia coli plasmid pCERC4, complete sequence 65928-65959 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 KU695535 Escherichia coli plasmid pMEX01, complete sequence 59340-59371 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP010345 Escherichia coli ECC-1470 plasmid pECC-1470_100, complete sequence 89273-89304 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_019057 Escherichia coli plasmid pHK01, complete sequence 59470-59501 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_019073 Escherichia coli plasmid pHN7A8, complete sequence 66646-66677 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP029381 Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence 64705-64736 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP041363 Citrobacter amalonaticus strain 133355-SW-C4-Cam plasmid p133355_SW_C4_Cam-1, complete sequence 70110-70141 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP041358 Escherichia coli strain U1 plasmid unnamed1, complete sequence 78235-78266 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP018973 Escherichia coli strain Ecol_545 plasmid pEC545_3, complete sequence 37154-37185 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP023363 Escherichia coli strain 144 plasmid 134q, complete sequence 84613-84644 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP023367 Escherichia coli strain 1428 plasmid p111, complete sequence 100914-100945 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP023369 Escherichia coli strain 1428 plasmid p66, complete sequence 53883-53914 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP026141 Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence 154373-154404 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP026158 Klebsiella pneumoniae strain F93-2 plasmid pF93-2_1, complete sequence 57325-57356 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LS992194 Escherichia coli isolate Escherichia coli str. TO217 plasmid 3, complete sequence 43305-43336 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LS992169 Escherichia coli isolate Escherichia coli str. TO60 plasmid 2, complete sequence 72381-72412 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP049174 Shigella sonnei strain 19.0820.1561 plasmid p19-0820-1561, complete sequence 62808-62839 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP023918 Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed 44482-44513 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP023959 Escherichia coli strain FDAARGOS_448 plasmid unnamed1, complete sequence 36346-36377 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP042887 Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_03, complete sequence 57032-57063 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP043407 Escherichia coli strain NMBU-W13E19 plasmid pNMBU-W13E19_01, complete sequence 58379-58410 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP043408 Escherichia coli strain NMBU-W13E19 plasmid pNMBU-W13E19_02, complete sequence 55457-55488 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP023725 Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed3, complete sequence 83773-83804 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP047407 Escherichia coli strain MS6193 plasmid pMS6193B, complete sequence 50747-50778 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP054450 Escherichia coli strain SCU-488 plasmid pSCU-488-1, complete sequence 148443-148474 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP040541 Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence 53288-53319 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_013507 Escherichia coli ETEC H10407 plasmid pEntH10407, complete sequence 52450-52481 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_002134 Shigella flexneri 2b plasmid R100 DNA, complete sequence 77234-77265 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_002483 Escherichia coli K-12 plasmid F DNA, complete sequence 90788-90819 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP026584 Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence 69457-69488 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP045934 Shigella sonnei strain AUSMDU00010534 plasmid pAUSMDU00010534_02, complete sequence 69275-69306 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP023358 Escherichia coli strain 317 plasmid p100, complete sequence 45908-45939 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP027589 Escherichia coli strain 2014C-3011 plasmid unnamed1 40374-40405 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP011417 Escherichia coli strain CFSAN029787 plasmid pCFSAN029787_01, complete sequence 103197-103228 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP011418 Escherichia coli strain CFSAN029787 plasmid pCFSAN029787_02, complete sequence 8428-8459 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP013028 Escherichia coli strain 2012C-4227 plasmid unnamed1, complete sequence 36251-36282 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_017630 Escherichia coli UM146 plasmid pUM146, complete sequence 10286-10317 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP027554 Escherichia coli strain 2013C-3513 plasmid unnamed1 65095-65126 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP032205 Escherichia coli strain AR_0013 plasmid unnamed, complete sequence 65479-65510 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP048648 Escherichia coli strain GW-AmxH19 plasmid unnamed, complete sequence 69201-69232 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP034396 Escherichia coli strain CRE1 plasmid pCRE1.1, complete sequence 35895-35926 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP035722 Escherichia coli strain U15A plasmid pU15A_B, complete sequence 30514-30545 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP048440 Escherichia coli strain NBRC 3301 plasmid putative_pEcol1, complete sequence 45589-45620 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP029058 Escherichia coli strain FORC_081 plasmid pFORC_081_1, complete sequence 36977-37008 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP029058 Escherichia coli strain FORC_081 plasmid pFORC_081_1, complete sequence 245700-245731 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP050384 Escherichia coli strain 52148 plasmid p52148_NDM_5, complete sequence 30323-30354 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 MH061383 Pseudomonas aeruginosa plasmid pP6qnrS1, complete sequence 8322-8353 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP024268 Escherichia coli O6:H16 strain F6699 plasmid unnamed2 55958-55989 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP049186 Shigella sonnei strain 19.0821.3486 plasmid p19-0821-3486, complete sequence 77440-77471 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LR025097 Escherichia coli isolate EC-7215 plasmid 2, complete sequence 37482-37513 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_LS992191 Escherichia coli isolate Escherichia coli str. TO148 plasmid 2, complete sequence 117950-117981 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_006671 Escherichia coli A2363 plasmid pAPEC-O2-R, complete sequence 14759-14790 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_013542 Klebsiella pneumoniae plasmid pKF3-70, complete sequence 25843-25874 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_016039 Escherichia coli plasmid pHK17a, complete sequence 59331-59362 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP046285 Shigella sonnei strain FDAARGOS_715 plasmid unnamed1, complete sequence 15630-15661 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP023361 Escherichia coli strain 1943 plasmid p80, complete sequence 8301-8332 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP023354 Escherichia coli strain 746 plasmid p62, complete sequence 51998-52029 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP023355 Escherichia coli strain 746 plasmid p72, complete sequence 61309-61340 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP025677 Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence 11829-11860 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP027551 Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence 131311-131342 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 AP022364 Escherichia coli E309 plasmid pE309_IMP6 DNA, complete sequence 93495-93526 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 AP022366 Escherichia coli E312 plasmid pE312_IMP6 DNA, complete sequence 58380-58411 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 AP022368 Escherichia coli E318 plasmid pE318_IMP6 DNA, complete sequence 70879-70910 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 AP022369 Escherichia coli E319 plasmid pE319_IMP6 DNA, complete sequence 78560-78591 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP030283 Escherichia coli strain E308 plasmid pLKSZ02, complete sequence 98045-98076 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 MN823993 Klebsiella pneumoniae strain 20130907-4 plasmid p309074-2FII, complete sequence 57781-57812 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 MN822124 Escherichia coli strain 14E509 plasmid p14E509-1FII, complete sequence 54494-54525 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 MN822125 Escherichia coli strain 14E509 plasmid p14E509-2FII, complete sequence 17009-17040 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP053282 Escherichia coli strain SCU-308 plasmid pSCU-308-1, complete sequence 90045-90076 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_HG941719 Escherichia coli O25b:H4-ST131 strain EC958 plasmid pEC958, complete sequence 57504-57535 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_009133 Escherichia coli plasmid NR1, complete sequence 77233-77264 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NC_020271 Escherichia coli O25b:H4-ST131 str. EC958 strain ST131 plasmid pJIE186-2, complete sequence 69243-69274 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 CP000039 Shigella sonnei Ss046 plasmid pSS_046, complete sequence 167349-167380 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP028582 Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence 93912-93943 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP026576 Escherichia coli strain WCHEC005237 plasmid pCTX-M-55_005237, complete sequence 59707-59738 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP014668 Escherichia coli strain ECONIH2 plasmid pECO-bc6, complete sequence 91084-91115 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP010239 Escherichia coli strain S50 plasmid A, complete sequence 105922-105953 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP021871 Escherichia coli strain H105 plasmid pH105, complete sequence 68039-68070 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 AP022363 Escherichia coli E303 plasmid pE303_IMP6 DNA, complete sequence 72736-72767 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP015914 Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy2, complete sequence 19272-19303 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP032258 Escherichia coli strain AR_0067 plasmid unnamed1, complete sequence 120883-120914 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP032262 Escherichia coli strain AR_0067 plasmid unnamed4, complete sequence 33670-33701 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP036366 Klebsiella pneumoniae strain WCHKP115068 plasmid pCTXM65_115068, complete sequence 68991-69022 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 NZ_CP036367 Klebsiella pneumoniae strain WCHKP115068 plasmid pKPC12_115068, complete sequence 35696-35727 0 1.0
CP030783_2 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064640-3064671 32 MN865122 Escherichia coli strain SCNJ06 plasmid prmtB_SCNJ06, complete sequence 14332-14363 0 1.0
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP042249 Escherichia coli strain BCE049 plasmid pBCE049-3, complete sequence 21767-21798 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP042249 Escherichia coli strain BCE049 plasmid pBCE049-3, complete sequence 22676-22707 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 CP045935 Shigella sonnei strain AUSMDU00010534 plasmid pAUSMDU00010534_03, complete sequence 4795-4826 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 CP045935 Shigella sonnei strain AUSMDU00010534 plasmid pAUSMDU00010534_03, complete sequence 7701-7732 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP015845 Escherichia coli O157:H7 strain FRIK2455 plasmid p35K, complete sequence 1983-2014 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP053083 Escherichia coli strain HB37 plasmid pHB37-3, complete sequence 6136-6167 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG904994 Escherichia coli strain 14OD0056 plasmid p14ODV, complete sequence 27342-27373 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KX580716 Escherichia coli strain ZJ1635 plasmid unnamed, complete sequence 35921-35952 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KX580716 Escherichia coli strain ZJ1635 plasmid unnamed, complete sequence 36831-36862 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KX580716 Escherichia coli strain ZJ1635 plasmid unnamed, complete sequence 40517-40548 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KU934208 Escherichia coli strain HeN867 plasmid pHeN867, complete sequence 5484-5515 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KU934208 Escherichia coli strain HeN867 plasmid pHeN867, complete sequence 6394-6425 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KU934208 Escherichia coli strain HeN867 plasmid pHeN867, complete sequence 8392-8423 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KX013538 Escherichia coli strain ABC149 plasmid pABC149-MCR-1, complete sequence 5484-5515 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KX013538 Escherichia coli strain ABC149 plasmid pABC149-MCR-1, complete sequence 6394-6425 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KX013538 Escherichia coli strain ABC149 plasmid pABC149-MCR-1, complete sequence 8392-8423 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KX772778 Escherichia coli strain E15017_00 plasmid pE15017_00, complete sequence 10295-10326 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KX772778 Escherichia coli strain E15017_00 plasmid pE15017_00, complete sequence 11205-11236 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KX772778 Escherichia coli strain E15017_00 plasmid pE15017_00, complete sequence 13203-13234 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY120366 Salmonella enterica subsp. enterica serovar Typhimurium strain R150626 plasmid pR150626, complete sequence 52750-52781 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY120366 Salmonella enterica subsp. enterica serovar Typhimurium strain R150626 plasmid pR150626, complete sequence 54748-54779 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY120366 Salmonella enterica subsp. enterica serovar Typhimurium strain R150626 plasmid pR150626, complete sequence 55658-55689 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY075656 Escherichia coli strain WH13 plasmid pWH13-4, complete sequence 4988-5019 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY075656 Escherichia coli strain WH13 plasmid pWH13-4, complete sequence 5898-5929 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY075656 Escherichia coli strain WH13 plasmid pWH13-4, complete sequence 7896-7927 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY075650 Escherichia coli strain GD17 plasmid pGD17-2, complete sequence 4987-5018 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY075650 Escherichia coli strain GD17 plasmid pGD17-2, complete sequence 5897-5928 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY446064 Escherichia coli strain GD81 plasmid pGD81-1, complete sequence 45988-46019 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY446064 Escherichia coli strain GD81 plasmid pGD81-1, complete sequence 49873-49904 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY446064 Escherichia coli strain GD81 plasmid pGD81-1, complete sequence 51871-51902 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY471309 Escherichia coli strain M15224 plasmid pMCR-M15224, complete sequence 4989-5020 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY471309 Escherichia coli strain M15224 plasmid pMCR-M15224, complete sequence 5899-5930 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY471309 Escherichia coli strain M15224 plasmid pMCR-M15224, complete sequence 7897-7928 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY471145 Escherichia coli strain EC019 plasmid pEC019, complete sequence 6923-6954 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY471145 Escherichia coli strain EC019 plasmid pEC019, complete sequence 7833-7864 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY471145 Escherichia coli strain EC019 plasmid pEC019, complete sequence 9829-9860 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY471313 Escherichia coli strain M19441 plasmid pMCR-M19441, complete sequence 5117-5148 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY471313 Escherichia coli strain M19441 plasmid pMCR-M19441, complete sequence 8803-8834 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY471307 Escherichia coli strain GN775 plasmid pMCR-GN775, complete sequence 5129-5160 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY471307 Escherichia coli strain GN775 plasmid pMCR-GN775, complete sequence 6038-6069 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY471307 Escherichia coli strain GN775 plasmid pMCR-GN775, complete sequence 9374-9405 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY471312 Escherichia coli strain M19242 plasmid pMCR-M19242, complete sequence 5117-5148 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY471312 Escherichia coli strain M19242 plasmid pMCR-M19242, complete sequence 7115-7146 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY471311 Escherichia coli strain M19241 plasmid pMCR-M19241, complete sequence 5117-5148 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY471311 Escherichia coli strain M19241 plasmid pMCR-M19241, complete sequence 7115-7146 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY405001 Escherichia coli strain Ec28 plasmid pEC28, complete sequence 7984-8015 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY405001 Escherichia coli strain Ec28 plasmid pEC28, complete sequence 8894-8925 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY405001 Escherichia coli strain Ec28 plasmid pEC28, complete sequence 10892-10923 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY471308 Escherichia coli strain M15049 plasmid pMCR-M15049, complete sequence 5117-5148 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY471308 Escherichia coli strain M15049 plasmid pMCR-M15049, complete sequence 7115-7146 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY471310 Escherichia coli strain M17059 plasmid pMCR-M17059, complete sequence 5117-5148 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY471310 Escherichia coli strain M17059 plasmid pMCR-M17059, complete sequence 7115-7146 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY075658 Escherichia coli strain WH07 plasmid pWH07-3, complete sequence 4989-5020 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY075658 Escherichia coli strain WH07 plasmid pWH07-3, complete sequence 5897-5928 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY075658 Escherichia coli strain WH07 plasmid pWH07-3, complete sequence 9241-9272 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY075657 Escherichia coli strain WH09 plasmid pWH09-3, complete sequence 4989-5020 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY075657 Escherichia coli strain WH09 plasmid pWH09-3, complete sequence 5899-5930 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY075657 Escherichia coli strain WH09 plasmid pWH09-3, complete sequence 9243-9274 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KX032519 Escherichia coli strain Af23 isolate A plasmid pAF23, complete sequence 5531-5562 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KX032519 Escherichia coli strain Af23 isolate A plasmid pAF23, complete sequence 6443-6474 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KX032519 Escherichia coli strain Af23 isolate A plasmid pAF23, complete sequence 8441-8472 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY363997 Shigella sonnei strain SH11Sh418 plasmid pSh418-m3, complete sequence 7172-7203 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY363997 Shigella sonnei strain SH11Sh418 plasmid pSh418-m3, complete sequence 8082-8113 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY363997 Shigella sonnei strain SH11Sh418 plasmid pSh418-m3, complete sequence 10080-10111 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KP347127 Escherichia coli strain SHP45 plasmid pHNSHP45, complete sequence 8196-8227 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KP347127 Escherichia coli strain SHP45 plasmid pHNSHP45, complete sequence 9106-9137 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KP347127 Escherichia coli strain SHP45 plasmid pHNSHP45, complete sequence 11104-11135 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 CP043017 Escherichia coli strain 388808_gen plasmid unnamed2, complete sequence 41587-41618 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 CP043017 Escherichia coli strain 388808_gen plasmid unnamed2, complete sequence 43584-43615 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 CP043017 Escherichia coli strain 388808_gen plasmid unnamed2, complete sequence 44494-44525 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 CP043014 Escherichia coli strain 388755_gen plasmid unnamed3, complete sequence 723-754 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 CP043014 Escherichia coli strain 388755_gen plasmid unnamed3, complete sequence 2721-2752 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 CP043014 Escherichia coli strain 388755_gen plasmid unnamed3, complete sequence 48877-48908 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP042629 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-2, complete sequence 13795-13826 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP042629 Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-2, complete sequence 15693-15724 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_AP017614 Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_4, complete sequence 5484-5515 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_AP017614 Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_4, complete sequence 6394-6425 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_AP017614 Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_4, complete sequence 8392-8423 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 LC469775 Escherichia coli C1 plasmid pC1 DNA, complete sequence 4989-5020 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 LC469775 Escherichia coli C1 plasmid pC1 DNA, complete sequence 5899-5930 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 LC469775 Escherichia coli C1 plasmid pC1 DNA, complete sequence 7897-7928 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 LC473131 Escherichia coli C2 plasmid pC2 DNA, complete sequence 4989-5020 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 LC473131 Escherichia coli C2 plasmid pC2 DNA, complete sequence 5899-5930 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 LC473131 Escherichia coli C2 plasmid pC2 DNA, complete sequence 7897-7928 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP041625 Escherichia coli O157:H7 strain ATCC 43888 plasmid p35K_like, complete sequence 18222-18253 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP041625 Escherichia coli O157:H7 strain ATCC 43888 plasmid p35K_like, complete sequence 20119-20150 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP034405 Escherichia coli strain CRE10 plasmid pCRE10.3, complete sequence 58923-58954 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP034405 Escherichia coli strain CRE10 plasmid pCRE10.3, complete sequence 59833-59864 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY784668 Shigella flexneri Y strain C960 plasmid pRC960-2, complete sequence 59840-59871 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY784668 Shigella flexneri Y strain C960 plasmid pRC960-2, complete sequence 61838-61869 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY784668 Shigella flexneri Y strain C960 plasmid pRC960-2, complete sequence 62748-62779 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_AP017619 Escherichia coli strain MRY15-117 plasmid pMRY15-117_2, complete sequence 5484-5515 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_AP017619 Escherichia coli strain MRY15-117 plasmid pMRY15-117_2, complete sequence 6394-6425 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_AP017619 Escherichia coli strain MRY15-117 plasmid pMRY15-117_2, complete sequence 8392-8423 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP011294 Salmonella enterica subsp. diarizonae strain 11-01854 plasmid unnamed2, complete sequence 18015-18046 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP011294 Salmonella enterica subsp. diarizonae strain 11-01854 plasmid unnamed2, complete sequence 20012-20043 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP011294 Salmonella enterica subsp. diarizonae strain 11-01854 plasmid unnamed2, complete sequence 20919-20950 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP011291 Salmonella enterica subsp. diarizonae strain 11-01853 plasmid unnamed2, complete sequence 18065-18096 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP011291 Salmonella enterica subsp. diarizonae strain 11-01853 plasmid unnamed2, complete sequence 20062-20093 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP011291 Salmonella enterica subsp. diarizonae strain 11-01853 plasmid unnamed2, complete sequence 20969-21000 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP010220 Escherichia coli strain M18 plasmid A, complete sequence 34415-34446 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP010220 Escherichia coli strain M18 plasmid A, complete sequence 35322-35353 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP010220 Escherichia coli strain M18 plasmid A, complete sequence 37320-37351 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP028594 Escherichia coli strain 150 plasmid pTA150-2, complete sequence 27926-27957 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP028594 Escherichia coli strain 150 plasmid pTA150-2, complete sequence 29823-29854 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MK875287 Escherichia coli strain MFDS2054 plasmid pMFDS2054.1, complete sequence 58495-58526 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MK852553 Escherichia coli strain MFDS1339 plasmid pMFDS1339.1, complete sequence 24706-24737 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MK852553 Escherichia coli strain MFDS1339 plasmid pMFDS1339.1, complete sequence 26704-26735 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MK852553 Escherichia coli strain MFDS1339 plasmid pMFDS1339.1, complete sequence 27614-27645 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP034061 Shigella flexneri strain FDAARGOS_535 plasmid unnamed2 19848-19879 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP034061 Shigella flexneri strain FDAARGOS_535 plasmid unnamed2 21845-21876 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP034061 Shigella flexneri strain FDAARGOS_535 plasmid unnamed2 22752-22783 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP028153 Salmonella enterica subsp. enterica serovar Enteritidis str. RM2968 plasmid pRM2968-2, complete sequence 6201-6232 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP028153 Salmonella enterica subsp. enterica serovar Enteritidis str. RM2968 plasmid pRM2968-2, complete sequence 8199-8230 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP028155 Salmonella enterica subsp. enterica serovar Enteritidis strain RM4283 plasmid pRM4283-2, complete sequence 16663-16694 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP028155 Salmonella enterica subsp. enterica serovar Enteritidis strain RM4283 plasmid pRM4283-2, complete sequence 18661-18692 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP028155 Salmonella enterica subsp. enterica serovar Enteritidis strain RM4283 plasmid pRM4283-2, complete sequence 19570-19601 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP033341 Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN076214 plasmid pCFSAN076214_1, complete sequence 7665-7696 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP033341 Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN076214 plasmid pCFSAN076214_1, complete sequence 9663-9694 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP031550 Escherichia coli strain cq9 plasmid unnamed4, complete sequence 20129-20160 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP031550 Escherichia coli strain cq9 plasmid unnamed4, complete sequence 22127-22158 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP031550 Escherichia coli strain cq9 plasmid unnamed4, complete sequence 23037-23068 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MN232187 Escherichia coli plasmid pGD16-131, complete sequence 5473-5504 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MN232187 Escherichia coli plasmid pGD16-131, complete sequence 6383-6414 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MN232187 Escherichia coli plasmid pGD16-131, complete sequence 8381-8412 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MN232193 Escherichia coli plasmid pGD27-63, complete sequence 5484-5515 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MN232193 Escherichia coli plasmid pGD27-63, complete sequence 6394-6425 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MN232193 Escherichia coli plasmid pGD27-63, complete sequence 8392-8423 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MN232209 Escherichia coli plasmid pHLJ111-9, complete sequence 5484-5515 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MN232209 Escherichia coli plasmid pHLJ111-9, complete sequence 6394-6425 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MN232209 Escherichia coli plasmid pHLJ111-9, complete sequence 8392-8423 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MN232214 Escherichia fergusonii plasmid pHLJ179-85, complete sequence 5484-5515 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MN232214 Escherichia fergusonii plasmid pHLJ179-85, complete sequence 6394-6425 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MN232214 Escherichia fergusonii plasmid pHLJ179-85, complete sequence 8392-8423 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP020924 Salmonella enterica subsp. enterica strain 16A242 plasmid unnamed2, complete sequence 31735-31766 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP020924 Salmonella enterica subsp. enterica strain 16A242 plasmid unnamed2, complete sequence 33635-33666 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP020924 Salmonella enterica subsp. enterica strain 16A242 plasmid unnamed2, complete sequence 35534-35565 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 AP018412 Escherichia coli plasmid pRYU2912C-1 RYU 2912 DNA, complete sequence 4989-5020 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 AP018412 Escherichia coli plasmid pRYU2912C-1 RYU 2912 DNA, complete sequence 5899-5930 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 AP018412 Escherichia coli plasmid pRYU2912C-1 RYU 2912 DNA, complete sequence 7897-7928 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP037942 Escherichia coli strain CFSAN027350 plasmid pCFSAN027350, complete sequence 56111-56142 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP037942 Escherichia coli strain CFSAN027350 plasmid pCFSAN027350, complete sequence 58108-58139 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038409 Escherichia coli O157:H7 strain 86-24 plasmid p86-24-2, complete sequence 29406-29437 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038334 Escherichia coli O157:H7 strain N8B7-2 plasmid pN8B7-2 5330-5361 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038334 Escherichia coli O157:H7 strain N8B7-2 plasmid pN8B7-2 6239-6270 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038334 Escherichia coli O157:H7 strain N8B7-2 plasmid pN8B7-2 8237-8268 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038381 Escherichia coli O157:H7 strain E32511 plasmid pE32511-2 25450-25481 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038381 Escherichia coli O157:H7 strain E32511 plasmid pE32511-2 27448-27479 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 LT174530 Shigella sonnei plasmid pEG430-1, strain EG0430 5484-5515 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 LT174530 Shigella sonnei plasmid pEG430-1, strain EG0430 6394-6425 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 LT174530 Shigella sonnei plasmid pEG430-1, strain EG0430 8392-8423 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY363995 Shigella sonnei strain SH13Sh069 plasmid pSh069-m6, complete sequence 5484-5515 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY363995 Shigella sonnei strain SH13Sh069 plasmid pSh069-m6, complete sequence 6394-6425 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY363995 Shigella sonnei strain SH13Sh069 plasmid pSh069-m6, complete sequence 8392-8423 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY363999 Shigella sonnei strain SH10Sh016 plasmid pSh016-m1, complete sequence 7172-7203 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY363999 Shigella sonnei strain SH10Sh016 plasmid pSh016-m1, complete sequence 8082-8113 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY363999 Shigella sonnei strain SH10Sh016 plasmid pSh016-m1, complete sequence 10080-10111 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY363996 Shigella sonnei strain SH11Sh487 plasmid pSh487-m4, complete sequence 7197-7228 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY363996 Shigella sonnei strain SH11Sh487 plasmid pSh487-m4, complete sequence 8107-8138 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY363996 Shigella sonnei strain SH11Sh487 plasmid pSh487-m4, complete sequence 10105-10136 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY363998 Shigella sonnei strain SH11Sh125 plasmid pSh125-m2, complete sequence 5484-5515 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY363998 Shigella sonnei strain SH11Sh125 plasmid pSh125-m2, complete sequence 6394-6425 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY363998 Shigella sonnei strain SH11Sh125 plasmid pSh125-m2, complete sequence 8392-8423 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY363994 Shigella sonnei strain SH12Sh113 plasmid pSh113-m4, complete sequence 5484-5515 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY363994 Shigella sonnei strain SH12Sh113 plasmid pSh113-m4, complete sequence 6394-6425 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY363994 Shigella sonnei strain SH12Sh113 plasmid pSh113-m4, complete sequence 8392-8423 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP028605 Escherichia coli strain 144 plasmid pTA144-2, complete sequence 30374-30405 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP028605 Escherichia coli strain 144 plasmid pTA144-2, complete sequence 32271-32302 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP027334 Escherichia coli strain 2013C-3277 plasmid unnamed3 105645-105676 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP027334 Escherichia coli strain 2013C-3277 plasmid unnamed3 107642-107673 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP039587 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014859 plasmid p11-0225.2, complete sequence 23168-23199 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP039587 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014859 plasmid p11-0225.2, complete sequence 24078-24109 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 KX592672 Escherichia coli plasmid pEc_04HAE12, complete sequence 5484-5515 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 KX592672 Escherichia coli plasmid pEc_04HAE12, complete sequence 6394-6425 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 KX592672 Escherichia coli plasmid pEc_04HAE12, complete sequence 8392-8423 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038307 Escherichia coli O157:H7 strain SS NE 1040-1 plasmid pNE1040-3, complete sequence 28549-28580 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038307 Escherichia coli O157:H7 strain SS NE 1040-1 plasmid pNE1040-3, complete sequence 30445-30476 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038311 Escherichia coli O157:H7 strain Show KS 470-1 plasmid pKS470-3, complete sequence 30395-30426 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038311 Escherichia coli O157:H7 strain Show KS 470-1 plasmid pKS470-3, complete sequence 34122-34153 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038367 Escherichia coli O157:H7 strain F6667 plasmid pF6667-2, complete sequence 20546-20577 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038367 Escherichia coli O157:H7 strain F6667 plasmid pF6667-2, complete sequence 22443-22474 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP016388 Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid p931IncI2, complete sequence 21311-21342 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP016388 Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid p931IncI2, complete sequence 22221-22252 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP016388 Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid p931IncI2, complete sequence 24219-24250 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038303 Escherichia coli O157:H7 strain SS TX 313-1 plasmid pTX313-2, complete sequence 29519-29550 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038340 Escherichia coli O157:H7 strain H6437 plasmid pH6437-2 29063-29094 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038340 Escherichia coli O157:H7 strain H6437 plasmid pH6437-2 29972-30003 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038340 Escherichia coli O157:H7 strain H6437 plasmid pH6437-2 31970-32001 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038361 Escherichia coli O157:H7 strain F7386 plasmid pF7386-2 49798-49829 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038361 Escherichia coli O157:H7 strain F7386 plasmid pF7386-2 51796-51827 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MK836306 Escherichia coli strain NMG21 plasmid pMCR-NMG21, complete sequence 39824-39855 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MK836306 Escherichia coli strain NMG21 plasmid pMCR-NMG21, complete sequence 40734-40765 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MK836306 Escherichia coli strain NMG21 plasmid pMCR-NMG21, complete sequence 42732-42763 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP034798 Escherichia coli strain 08-3918 plasmid p08-3918-2 5737-5768 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP034798 Escherichia coli strain 08-3918 plasmid p08-3918-2 7735-7766 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP034798 Escherichia coli strain 08-3918 plasmid p08-3918-2 8644-8675 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_AP018806 Escherichia coli strain E2863 plasmid pE2863-4, complete sequence 5484-5515 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_AP018806 Escherichia coli strain E2863 plasmid pE2863-4, complete sequence 6394-6425 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_AP018806 Escherichia coli strain E2863 plasmid pE2863-4, complete sequence 8392-8423 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_AP018807 Escherichia coli strain E2863 plasmid pE2863-5, complete sequence 31789-31820 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_AP018807 Escherichia coli strain E2863 plasmid pE2863-5, complete sequence 33686-33717 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP040110 Escherichia coli O157:H7 strain MB9-1 plasmid pMB9_3, complete sequence 107-138 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP040110 Escherichia coli O157:H7 strain MB9-1 plasmid pMB9_3, complete sequence 1979-2010 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP021205 Escherichia coli strain Z1002 plasmid p1002-MCR1, complete sequence 33644-33675 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP021205 Escherichia coli strain Z1002 plasmid p1002-MCR1, complete sequence 35642-35673 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP021205 Escherichia coli strain Z1002 plasmid p1002-MCR1, complete sequence 36552-36583 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP007134 Escherichia coli O145:H28 str. RM12761 plasmid pRM12761, complete sequence 6429-6460 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP007134 Escherichia coli O145:H28 str. RM12761 plasmid pRM12761, complete sequence 7339-7370 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP008807 Escherichia coli O157:H7 str. SS17 plasmid pSS17, complete sequence 34137-34168 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP008807 Escherichia coli O157:H7 str. SS17 plasmid pSS17, complete sequence 36033-36064 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP006264 Escherichia coli O145:H28 str. RM13516 plasmid pRM13516, complete sequence 6429-6460 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP006264 Escherichia coli O145:H28 str. RM13516 plasmid pRM13516, complete sequence 7339-7370 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_AP018812 Escherichia coli strain E2865 plasmid pE2865-4, complete sequence 7172-7203 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_AP018812 Escherichia coli strain E2865 plasmid pE2865-4, complete sequence 8082-8113 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_AP018812 Escherichia coli strain E2865 plasmid pE2865-4, complete sequence 10078-10109 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP024858 Escherichia coli strain AR_0011 plasmid tig00013784_pilon, complete sequence 14491-14522 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP024858 Escherichia coli strain AR_0011 plasmid tig00013784_pilon, complete sequence 16489-16520 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 KU932022 Escherichia coli plasmid pEC3II_1, complete sequence 54987-55018 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 KU932022 Escherichia coli plasmid pEC3II_1, complete sequence 56985-57016 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 KU932023 Escherichia coli plasmid pEC3II_2, complete sequence 54987-55018 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 KU932023 Escherichia coli plasmid pEC3II_2, complete sequence 56985-57016 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP024156 Escherichia coli strain 14EC047 plasmid p14EC047a, complete sequence 34911-34942 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP024156 Escherichia coli strain 14EC047 plasmid p14EC047a, complete sequence 35820-35851 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP024156 Escherichia coli strain 14EC047 plasmid p14EC047a, complete sequence 37817-37848 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP024148 Escherichia coli strain 14EC033 plasmid p14EC033a, complete sequence 55701-55732 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP024148 Escherichia coli strain 14EC033 plasmid p14EC033a, complete sequence 57699-57730 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP024148 Escherichia coli strain 14EC033 plasmid p14EC033a, complete sequence 58608-58639 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_AP017622 Escherichia coli strain MRY15-131 plasmid pMRY15-131_2, complete sequence 5484-5515 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_AP017622 Escherichia coli strain MRY15-131 plasmid pMRY15-131_2, complete sequence 6394-6425 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_AP017622 Escherichia coli strain MRY15-131 plasmid pMRY15-131_2, complete sequence 8392-8423 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP019199 Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_02, complete sequence 38639-38670 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP019199 Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_02, complete sequence 40636-40667 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NC_019039 Escherichia coli plasmid pChi7122-3, complete sequence 6656-6687 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NC_019039 Escherichia coli plasmid pChi7122-3, complete sequence 7566-7597 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NC_019039 Escherichia coli plasmid pChi7122-3, complete sequence 9563-9594 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 23604-23635 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 25501-25532 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP041113 Escherichia coli strain ECCTRSRTH03 plasmid unnamed3, complete sequence 4989-5020 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP041113 Escherichia coli strain ECCTRSRTH03 plasmid unnamed3, complete sequence 5899-5930 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP041113 Escherichia coli strain ECCTRSRTH03 plasmid unnamed3, complete sequence 7897-7928 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MN746291 Escherichia coli strain GN2982 plasmid p25, complete sequence 4989-5020 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MN746291 Escherichia coli strain GN2982 plasmid p25, complete sequence 5899-5930 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MN746291 Escherichia coli strain GN2982 plasmid p25, complete sequence 7897-7928 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP026644 Escherichia coli strain FORC_082 plasmid pFORC82_3, complete sequence 29711-29742 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP026644 Escherichia coli strain FORC_082 plasmid pFORC82_3, complete sequence 31708-31739 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP026644 Escherichia coli strain FORC_082 plasmid pFORC82_3, complete sequence 32617-32648 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP026644 Escherichia coli strain FORC_082 plasmid pFORC82_3, complete sequence 34754-34785 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP026644 Escherichia coli strain FORC_082 plasmid pFORC82_3, complete sequence 35663-35694 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NC_002525 Escherichia coli K-12 plasmid R721, complete sequence 7643-7674 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NC_002525 Escherichia coli K-12 plasmid R721, complete sequence 9641-9672 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP027450 Escherichia coli strain 2014C-3097 plasmid unnamed1, complete sequence 18980-19011 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP027450 Escherichia coli strain 2014C-3097 plasmid unnamed1, complete sequence 20880-20911 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NC_011351 Escherichia coli O157:H7 str. EC4115 plasmid pEC4115, complete sequence 34142-34173 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NC_011351 Escherichia coli O157:H7 str. EC4115 plasmid pEC4115, complete sequence 36038-36069 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP042885 Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_01, complete sequence 14085-14116 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP042888 Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_04, complete sequence 4989-5020 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP042888 Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_04, complete sequence 5898-5929 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP042888 Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_04, complete sequence 7896-7927 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP034400 Escherichia coli strain CRE1 plasmid pCRE1.3, complete sequence 25109-25140 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP034400 Escherichia coli strain CRE1 plasmid pCRE1.3, complete sequence 26019-26050 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP034400 Escherichia coli strain CRE1 plasmid pCRE1.3, complete sequence 28016-28047 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP030284 Escherichia coli strain E308 plasmid pLKSZ03, complete sequence 41849-41880 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP030284 Escherichia coli strain E308 plasmid pLKSZ03, complete sequence 43846-43877 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP030284 Escherichia coli strain E308 plasmid pLKSZ03, complete sequence 44756-44787 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MG557851 Escherichia coli plasmid PN21, complete sequence 48718-48749 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MG557851 Escherichia coli plasmid PN21, complete sequence 49628-49659 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MG557851 Escherichia coli plasmid PN21, complete sequence 51626-51657 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 KX856067 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pHSSH22-MCR1, complete sequence 6197-6228 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 KX856067 Salmonella enterica subsp. enterica serovar Typhimurium plasmid pHSSH22-MCR1, complete sequence 8195-8226 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 KX856068 Salmonella enterica subsp. enterica serovar Enteritidis plasmid pHSSH23-MCR1, complete sequence 4978-5009 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 KX856068 Salmonella enterica subsp. enterica serovar Enteritidis plasmid pHSSH23-MCR1, complete sequence 5888-5919 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 KX856068 Salmonella enterica subsp. enterica serovar Enteritidis plasmid pHSSH23-MCR1, complete sequence 7886-7917 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 KY657477 Klebsiella aerogenes plasmid pCRENT-301_1, complete sequence 51583-51614 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 KY657477 Klebsiella aerogenes plasmid pCRENT-301_1, complete sequence 52493-52524 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 KY657477 Klebsiella aerogenes plasmid pCRENT-301_1, complete sequence 54491-54522 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP022051 Escherichia coli O157 strain FDAARGOS_293 plasmid unnamed1, complete sequence 12715-12746 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP022051 Escherichia coli O157 strain FDAARGOS_293 plasmid unnamed1, complete sequence 14614-14645 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP019052 Escherichia coli strain CRE1540 plasmid p1540-1, complete sequence 10790-10821 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP019052 Escherichia coli strain CRE1540 plasmid p1540-1, complete sequence 11700-11731 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP019052 Escherichia coli strain CRE1540 plasmid p1540-1, complete sequence 13698-13729 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038317 Escherichia coli O157:H7 strain NE92 plasmid pNE92-2, complete sequence 30744-30775 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP029977 Escherichia coli strain 51008369SK1 plasmid p51008369SK1_D, complete sequence 20820-20851 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP029977 Escherichia coli strain 51008369SK1 plasmid p51008369SK1_D, complete sequence 22146-22177 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP029977 Escherichia coli strain 51008369SK1 plasmid p51008369SK1_D, complete sequence 24143-24174 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP041921 Escherichia coli strain Ec40743 plasmid unnamed2, complete sequence 44078-44109 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP041921 Escherichia coli strain Ec40743 plasmid unnamed2, complete sequence 44988-45019 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP041921 Escherichia coli strain Ec40743 plasmid unnamed2, complete sequence 46986-47017 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP041926 Klebsiella aerogenes strain Ka37751 plasmid unnamed1, complete sequence 47359-47390 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP041926 Klebsiella aerogenes strain Ka37751 plasmid unnamed1, complete sequence 49357-49388 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP041926 Klebsiella aerogenes strain Ka37751 plasmid unnamed1, complete sequence 50267-50298 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP051226 Escherichia coli strain SCZE5 plasmid pSCZE4 4989-5020 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP051226 Escherichia coli strain SCZE5 plasmid pSCZE4 5899-5930 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP051226 Escherichia coli strain SCZE5 plasmid pSCZE4 7897-7928 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP018106 Escherichia coli strain MRSN352231 plasmid pMR0716_mcr1, complete sequence 4816-4847 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP018106 Escherichia coli strain MRSN352231 plasmid pMR0716_mcr1, complete sequence 5725-5756 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP018106 Escherichia coli strain MRSN352231 plasmid pMR0716_mcr1, complete sequence 9061-9092 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP016405 Escherichia coli strain 210205630 plasmid pSLy21, complete sequence 4989-5020 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP016405 Escherichia coli strain 210205630 plasmid pSLy21, complete sequence 5899-5930 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP016405 Escherichia coli strain 210205630 plasmid pSLy21, complete sequence 7897-7928 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP031296 Escherichia coli strain EC17GD31 plasmid pGD31-MCR, complete sequence 5484-5515 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP031296 Escherichia coli strain EC17GD31 plasmid pGD31-MCR, complete sequence 7482-7513 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP018124 Escherichia coli strain MRSN346355 plasmid pMRSN346355_65.5, complete sequence 4816-4847 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP018124 Escherichia coli strain MRSN346355 plasmid pMRSN346355_65.5, complete sequence 5725-5756 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP018124 Escherichia coli strain MRSN346355 plasmid pMRSN346355_65.5, complete sequence 9061-9092 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH213346 Escherichia coli strain EC1188 plasmid pEC1188-MCR, complete sequence 10530-10561 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH213346 Escherichia coli strain EC1188 plasmid pEC1188-MCR, complete sequence 11440-11471 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH213346 Escherichia coli strain EC1188 plasmid pEC1188-MCR, complete sequence 13437-13468 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG210940 Escherichia coli strain GZ49273 plasmid pGZ49273, complete sequence 4989-5020 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG210940 Escherichia coli strain GZ49273 plasmid pGZ49273, complete sequence 5898-5929 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG210940 Escherichia coli strain GZ49273 plasmid pGZ49273, complete sequence 7896-7927 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MF175187 Escherichia coli strain PC11 plasmid pPC11, complete sequence 5936-5967 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MF175187 Escherichia coli strain PC11 plasmid pPC11, complete sequence 11644-11675 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG489944 Escherichia coli strain PN16 plasmid unnamed, complete sequence 48217-48248 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG489944 Escherichia coli strain PN16 plasmid unnamed, complete sequence 49127-49158 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG489944 Escherichia coli strain PN16 plasmid unnamed, complete sequence 51125-51156 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG825369 Escherichia coli strain 974 plasmid p974-MCR, complete sequence 35943-35974 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG825369 Escherichia coli strain 974 plasmid p974-MCR, complete sequence 36853-36884 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG825369 Escherichia coli strain 974 plasmid p974-MCR, complete sequence 40200-40231 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG598815 Escherichia coli isolate 4070 plasmid p4070, complete sequence 4989-5020 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG598815 Escherichia coli isolate 4070 plasmid p4070, complete sequence 5899-5930 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG598815 Escherichia coli isolate 4070 plasmid p4070, complete sequence 7897-7928 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG594798 Escherichia coli strain 6383 plasmid p6383, complete sequence 5117-5148 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG594798 Escherichia coli strain 6383 plasmid p6383, complete sequence 7115-7146 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG598816 Escherichia coli isolate 979 plasmid p979, complete sequence 4989-5020 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG598816 Escherichia coli isolate 979 plasmid p979, complete sequence 5899-5930 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG598816 Escherichia coli isolate 979 plasmid p979, complete sequence 7897-7928 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG515249 Escherichia coli strain EC16-50 plasmid pEC16-50-MCR, complete sequence 10295-10326 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG515249 Escherichia coli strain EC16-50 plasmid pEC16-50-MCR, complete sequence 11205-11236 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG515249 Escherichia coli strain EC16-50 plasmid pEC16-50-MCR, complete sequence 13203-13234 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG594799 Escherichia coli isolate 4222 plasmid p4222, complete sequence 4989-5020 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG594799 Escherichia coli isolate 4222 plasmid p4222, complete sequence 5899-5930 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG594799 Escherichia coli isolate 4222 plasmid p4222, complete sequence 7897-7928 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH522409 Salmonella enterica subsp. enterica serovar Typhimurium strain SH12G402 plasmid pSH12G402, complete sequence 6985-7016 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH522409 Salmonella enterica subsp. enterica serovar Typhimurium strain SH12G402 plasmid pSH12G402, complete sequence 7895-7926 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH522409 Salmonella enterica subsp. enterica serovar Typhimurium strain SH12G402 plasmid pSH12G402, complete sequence 9892-9923 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH522410 Salmonella enterica subsp. enterica serovar Typhimurium strain SH12G950 plasmid pSH12G950, complete sequence 37596-37627 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH522410 Salmonella enterica subsp. enterica serovar Typhimurium strain SH12G950 plasmid pSH12G950, complete sequence 38506-38537 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH522410 Salmonella enterica subsp. enterica serovar Typhimurium strain SH12G950 plasmid pSH12G950, complete sequence 40504-40535 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH522411 Salmonella enterica subsp. enterica serovar Typhimurium strain SH13G841 plasmid pSH13G841, complete sequence 20628-20659 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH522411 Salmonella enterica subsp. enterica serovar Typhimurium strain SH13G841 plasmid pSH13G841, complete sequence 22626-22657 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH522411 Salmonella enterica subsp. enterica serovar Typhimurium strain SH13G841 plasmid pSH13G841, complete sequence 23536-23567 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH522416 Salmonella enterica subsp. enterica serovar Typhimurium strain SH15G1531 plasmid pSH15G1531, complete sequence 21777-21808 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH522416 Salmonella enterica subsp. enterica serovar Typhimurium strain SH15G1531 plasmid pSH15G1531, complete sequence 23775-23806 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH522416 Salmonella enterica subsp. enterica serovar Typhimurium strain SH15G1531 plasmid pSH15G1531, complete sequence 24685-24716 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH271383 Escherichia coli strain V80 plasmid mcr-1_pV80_dog, complete sequence 19616-19647 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH271383 Escherichia coli strain V80 plasmid mcr-1_pV80_dog, complete sequence 21614-21645 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH271383 Escherichia coli strain V80 plasmid mcr-1_pV80_dog, complete sequence 22523-22554 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH522414 Salmonella enterica subsp. enterica serovar Typhimurium strain SH15G1493 plasmid pSH15G1493, complete sequence 35473-35504 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH522414 Salmonella enterica subsp. enterica serovar Typhimurium strain SH15G1493 plasmid pSH15G1493, complete sequence 36383-36414 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH522414 Salmonella enterica subsp. enterica serovar Typhimurium strain SH15G1493 plasmid pSH15G1493, complete sequence 38381-38412 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH522415 Salmonella enterica subsp. enterica serovar Typhimurium strain SH15G1527 plasmid pSH15G1527, complete sequence 25246-25277 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH522415 Salmonella enterica subsp. enterica serovar Typhimurium strain SH15G1527 plasmid pSH15G1527, complete sequence 27244-27275 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH522415 Salmonella enterica subsp. enterica serovar Typhimurium strain SH15G1527 plasmid pSH15G1527, complete sequence 28154-28185 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MK041211 Citrobacter amalonaticus strain M21015 plasmid pMCR-M21015, complete sequence 4989-5020 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MK041211 Citrobacter amalonaticus strain M21015 plasmid pMCR-M21015, complete sequence 5899-5930 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MK041211 Citrobacter amalonaticus strain M21015 plasmid pMCR-M21015, complete sequence 7897-7928 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY802014 Escherichia coli strain ZE36 plasmid pZE36, complete sequence 10102-10133 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY802014 Escherichia coli strain ZE36 plasmid pZE36, complete sequence 11012-11043 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY802014 Escherichia coli strain ZE36 plasmid pZE36, complete sequence 13010-13041 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY795977 Escherichia coli strain JIE2288 plasmid pJIE2288-1, complete sequence 5484-5515 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY795977 Escherichia coli strain JIE2288 plasmid pJIE2288-1, complete sequence 6394-6425 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KY795977 Escherichia coli strain JIE2288 plasmid pJIE2288-1, complete sequence 8392-8423 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MF521836 Escherichia coli str. K-12 substr. MG1655 strain K-12 plasmid TP114, complete sequence 47668-47699 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MF521836 Escherichia coli str. K-12 substr. MG1655 strain K-12 plasmid TP114, complete sequence 49665-49696 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MF521836 Escherichia coli str. K-12 substr. MG1655 strain K-12 plasmid TP114, complete sequence 50574-50605 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG747472 Klebsiella pneumoniae strain 09-20 plasmid pK09-20-mcr-1, complete sequence 27472-27503 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG747472 Klebsiella pneumoniae strain 09-20 plasmid pK09-20-mcr-1, complete sequence 29470-29501 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG747472 Klebsiella pneumoniae strain 09-20 plasmid pK09-20-mcr-1, complete sequence 30380-30411 1 0.969
CP030783_2 2.4|3064518|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064518-3064549 32 MN927225 Escherichia phage vB_EcoS_XY1, complete genome 9516-9547 1 0.969
CP030783_2 2.4|3064518|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064518-3064549 32 MG252615 Escherichia phage vB_EcoS_HSE2, complete genome 34819-34850 1 0.969
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP021754 Klebsiella pneumoniae strain AR_0113 plasmid unitig_3, complete sequence 41986-42017 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP011978 Klebsiella pneumoniae DMC1097 plasmid pDMC1097-77.775kb, complete sequence 7740-7771 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_LS992189 Escherichia coli isolate Escherichia coli str. 3426 plasmid 5 40767-40798 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP021546 Klebsiella pneumoniae strain AR_0112 plasmid tig00000002, complete sequence 42921-42952 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP021861 Klebsiella pneumoniae strain AR_0125 plasmid tig00000009_pilon, complete sequence 36932-36963 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP011645 Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-78, complete sequence 7752-7783 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NC_022520 Klebsiella pneumoniae plasmid pBK15692, complete sequence 7789-7820 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP028153 Salmonella enterica subsp. enterica serovar Enteritidis str. RM2968 plasmid pRM2968-2, complete sequence 5292-5323 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP033341 Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN076214 plasmid pCFSAN076214_1, complete sequence 6756-6787 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038381 Escherichia coli O157:H7 strain E32511 plasmid pE32511-2 28357-28388 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP039587 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014859 plasmid p11-0225.2, complete sequence 21170-21201 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038361 Escherichia coli O157:H7 strain F7386 plasmid pF7386-2 52705-52736 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP007134 Escherichia coli O145:H28 str. RM12761 plasmid pRM12761, complete sequence 9337-9368 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP006264 Escherichia coli O145:H28 str. RM13516 plasmid pRM13516, complete sequence 9337-9368 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP024858 Escherichia coli strain AR_0011 plasmid tig00013784_pilon, complete sequence 17398-17429 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 KU932022 Escherichia coli plasmid pEC3II_1, complete sequence 54078-54109 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 KU932023 Escherichia coli plasmid pEC3II_2, complete sequence 54078-54109 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NC_002525 Escherichia coli K-12 plasmid R721, complete sequence 6734-6765 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP029977 Escherichia coli strain 51008369SK1 plasmid p51008369SK1_D, complete sequence 25052-25083 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MF175187 Escherichia coli strain PC11 plasmid pPC11, complete sequence 5026-5057 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP027455 Escherichia coli strain 2014C-4423 plasmid unnamed1, complete sequence 43531-43562 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP023367 Escherichia coli strain 1428 plasmid p111, complete sequence 23440-23471 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MK416152 Escherichia coli strain 6BS17eCTX plasmid pHNBS17e, complete sequence 16279-16310 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP024283 Escherichia albertii strain 2014C-4356 plasmid unnamed1, complete sequence 16000-16031 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP024283 Escherichia albertii strain 2014C-4356 plasmid unnamed1, complete sequence 18141-18172 2 0.938
CP030783_2 2.4|3064518|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064518-3064549 32 NC_042084 Escherichia phage VB_EcoS-Golestan, complete genome 13763-13794 2 0.938
CP030783_2 2.4|3064518|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064518-3064549 32 MK737937 Raoultella phage RP180, complete genome 15642-15673 2 0.938
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_KX276657 Escherichia coli strain MRSN388634 plasmid pMR0516mcr, complete sequence 149599-149630 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP010232 Escherichia coli strain S30 plasmid A, complete sequence 132818-132849 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_AP023192 Escherichia coli strain TUM18530 plasmid pMTY18530-2, complete sequence 13575-13606 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP038182 Escherichia coli strain 2 HS-C plasmid p2HS-C-2, complete sequence 81268-81299 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP053732 Escherichia coli strain CP55_Sichuan plasmid pCP55-IncFIB, complete sequence 40107-40138 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_LS999561 Escherichia coli isolate EC-TO143 plasmid 2, complete sequence 59076-59107 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_LS992167 Escherichia coli isolate Escherichia coli str. TO6 plasmid 2, complete sequence 86635-86666 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NC_010488 Escherichia coli SMS-3-5 plasmid pSMS35_130, complete sequence 80065-80096 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP019282 Escherichia coli strain 13P484A plasmid p13P484A-2, complete sequence 51935-51966 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP034739 Escherichia coli strain L65 plasmid pL65-2, complete sequence 57391-57422 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP051220 Escherichia coli strain SFE8 plasmid pSCZP1, complete sequence 42457-42488 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP054364 Escherichia coli strain SCU-171 plasmid pSCU-171-1, complete sequence 41913-41944 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP054364 Escherichia coli strain SCU-171 plasmid pSCU-171-1, complete sequence 59134-59165 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP021728 Escherichia coli strain Combat11I9 plasmid pCombat11I9-2, complete sequence 56761-56792 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP049082 Escherichia coli strain p10A plasmid p10A_p1, complete sequence 10988-11019 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MN158992 Escherichia coli strain TREC9 plasmid pTREC9, complete sequence 52340-52371 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP019247 Escherichia coli strain Combat13F7 plasmid pCombat13F7-2, complete sequence 51745-51776 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP029243 Escherichia coli strain ECCRA-119 plasmid pTB201, complete sequence 119694-119725 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP029748 Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence 253760-253791 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 CM019851 Escherichia coli strain CVM N17EC0326 plasmid pN17EC0326-1, complete sequence, whole genome shotgun sequence 65476-65507 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP041434 Escherichia coli strain STEC313 plasmid pSTEC313, complete sequence 77726-77757 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP041430 Escherichia coli strain STEC367 plasmid pSTEC367, complete sequence 22387-22418 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 LT906556 Escherichia coli isolate E. coli RL465 genome assembly, plasmid: I 31003-31034 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP032263 Escherichia coli strain AR_0089 plasmid unnamed1, complete sequence 94042-94073 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MN158991 Escherichia coli strain TREC8 plasmid pTREC8, complete sequence 42105-42136 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP053236 Escherichia coli strain SCU-106 plasmid pSCU-106-2, complete sequence 13010-13041 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP044347 Escherichia coli strain P225M plasmid pP225M-CTX-M-55, complete sequence 123022-123053 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP027357 Escherichia coli strain 2013C-4991 plasmid unnamed2 21343-21374 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP041424 Escherichia coli strain STEC409 plasmid pSTEC409_2, complete sequence 34975-35006 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP041432 Escherichia coli strain STEC316 plasmid pSTEC316, complete sequence 62004-62035 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP019007 Escherichia coli strain Ecol_AZ159 plasmid pECAZ159_1, complete sequence 69912-69943 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP011916 Escherichia coli strain PSUO2 plasmid pPSUO2, complete sequence 72452-72483 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP012500 Escherichia coli strain 09-00049 plasmid pCFSAN004180G, complete sequence 100324-100355 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP012501 Escherichia coli strain 08-00022 plasmid pCFSAN004179G, complete sequence 180024-180055 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP047878 Escherichia coli strain LD22-1 plasmid pLD22-1-135kb, complete sequence 37917-37948 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP046718 Escherichia coli strain T16R plasmid pT16R-2, complete sequence 36795-36826 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP041303 Escherichia coli strain MSHS 133 plasmid pCys-11, complete sequence 107247-107278 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NC_011964 Escherichia coli plasmid pAPEC-O103-ColBM, complete sequence 51747-51778 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP024852 Escherichia coli strain AR_0006 plasmid tig00000164, complete sequence 156116-156147 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP022732 Escherichia coli strain SA186 plasmid pSA186_3, complete sequence 47581-47612 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_LT985319 Escherichia coli strain ECOR 30 genome assembly, plasmid: RCS96_pII 84642-84673 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_AP019676 Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-1, complete sequence 37995-38026 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP051739 Escherichia coli strain SCU-105 plasmid pSCU-105-1, complete sequence 103680-103711 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP012377 Escherichia coli strain GE3 isolate human faeces plasmid pGE3, complete sequence 31133-31164 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP024827 Escherichia coli strain CREC-544 plasmid pCREC-544_1, complete sequence 19383-19414 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP024158 Escherichia coli strain 14EC047 plasmid p14EC047c, complete sequence 39093-39124 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NC_025175 Escherichia coli plasmid pH2332-166, complete sequence 121588-121619 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NC_025139 Escherichia coli plasmid pH2291-144, complete sequence 59295-59326 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP042296 Escherichia coli strain RM9088 plasmid p1RM9088, complete sequence 154079-154110 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP010149 Escherichia coli strain D6 plasmid A, complete sequence 124245-124276 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MN158989 Escherichia coli strain TREC1 plasmid pTREC1, complete sequence 52349-52380 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP041301 Escherichia coli strain MSHS 472 plasmid pCys-6, complete sequence 67888-67919 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP047577 Escherichia coli strain 94EC plasmid p94EC-1, complete sequence 119556-119587 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP042586 Escherichia coli strain LD91-1 plasmid pLD91-1-146kb, complete sequence 37917-37948 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NC_010409 Escherichia coli plasmid pVM01, complete sequence 63862-63893 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 CP043743 Escherichia coli strain CVM N17EC0211 plasmid pN17EC0211, complete sequence 98607-98638 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MN419430 Escherichia coli strain 2016-4017437 plasmid p17437, complete sequence 149195-149226 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP012499 Escherichia coli strain GB089 plasmid pCFSAN004181P, complete sequence 198697-198728 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP030282 Escherichia coli strain E308 plasmid pLKSZ01, complete sequence 83949-83980 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NC_020271 Escherichia coli O25b:H4-ST131 str. EC958 strain ST131 plasmid pJIE186-2, complete sequence 92579-92610 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MN848327 Escherichia coli strain T16RC plasmid pT16RC-1, complete sequence 55581-55612 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 MN823988 Escherichia coli strain 14406 plasmid p14406-FII, complete sequence 61767-61798 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP047667 Escherichia coli strain LD26-1 plasmid pLD26-1-135kb, complete sequence 102197-102228 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP048026 Escherichia coli strain GZEC065 plasmid pTEM1-GZEC065, complete sequence 63470-63501 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_AP023199 Escherichia coli strain TUM18780 plasmid pMTY18780-2, complete sequence 13575-13606 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP041920 Escherichia coli strain Ec40743 plasmid unnamed1, complete sequence 41875-41906 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP051224 Escherichia coli strain SCZE5 plasmid pSCZE2 33527-33558 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP029842 Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081B, complete sequence 10503-10534 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP041997 Escherichia coli strain AR Bank #0349 plasmid pAR349, complete sequence 266881-266912 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NC_014615 Escherichia coli plasmid pETN48, complete sequence 112997-113028 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 CP027377 Escherichia coli strain 2013C-4404 plasmid unnamed1, complete sequence 39815-39846 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP024140 Escherichia coli strain 14EC020 plasmid p14EC020b, complete sequence 14858-14889 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP024137 Escherichia coli strain 14EC017 plasmid p14EC017c, complete sequence 102051-102082 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP031295 Escherichia coli strain EC17GD31 plasmid pGD31-F1928, complete sequence 162478-162509 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NC_017659 Escherichia coli O83:H1 str. NRG 857C plasmid pO83_CORR, complete sequence 15952-15983 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MK430046 Escherichia coli strain 11.4-R4 plasmid pCERC13, complete sequence 26430-26461 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MK416151 Escherichia coli strain 6TC9eCTX plasmid pHNTC9e, complete sequence 103271-103302 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MN053930 Escherichia coli strain 2.3-R4 plasmid pCERC14, complete sequence 37854-37885 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MH580302 Escherichia coli strain 1107 plasmid p1107-118K, complete sequence 26082-26113 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG014722 Escherichia coli strain P2-3 plasmid pP2-3T, complete sequence 213803-213834 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MF474175 Escherichia coli strain J53/pNIT-HK plasmid pNIT-HK, complete sequence 80005-80036 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MF589339 Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence 122098-122129 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MF174860 Escherichia coli strain 6/14/6b plasmid pIncF-MU4, complete sequence 14308-14339 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG385063 Escherichia coli strain WF5-29 plasmid pWF5-29, complete sequence 161692-161723 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_MG838205 Escherichia coli strain 92944 plasmid p92944-mph, complete sequence 42955-42986 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 CP043741 Escherichia coli strain CVM N17EC0320 plasmid pN17EC0320-2, complete sequence 30745-30776 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NC_009837 Escherichia coli APEC O1 plasmid pAPEC-O1-ColBM, complete sequence 103147-103178 3 0.906
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP012498 Escherichia coli strain 06-00048 plasmid pCFSAN004178P_02, complete sequence 70075-70106 4 0.875
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP024150 Escherichia coli strain 14EC033 plasmid p14EC033c, complete sequence 79549-79580 4 0.875
CP030783_2 2.3|3064457|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064457-3064488 32 NZ_CP051699 Escherichia coli strain SCU-152 plasmid pSCU-152-1, complete sequence 36274-36305 7 0.781
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NC_005247 Erwinia amylovora UTRJ2 plasmid pEU30, complete sequence 23539-23570 8 0.75
CP030783_2 2.4|3064518|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064518-3064549 32 NZ_CP024789 Nostoc flagelliforme CCNUN1 plasmid pNFSY04, complete sequence 49181-49212 8 0.75
CP030783_2 2.1|3064335|32|CP030783|CRT 3064335-3064366 32 MF417888 Uncultured Caudovirales phage clone 9S_3, partial genome 20471-20502 9 0.719
CP030783_2 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064396-3064427 32 NZ_CP049355 Escherichia coli strain T28R plasmid pT28R-2, complete sequence 33524-33555 10 0.688
CP030783_2 2.3|3064457|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064457-3064488 32 NZ_CP039965 Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence 1463587-1463618 10 0.688
CP030783_2 2.7|3064701|32|CP030783|CRT,PILER-CR,CRISPRCasFinder 3064701-3064732 32 NZ_CP031608 Xanthomonas hortorum strain VT106 plasmid pVT106, complete sequence 13694-13725 10 0.688
CP030783_1 1.1|2731858|54|CP030783|CRISPRCasFinder 2731858-2731911 54 NZ_CP019906 Escherichia coli strain MDR_56 plasmid unnamed5, complete sequence 2754-2807 12 0.778
CP030783_1 1.1|2731858|54|CP030783|CRISPRCasFinder 2731858-2731911 54 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24815-24868 12 0.778

1. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021754 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_3, complete sequence) position: , mismatch: 0, identity: 1.0

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgtcggg	Protospacer
********************************

2. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011978 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-77.775kb, complete sequence) position: , mismatch: 0, identity: 1.0

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgtcggg	Protospacer
********************************

3. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS992189 (Escherichia coli isolate Escherichia coli str. 3426 plasmid 5) position: , mismatch: 0, identity: 1.0

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgtcggg	Protospacer
********************************

4. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038337 (Escherichia coli O157:H7 strain LSU61 plasmid pLSU61-2, complete sequence) position: , mismatch: 0, identity: 1.0

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgtcggg	Protospacer
********************************

5. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038337 (Escherichia coli O157:H7 strain LSU61 plasmid pLSU61-2, complete sequence) position: , mismatch: 0, identity: 1.0

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgtcggg	Protospacer
********************************

6. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021546 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000002, complete sequence) position: , mismatch: 0, identity: 1.0

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgtcggg	Protospacer
********************************

7. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP007599 (Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 plasmid pCFSAN000111_01, complete sequence) position: , mismatch: 0, identity: 1.0

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgtcggg	Protospacer
********************************

8. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP007599 (Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 plasmid pCFSAN000111_01, complete sequence) position: , mismatch: 0, identity: 1.0

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgtcggg	Protospacer
********************************

9. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042249 (Escherichia coli strain BCE049 plasmid pBCE049-3, complete sequence) position: , mismatch: 0, identity: 1.0

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgtcggg	Protospacer
********************************

10. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP045935 (Shigella sonnei strain AUSMDU00010534 plasmid pAUSMDU00010534_03, complete sequence) position: , mismatch: 0, identity: 1.0

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgtcggg	Protospacer
********************************

11. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021861 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000009_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgtcggg	Protospacer
********************************

12. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011645 (Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-78, complete sequence) position: , mismatch: 0, identity: 1.0

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgtcggg	Protospacer
********************************

13. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015845 (Escherichia coli O157:H7 strain FRIK2455 plasmid p35K, complete sequence) position: , mismatch: 0, identity: 1.0

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgtcggg	Protospacer
********************************

14. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053083 (Escherichia coli strain HB37 plasmid pHB37-3, complete sequence) position: , mismatch: 0, identity: 1.0

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgtcggg	Protospacer
********************************

15. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053083 (Escherichia coli strain HB37 plasmid pHB37-3, complete sequence) position: , mismatch: 0, identity: 1.0

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgtcggg	Protospacer
********************************

16. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG904994 (Escherichia coli strain 14OD0056 plasmid p14ODV, complete sequence) position: , mismatch: 0, identity: 1.0

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgtcggg	Protospacer
********************************

17. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_022520 (Klebsiella pneumoniae plasmid pBK15692, complete sequence) position: , mismatch: 0, identity: 1.0

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgtcggg	Protospacer
********************************

18. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015086 (Escherichia coli O25b:H4 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

19. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025949 (Escherichia coli strain SCEC020023 plasmid pCTXM55_020023, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

20. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU987452 (Citrobacter freundii strain AC2901 plasmid AC2901, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

21. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX928752 (Klebsiella pneumoniae strain CRKP-59-KPC plasmid pCRKP-59-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

22. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX608544 (Escherichia coli strain FA27 plasmid pFA27_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

23. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX683283 (Escherichia coli strain EcU443 plasmid pECSE_01, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

24. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY751926 (Klebsiella pneumoniae strain HK02-026 plasmid pHK02-026, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

25. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY288024 (Klebsiella pneumoniae strain ST709 plasmid pCC1410-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

26. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY416992 (Escherichia coli strain FAM21805 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

27. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_017627 (Escherichia coli 042 plasmid pAA, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

28. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025626 (Escherichia coli strain SCEC020007 plasmid pNDM5_020007, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

29. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028541 (Klebsiella pneumoniae strain WCHKP2 plasmid pKPC2_020002, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

30. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to AP018456 (Escherichia coli O25b:H4-ST131 plasmid pMRY09-581ECO_1 MRY09-581 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

31. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to AP018457 (Escherichia coli O25b:H4-ST131 plasmid pMRY09-592ECO_1 MRY09-592 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

32. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to AP018458 (Escherichia coli O25b:H4-ST131 plasmid pMRY09-597ECO_1 MRY09-597 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

33. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN783745 (Escherichia coli plasmid pFII-FIB, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

34. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023854 (Escherichia coli strain 2/0 plasmid p2_0.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

35. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MF679146 (Escherichia coli plasmid pBJ114-141, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

36. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MF679147 (Escherichia coli plasmid pBJ114T-190, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

37. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR213453 (Shigella flexneri strain AUSMDU00008355 isolate AUSMDU00008355 plasmid 2) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

38. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU664810 (Escherichia coli strain 11.3-R3 plasmid pCERC5, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

39. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT988018 (Escherichia coli strain V282 plasmid pEcoV282, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

40. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU288634 (Escherichia coli strain FAM22321 plasmid pFAM22321, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

41. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY007017 (Escherichia coli strain 14.3-R4 plasmid pCERC9, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

42. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU321583 (Escherichia coli strain E80 plasmid pE80, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

43. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT879914 (Escherichia coli strain HNEC55 plasmid pHNEC55, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

44. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU043115 (Escherichia coli strain Y5 plasmid pECY55, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

45. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX839209 (Klebsiella pneumoniae strain KP1814 plasmid pKP1814-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

46. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU254579 (Escherichia coli strain YD786 plasmid pYD786-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

47. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX503323 (Escherichia coli strain HNEC46 plasmid PHNEC46, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

48. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015077 (Escherichia coli strain Ecol_448 plasmid pEC448_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

49. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032991 (Escherichia coli strain W2-5 plasmid p2_W2-5, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

50. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015070 (Escherichia coli strain Ecol_743 plasmid pEC743_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

51. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015072 (Escherichia coli strain Ecol_743 plasmid pEC743_3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

52. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT185451 (Klebsiella pneumoniae strain LJ04 plasmid pCT-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

53. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT818627 (Klebsiella pneumoniae strain U25 plasmid U25P002, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

54. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT725788 (Klebsiella pneumoniae strain ST147 plasmid pCC1410-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

55. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT725789 (Klebsiella pneumoniae strain ST147 plasmid pCC1409-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

56. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KR653209 (Escherichia coli strain GDZ13 plasmid pGD0503Z13, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

57. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT002541 (Escherichia coli strain HeB7 plasmid pHeBE7, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

58. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT990220 (Escherichia coli strain 42-2 plasmid p42-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

59. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT845955 (Escherichia coli strain EP28 plasmid pHNEP28_cfr, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

60. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KP398867 (Escherichia coli strain DB04277 plasmid pDB4277, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

61. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KR078259 (Escherichia coli strain YD472 plasmid pYHCC, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

62. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to AP019526 (Escherichia coli O25b:H4-ST131 B0018 plasmid pB0018 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

63. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042629 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

64. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042630 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

65. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041339 (Escherichia coli strain CCUG 73778 plasmid pSUH-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

66. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023850 (Escherichia coli strain 4/0 plasmid p4_0.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

67. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP035517 (Escherichia coli strain U14A plasmid pU14A_A, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

68. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP035518 (Escherichia coli strain U14A plasmid pU14A_B, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

69. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP048368 (Escherichia coli strain 163 plasmid pC-F-164_A-OXA140, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

70. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040995 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

71. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP017611 (Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

72. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR130565 (Escherichia coli strain MS14387 isolate MS14387 plasmid 2) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

73. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042338 (Escherichia coli strain GZ04-0086 plasmid pNDM5-GZ04_B, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

74. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_014232 (Escherichia coli ETEC 1392/75 plasmid p1081, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

75. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP022460 (Shigella sonnei strain 2015C-3807 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

76. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP010158 (Escherichia coli strain D10 plasmid A, complete genome) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

77. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040124 (Klebsiella pneumoniae strain LSH-KPN148 plasmid pLSH-KPN148-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

78. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028484 (Escherichia coli strain E41-1 plasmid p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

79. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP010138 (Escherichia coli strain D2 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

80. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025857 (Escherichia coli strain 504838 plasmid p504838_108, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

81. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025852 (Escherichia coli strain 510016 plasmid p510016_29, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

82. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025844 (Escherichia coli strain 720632 plasmid p720632_94, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

83. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP035478 (Escherichia coli strain U13A plasmid pU13A_A, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

84. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP035479 (Escherichia coli strain U13A plasmid pU13A_B, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

85. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034401 (Escherichia coli strain CRE10 plasmid pCRE10.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

86. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014493 (Escherichia coli strain MVAST0167 plasmid pMVAST0167_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

87. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031918 (Escherichia coli O45:H2 strain FWSEC0003 plasmid unnamed12, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

88. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX646543 (Shigella boydii strain 2246 plasmid p2246-CTXM, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

89. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_013354 (Escherichia coli O103:H2 str. 12009 plasmid pO103, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

90. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_013655 (Escherichia coli SE15 plasmid pECSF1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

91. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_020278 (Escherichia coli strain 3A11 plasmid pHN3A11, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

92. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043219 (Escherichia coli O80:H26 strain EC-107 plasmid pET6.2-IncFII, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

93. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018113 (Escherichia coli strain MRSN346595 plasmid pMRSN346595_62.2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

94. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042601 (Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

95. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP048331 (Escherichia coli strain 10 plasmid p010_A, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

96. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026131 (Klebsiella pneumoniae strain F1 plasmid pF1_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

97. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP049351 (Escherichia coli strain 3R plasmid p3R-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

98. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KY130431 (Klebsiella pneumoniae plasmid pABC143C-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

99. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038182 (Escherichia coli strain 2 HS-C plasmid p2HS-C-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

100. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT754160 (Shigella dysenteriae strain 80-547 plasmid p80-547, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

101. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KT754164 (Shigella dysenteriae 1 strain 3099-85 plasmid p3099-85, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

102. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP054329 (Escherichia coli strain SCU-121 plasmid pSCU-121-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

103. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019272 (Escherichia coli strain 13P460A plasmid p13P460A-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

104. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011135 (Escherichia coli VR50 plasmid pVR50A, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

105. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011136 (Escherichia coli VR50 plasmid pVR50B, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

106. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP048338 (Escherichia coli strain 142 plasmid p142_A-OXA181, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

107. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP010174 (Escherichia coli strain H8 plasmid B, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

108. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031909 (Escherichia coli O103:H2 strain FWSEC0007 plasmid unnamed16, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

109. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS992188 (Escherichia coli isolate Escherichia coli str. 3426 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

110. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS992188 (Escherichia coli isolate Escherichia coli str. 3426 plasmid 4, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

111. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053732 (Escherichia coli strain CP55_Sichuan plasmid pCP55-IncFIB, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

112. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053734 (Escherichia coli strain CP55_Sichuan plasmid pCP55-IncFII, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

113. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK878892 (Escherichia coli strain J53 plasmid pMG333, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

114. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_023315 (Escherichia coli strain EQ011 plasmid pEQ011, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

115. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_025106 (Escherichia coli strain NMI5428/11 plasmid pMC-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

116. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021289 (Escherichia coli strain PA45B plasmid pPA45B, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

117. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020510 (Escherichia coli strain 165 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

118. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020546 (Escherichia coli strain ZJ3920 plasmid pZJ3920-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

119. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP010316 (Escherichia coli strain 789 plasmid pAPEC-O78-ColV) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

120. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029734 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed6, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

121. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033394 (Klebsiella pneumoniae strain WCHKP015625 plasmid pCTXM65_015625, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

122. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033395 (Klebsiella pneumoniae strain WCHKP015625 plasmid pKPC12_015625, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

123. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034964 (Escherichia coli strain WCHEC020032 plasmid pCTXM3_020032, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

124. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS999561 (Escherichia coli isolate EC-TO143 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

125. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS999561 (Escherichia coli isolate EC-TO143 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

126. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS992167 (Escherichia coli isolate Escherichia coli str. TO6 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

127. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

128. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053737 (Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFII, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

129. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053722 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncFIB, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

130. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053725 (Escherichia coli strain CP66-6_Sichuan plasmid pCP66-6-IncFII, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

131. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KJ020575 (Escherichia coli strain FP460 plasmid pHNFP460-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

132. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP044404 (Escherichia coli strain NMBU-W10C18 plasmid pNMBU-W10C18_01, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

133. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

134. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LN824138 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_E_Kpneumoniae_MS6671) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

135. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021847 (Escherichia coli strain EC1515 plasmid pEC1515-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

136. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP047091 (Salmonella sp. S13 plasmid pS13-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

137. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012626 (Escherichia coli strain SF-468 plasmid pSF-468-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

138. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MT077882 (Escherichia coli plasmid p4, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

139. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MT077885 (Escherichia coli plasmid p37, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

140. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MT077887 (Escherichia coli plasmid p62, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

141. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MT077889 (Escherichia coli plasmid p77, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

142. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN007141 (Escherichia coli strain 91 plasmid p91_NDM5, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

143. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS992181 (Escherichia coli isolate Escherichia coli str. TO124 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

144. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS992182 (Escherichia coli isolate Escherichia coli str. TO124 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

145. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KX023260 (Escherichia coli plasmid pSCE516-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

146. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051433 (Escherichia sp. SCLE84 plasmid pSCLE3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

147. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026826 (Shigella dysenteriae strain ATCC 12021 plasmid unnamed) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

148. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024475 (Shigella flexneri 7b strain 94-3007 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

149. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR213457 (Shigella flexneri strain AUSMDU00008332 isolate AUSMDU00008332 plasmid 3) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

150. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP044156 (Shigella flexneri strain AR-0424 plasmid pAR-0424-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

151. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT838198 (Escherichia coli isolate WI1 isolate plasmid pWI1-incFII, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

152. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR130556 (Escherichia coli strain MS14385 isolate MS14385 plasmid 2) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

153. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR130558 (Escherichia coli strain MS14385 isolate MS14385 plasmid 4) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

154. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP054369 (Escherichia coli strain SCU-115 plasmid pSCU-115-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

155. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP054364 (Escherichia coli strain SCU-171 plasmid pSCU-171-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

156. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP048296 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

157. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014496 (Escherichia coli strain SaT040 plasmid pSaT040, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

158. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013836 (Escherichia coli strain JJ1897 plasmid pJJ1897_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

159. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP046678 (Escherichia coli strain 152661 plasmid p152661_p2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

160. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026724 (Escherichia coli strain 266917_2 plasmid p266917_2_01, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

161. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021728 (Escherichia coli strain Combat11I9 plasmid pCombat11I9-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

162. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020517 (Escherichia coli strain 222 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

163. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019276 (Escherichia coli strain 13P477T plasmid p13P477T-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

164. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033629 (Klebsiella pneumoniae strain 4743 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

165. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036301 (Klebsiella pneumoniae subsp. pneumoniae strain WCHKP015093 plasmid pKPC2_015093, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

166. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036362 (Klebsiella pneumoniae strain WCHKP2080 plasmid pKPC2_095080, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

167. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP049078 (Escherichia coli strain p11A plasmid p11A_p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

168. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP051693 (Escherichia coli strain SCU-318 plasmid pSCU-318-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

169. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030770 (Escherichia coli strain 2017C-4173W12 plasmid p2017C-4173W12, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

170. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP054942 (Escherichia coli strain MS6192 plasmid pMS6192B, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

171. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012683 (Salmonella enterica subsp. enterica serovar Typhimurium strain 33676 plasmid p33673_IncF, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

172. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024284 (Escherichia albertii strain 2014C-4356 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

173. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024286 (Escherichia albertii strain 2014C-4356 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

174. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024287 (Escherichia albertii strain 2014C-4356 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

175. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025952 (Klebsiella pneumoniae subsp. pneumoniae strain GD4 plasmid pKPGD4, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

176. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027326 (Escherichia coli strain 2013C-4830 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

177. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026854 (Escherichia coli strain MS7163 plasmid pMS7163A, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

178. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019261 (Escherichia coli strain 13C1065T plasmid p13C1065T-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

179. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019244 (Escherichia coli strain Combat2C1 plasmid pCombat2C1-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

180. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012634 (Escherichia coli strain SF-166 plasmid pSF-166-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

181. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

182. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031548 (Escherichia coli strain cq9 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

183. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036244 (Escherichia coli strain S65EC plasmid pS65EC, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

184. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036372 (Klebsiella pneumoniae strain WCHKP020037 plasmid pKPC2_020037, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

185. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012139 (Shigella flexneri 2a strain 981 plasmid 981p2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

186. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_018998 (Escherichia coli F18+ plasmid pTC1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

187. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP042642 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-4_MCR3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

188. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP045279 (Escherichia coli strain LAU-OXA plasmid pLAU-OXA2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

189. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021843 (Escherichia coli strain EC974 plasmid pEC974-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

190. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN061455 (Escherichia coli strain EC-15-3 plasmid pEC-15-3-NDM-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

191. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN891682 (Klebsiella pneumoniae strain 116753 plasmid p116753-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

192. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to LC549806 (Escherichia coli VNCEc57 plasmid pVNCEc57 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

193. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038393 (Escherichia coli O157:H7 strain DEC5B plasmid pDEC5B-5, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

194. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_009602 (Escherichia coli plasmid pSFO157, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

195. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021180 (Escherichia coli strain 81009 plasmid pEC-81009, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

196. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041957 (Escherichia coli strain EC2 plasmid pEC2_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

197. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041948 (Klebsiella pneumoniae strain KP2 plasmid pKP2_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

198. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CM019851 (Escherichia coli strain CVM N17EC0326 plasmid pN17EC0326-1, complete sequence, whole genome shotgun sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

199. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023350 (Escherichia coli strain ETEC-2264 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

200. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023351 (Escherichia coli strain ETEC-2264 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

201. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027460 (Escherichia coli strain 90-3040 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

202. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027385 (Escherichia coli strain 2013C-3250 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

203. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041414 (Escherichia coli strain STEC719 plasmid pSTEC719_3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

204. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041415 (Escherichia coli strain STEC719 plasmid pSTEC719_4, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

205. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041434 (Escherichia coli strain STEC313 plasmid pSTEC313, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

206. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041428 (Escherichia coli strain STEC388 plasmid pSTEC388_3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

207. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041430 (Escherichia coli strain STEC367 plasmid pSTEC367, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

208. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012632 (Escherichia coli strain SF-173 plasmid pSF-173-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

209. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015160 (Escherichia coli strain Eco889 plasmid pECO-fce, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

210. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015160 (Escherichia coli strain Eco889 plasmid pECO-fce, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

211. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP035752 (Escherichia coli E110019 plasmid pE110019_66, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

212. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN641485 (Escherichia coli strain SDCRK18-7 plasmid pNDM-SDCRK18-7, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

213. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP047380 (Escherichia coli strain CAU16175 plasmid pCAU16175_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

214. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP047381 (Escherichia coli strain CAU16175 plasmid pCAU16175_3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

215. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038385 (Escherichia coli O157:H7 strain DEC5E plasmid pDEC5E-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

216. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP045525 (Shigella sonnei strain 6904.27 plasmid p6904-27) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

217. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033091 (Escherichia coli DSM 30083 = JCM 1649 = ATCC 11775 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

218. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_008460 (Escherichia coli plasmid pO86A1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

219. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP019696 (Shigella sonnei strain 75/02 plasmid pInv_75_02_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

220. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to LT906556 (Escherichia coli isolate E. coli RL465 genome assembly, plasmid: I) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

221. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040922 (Escherichia coli strain FC853_EC plasmid p853EC3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

222. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014523 (Escherichia coli strain ZH063 plasmid pZH063_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

223. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024281 (Escherichia coli strain ATCC 43896 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

224. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024055 (Escherichia coli strain SMN197SH3 plasmid pO177A3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

225. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024617 (Escherichia coli strain SMN152SH1 plasmid pO177A1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

226. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP007150 (Escherichia coli RS218 plasmid pRS218, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

227. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029580 (Escherichia coli strain DA33137 plasmid pDA33137-178, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

228. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030329 (Escherichia coli strain AR_452 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

229. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014498 (Escherichia coli strain ZH193 plasmid pZH193, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

230. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053248 (Escherichia coli strain SCU-482 plasmid pSCU-482-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

231. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053246 (Escherichia coli strain SCU-485 plasmid pSCU-485-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

232. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_007941 (Escherichia coli UTI89 plasmid pUTI89, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

233. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015503 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

234. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013832 (Escherichia coli strain CD306 plasmid pCD306, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

235. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013833 (Escherichia coli strain JJ2434 plasmid pJJ2434_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

236. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013834 (Escherichia coli strain JJ2434 plasmid pJJ2434_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

237. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027357 (Escherichia coli strain 2013C-4991 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

238. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027389 (Escherichia coli strain 2011C-4251 plasmid unnamed) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

239. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041421 (Escherichia coli strain STEC711 plasmid pSTEC711_5, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

240. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041432 (Escherichia coli strain STEC316 plasmid pSTEC316, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

241. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041438 (Escherichia coli strain STEC005 plasmid pSTEC005, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

242. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP039562 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014847 plasmid p08-5333.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

243. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029577 (Escherichia coli strain DA33135 plasmid pDA33135-139, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

244. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029578 (Escherichia coli strain DA33135 plasmid pDA33135-70, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

245. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024652 (Escherichia coli strain BH100 substr. MG2014 plasmid pBH100-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

246. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP049937 (Escherichia coli strain JL05 plasmid pARG01, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

247. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016389 (Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid pESBL931, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

248. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042619 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-4, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

249. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042621 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-6, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

250. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014753 (Escherichia coli strain PSUO103 plasmid, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

251. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019007 (Escherichia coli strain Ecol_AZ159 plasmid pECAZ159_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

252. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011916 (Escherichia coli strain PSUO2 plasmid pPSUO2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

253. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024888 (Escherichia coli strain AR_0019 plasmid tig00000138_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

254. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019456 (Escherichia coli strain FHI_NMBU_03 plasmid pFHI_NMBU_03_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

255. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041436 (Escherichia coli strain STEC309 plasmid pSTEC309, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

256. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018994 (Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

257. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP037912 (Escherichia coli strain YSP8-1 plasmid pYSP8-1-CTX-M-14, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

258. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038338 (Escherichia coli O157:H7 strain LSU61 plasmid pLSU61-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

259. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038413 (Escherichia coli O157:H7 strain 493/89 plasmid p493-89-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

260. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041102 (Klebsiella pneumoniae subsp. pneumoniae strain KPCTRSRTH07 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

261. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MK492260 (Escherichia coli strain MG1655 K12 plasmid F-Tn10, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

262. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028193 (Escherichia coli strain CFSAN018748 plasmid pGMI14-004_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

263. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043415 (Escherichia coli strain EC42405 plasmid pNTEC2-42405, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

264. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP010882 (Escherichia coli strain MNCRE44 plasmid pMNCRE44_6, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

265. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011019 (Escherichia coli strain CI5 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

266. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985217 (Escherichia coli strain 715 plasmid RCS103_p, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

267. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030198 (Salmonella enterica strain SA20051401 plasmid pSA20051401.2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

268. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034324 (Klebsiella pneumoniae isolate KSH203 plasmid pKSH203-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

269. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KU318420 (Klebsiella pneumoniae strain KP04 plasmid pKP04CTXM, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

270. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP053752 (Shigella sonnei strain 506 plasmid pMHMC-001, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

271. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP053755 (Shigella sonnei strain 506 plasmid pMHMC-004, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

272. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040547 (Klebsiella pneumoniae strain CR-HvKP5 plasmid pCR-HvKP5-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

273. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to AP014876 (Escherichia coli plasmid pV021-b DNA, complete sequence, strain: V021) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

274. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to AP014877 (Escherichia coli plasmid pV085-c DNA, complete sequence, strain: V085) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

275. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015131 (Klebsiella pneumoniae strain Kpn555 plasmid pKPN-7c3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

276. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP046260 (Escherichia coli strain ECO2947 plasmid p2974-D, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

277. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP046261 (Escherichia coli strain ECO2947 plasmid p2947-NDM5, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

278. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027439 (Escherichia coli strain 2012C-4221 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

279. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032242 (Klebsiella pneumoniae strain XJ-K2 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

280. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP039820 (Klebsiella pneumoniae strain C2414 plasmid pC2414-2-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

281. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034254 (Escherichia coli strain IVRI Kol CP4 plasmid p1ESCUMpO83_CORR) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

282. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP035314 (Escherichia coli strain D72 plasmid pD72-F33, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

283. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP046718 (Escherichia coli strain T16R plasmid pT16R-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

284. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KY463220 (Escherichia coli plasmid pNDM5-IBAC, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

285. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034932 (Shigella flexneri strain 2013C-3749 plasmid p2013C-3749-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

286. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041177 (Salmonella enterica subsp. enterica serovar Enteritidis strain SJTUF12367v2 plasmid p12367A, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

287. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051655 (Escherichia coli strain RM13745 plasmid pRM13745-2) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

288. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051653 (Escherichia coli strain RM13752 plasmid pRM13752) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

289. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051657 (Escherichia coli strain SJ7 plasmid pSJ7-1) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

290. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051656 (Escherichia coli strain RM11911 plasmid pRM11911) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

291. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP039513 (Salmonella enterica subsp. enterica serovar Worthington strain 7102.58 plasmid p7102_58-6, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

292. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP010181 (Escherichia coli strain M1 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

293. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP008715 (Escherichia coli strain ST648 plasmid pEC648_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

294. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP043748 (Escherichia coli strain CVM N16EC0140 plasmid pN16EC0140-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

295. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021684 (Escherichia coli strain AR_0162 plasmid tig00008015, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

296. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024836 (Klebsiella pneumoniae strain CRKP-2297 plasmid pCRKP-2297_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

297. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026201 (Escherichia coli strain ECONIH6 plasmid pNDM-d2e9, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

298. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026754 (Escherichia coli strain AR_0077 plasmid tig00000042_pilon, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

299. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP039810 (Klebsiella pneumoniae strain C2660 plasmid pC2660-3-KPC, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

300. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012636 (Escherichia coli strain SF-088 plasmid pSF-088-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

301. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031804 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

302. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032202 (Escherichia coli strain AR_0086 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

303. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050707 (Salmonella enterica subsp. enterica serovar Enteritidis strain SE124 plasmid pSE124-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

304. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009233 (Escherichia coli strain CA08 plasmid pCA08, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

305. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021203 (Escherichia coli strain Z1002 plasmid p1002-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

306. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021210 (Escherichia coli strain strain Z247 plasmid p2474-NDM1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

307. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022731 (Escherichia coli strain SA186 plasmid pSA186_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

308. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022732 (Escherichia coli strain SA186 plasmid pSA186_3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

309. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_004998 (Escherichia coli plasmid p1658/97, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

310. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985319 (Escherichia coli strain ECOR 30 genome assembly, plasmid: RCS96_pII) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

311. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031852 (Klebsiella pneumoniae strain 121 plasmid pKP121-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

312. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033404 (Klebsiella pneumoniae strain WCHKP115069 plasmid pKPC2_115069, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

313. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025850 (Escherichia coli strain 600468 plasmid p600468_158, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

314. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP035468 (Escherichia coli strain U12A plasmid pU12A_A, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

315. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP035470 (Escherichia coli strain U12A plasmid pU12A_C, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

316. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051707 (Escherichia coli strain SCU-124 plasmid pSCU-124-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

317. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051708 (Escherichia coli strain SCU-124 plasmid pSCU-124-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

318. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR130563 (Escherichia coli strain MS14384 isolate MS14384 plasmid 2) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

319. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051701 (Escherichia coli strain SCU-125 plasmid pSCU-125-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

320. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019677 (Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

321. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_024956 (Escherichia coli strain K-12 plasmid pDM0133, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

322. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP010830 (Shigella sonnei strain FORC_011 plasmid pFORC11.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

323. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP006001 (Escherichia coli B7A plasmid pEB3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

324. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027448 (Escherichia coli strain 2014C-3075 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

325. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029104 (Escherichia coli strain AR437 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

326. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018147 (Escherichia coli strain M217 isolate M217 plasmid pM217_FII, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

327. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033159 (Escherichia coli strain CM IVRI KOL-1 plasmid p1ESCUMpO83_CORR) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

328. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP048372 (Escherichia coli strain 164 plasmid pC-F-163_A, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

329. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051728 (Escherichia coli strain SCU-111 plasmid pSCU-111-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

330. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051729 (Escherichia coli strain SCU-111 plasmid pSCU-111-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

331. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051712 (Escherichia coli strain SCU-123 plasmid pSCU-123-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

332. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051696 (Escherichia coli strain SCU-313 plasmid pSCU-313-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

333. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051689 (Escherichia coli strain SCU-387 plasmid pSCU-387-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

334. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051690 (Escherichia coli strain SCU-387 plasmid pSCU-387-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

335. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051739 (Escherichia coli strain SCU-105 plasmid pSCU-105-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

336. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051739 (Escherichia coli strain SCU-105 plasmid pSCU-105-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

337. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051726 (Escherichia coli strain SCU-112 plasmid pSCU-112-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

338. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051721 (Escherichia coli strain SCU-116 plasmid pSCU-116-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

339. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP052528 (Klebsiella pneumoniae strain B16KP0177 plasmid pB16KP0177-4, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

340. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018811 (Escherichia coli strain E2865 plasmid pE2865-3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

341. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018785 (Escherichia coli strain SK1144 plasmid pSK1144) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

342. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_019071 (Escherichia coli plasmid pHK09, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

343. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_019072 (Escherichia coli plasmid pHK08, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

344. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_019089 (Escherichia coli plasmid pGUE-NDM, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

345. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_019094 (Escherichia coli plasmid p417H-90, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

346. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_019095 (Escherichia coli plasmid pXZ, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

347. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040807 (Escherichia fergusonii strain EFCF056 plasmid pEF02, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

348. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040808 (Escherichia fergusonii strain EFCF056 plasmid pEF03, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

349. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP010241 (Escherichia coli strain C7 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

350. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP046117 (Enterobacter cloacae strain CBG15936 plasmid pTEM-CBG, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

351. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021690 (Escherichia coli strain AR_0058 plasmid tig00007555j7554, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

352. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023389 (Escherichia coli strain 1105 plasmid p74, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

353. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024823 (Escherichia coli strain CREC-591 plasmid pCREC-591_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

354. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024975 (Escherichia coli strain CV839-15 plasmid pCV839-15-p1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

355. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP043544 (Escherichia coli strain F2_81 plasmid pF2_18C_FIB, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

356. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021536 (Escherichia coli strain AR_0119 plasmid unitig_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

357. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024480 (Escherichia coli strain 2011C-4315 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

358. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030782 (Escherichia albertii strain 07-3866 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

359. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036180 (Escherichia coli strain WCHEC025970 plasmid p1_025970, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

360. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KU932024 (Escherichia coli plasmid pEC13, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

361. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KU932025 (Escherichia coli plasmid pEC14I, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

362. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KU932028 (Escherichia coli plasmid pEC14III, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

363. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024157 (Escherichia coli strain 14EC047 plasmid p14EC047b, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

364. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024158 (Escherichia coli strain 14EC047 plasmid p14EC047c, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

365. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050647 (Escherichia coli strain PapM-36-2 plasmid pIncFIB, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

366. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009860 (Escherichia coli strain ECONIH1 plasmid pECO-824, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

367. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017852 (Klebsiella variicola strain GJ2 plasmid pKPGJ-2c, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

368. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017287 (Klebsiella variicola strain GJ3 plasmid pKPGJ-3c, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

369. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019954 (Escherichia coli M8 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

370. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_025175 (Escherichia coli plasmid pH2332-166, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

371. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_025177 (Escherichia coli plasmid pH1519-76, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

372. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019444 (Salmonella enterica subsp. enterica serovar Typhimurium strain 81741 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

373. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024151 (Escherichia coli strain 14EC033 plasmid p14EC033d, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

374. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR025102 (Escherichia coli isolate EC-1639 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

375. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051734 (Escherichia coli strain SCU-109 plasmid pSCU-109-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

376. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051736 (Escherichia coli strain SCU-108 plasmid pSCU-108-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

377. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051737 (Escherichia coli strain SCU-108 plasmid pSCU-108-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

378. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051699 (Escherichia coli strain SCU-152 plasmid pSCU-152-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

379. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023733 (Escherichia coli strain FORC 064 plasmid pFORC64.2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

380. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051715 (Escherichia coli strain SCU-122 plasmid pSCU-122-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

381. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_013175 (Escherichia coli plasmid pEC14_114, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

382. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_025139 (Escherichia coli plasmid pH2291-144, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

383. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_025141 (Escherichia coli plasmid pH1038-142, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

384. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042296 (Escherichia coli strain RM9088 plasmid p1RM9088, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

385. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018978 (Escherichia coli strain Ecol_656 plasmid pEC656_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

386. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024258 (Escherichia coli O25:H16 strain F5505-C1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

387. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024840 (Klebsiella pneumoniae strain CRKP-1215 plasmid pCRKP-1215_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

388. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024145 (Escherichia coli strain 14EC029 plasmid p14EC029d, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

389. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027256 (Escherichia coli strain EC11 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

390. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027536 (Escherichia coli strain AR_0081 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

391. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027537 (Escherichia coli strain AR_0081 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

392. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013026 (Escherichia coli strain 2009C-3133 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

393. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029113 (Escherichia coli strain AR435 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

394. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018982 (Escherichia coli strain Ecol_867 plasmid pEC867_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

395. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018952 (Escherichia coli strain Ecol_276 plasmid pEC276_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

396. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042879 (Escherichia coli strain NMBU_W05E18 plasmid pNMBU-W05E18_01, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

397. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024241 (Escherichia coli O114:H49 strain 90-9280 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

398. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024242 (Escherichia coli O114:H49 strain 90-9280 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

399. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019076 (Escherichia coli strain CRE1493 plasmid p1493-5, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

400. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023674 (Escherichia coli strain SMN013SH2 plasmid pO177A2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

401. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015388 (Klebsiella pneumoniae strain NY9 plasmid pNY9_3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

402. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KJ201887 (Shigella flexneri 4c strain 072 plasmid pSF07201, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

403. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX008967 (Shigella sonnei strain 183660 plasmid p183660, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

404. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to LC163971 (Escherichia coli O145:NM str. 12E70 plasmid pSTEC-O145-12E70-1 DNA, complete sequence, strain: 12E70) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

405. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042943 (Escherichia fergusonii strain ATCC 35471 plasmid pATCC-35471_1) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

406. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013657 (Escherichia coli strain uk_P46212 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

407. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP037947 (Escherichia coli strain CFSAN027346 plasmid pCFSAN027346-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

408. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027364 (Escherichia coli strain 88-3001 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

409. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023895 (Escherichia coli strain FDAARGOS_433 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

410. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP017633 (Escherichia coli strain SLK172 plasmid pSLK172-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

411. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP054455 (Escherichia coli strain SCU-487 plasmid pSCU-487-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

412. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_014385 (Escherichia coli plasmid pEC_L46, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

413. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_014384 (Escherichia coli plasmid pEC_L8, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

414. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP025927 (Escherichia coli strain 520873 plasmid p520873_29, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

415. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP025891 (Escherichia coli strain 503046 plasmid p503046_32, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

416. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP025880 (Escherichia coli strain 503458 plasmid p503458_46, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

417. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032165 (Klebsiella pneumoniae strain XJ-K1 plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

418. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP042972 (Escherichia coli strain CFSAN061769 plasmid pCFSAN061769_03, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

419. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP010120 (Escherichia coli strain C3 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

420. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP043759 (Escherichia coli strain CVM N55972 plasmid pN55972-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

421. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032810 (Escherichia coli strain ERL04-3476 plasmid pERL04-3476-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

422. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024129 (Escherichia coli strain 14EC001 plasmid p14EC001b, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

423. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027446 (Escherichia coli strain 2013C-3492 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

424. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_017640 (Escherichia coli UMNK88 plasmid pUMNK88_Ent, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

425. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016498 (Escherichia coli strain UPEC 26-1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

426. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024238 (Escherichia coli O15:H11 strain 90-9272 plasmid unnamed) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

427. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024238 (Escherichia coli O15:H11 strain 90-9272 plasmid unnamed) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

428. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KX246267 (Escherichia coli plasmid pHNHN21, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

429. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR130554 (Escherichia coli strain MS14386 isolate MS14386 plasmid 3) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

430. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP009167 (Escherichia coli 1303 plasmid p1303_109, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

431. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024430 (Klebsiella pneumoniae strain DA48896 plasmid p48896_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

432. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP054381 (Escherichia coli strain SCU-175 plasmid pSCU-175-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

433. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_019424 (Escherichia coli plasmid pFOS-HK151325, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

434. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041111 (Escherichia coli strain ECCTRSRTH03 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

435. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024237 (Escherichia coli O6:H16 strain 2014EL-1346-6 plasmid unnamed5, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

436. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP047577 (Escherichia coli strain 94EC plasmid p94EC-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

437. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015140 (Escherichia coli strain Ecol_732 plasmid pEC732_2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

438. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050372 (Klebsiella pneumoniae strain 50595 plasmid p50595_ERM, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

439. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050367 (Klebsiella pneumoniae strain 47733 plasmid p47733_NDM_5, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

440. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KU578032 (Escherichia coli plasmid pCERC4, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

441. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KU695535 (Escherichia coli plasmid pMEX01, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

442. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP010345 (Escherichia coli ECC-1470 plasmid pECC-1470_100, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

443. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_019057 (Escherichia coli plasmid pHK01, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

444. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_019073 (Escherichia coli plasmid pHN7A8, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

445. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029381 (Klebsiella pneumoniae subsp. pneumoniae strain SCKP020079 plasmid pKPC2_020079, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

446. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041363 (Citrobacter amalonaticus strain 133355-SW-C4-Cam plasmid p133355_SW_C4_Cam-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

447. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041358 (Escherichia coli strain U1 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

448. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018973 (Escherichia coli strain Ecol_545 plasmid pEC545_3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

449. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023363 (Escherichia coli strain 144 plasmid 134q, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

450. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023367 (Escherichia coli strain 1428 plasmid p111, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

451. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023369 (Escherichia coli strain 1428 plasmid p66, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

452. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026141 (Klebsiella pneumoniae strain F127 plasmid pF127_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

453. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026158 (Klebsiella pneumoniae strain F93-2 plasmid pF93-2_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

454. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS992194 (Escherichia coli isolate Escherichia coli str. TO217 plasmid 3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

455. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS992169 (Escherichia coli isolate Escherichia coli str. TO60 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

456. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP049174 (Shigella sonnei strain 19.0820.1561 plasmid p19-0820-1561, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

457. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023918 (Klebsiella pneumoniae strain FDAARGOS_439 plasmid unnamed) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

458. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023959 (Escherichia coli strain FDAARGOS_448 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

459. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042887 (Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_03, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

460. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043407 (Escherichia coli strain NMBU-W13E19 plasmid pNMBU-W13E19_01, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

461. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP043408 (Escherichia coli strain NMBU-W13E19 plasmid pNMBU-W13E19_02, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

462. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023725 (Klebsiella pneumoniae strain TVGHCRE225 plasmid unnamed3, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

463. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP047407 (Escherichia coli strain MS6193 plasmid pMS6193B, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

464. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP054450 (Escherichia coli strain SCU-488 plasmid pSCU-488-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

465. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040541 (Klebsiella pneumoniae strain CR-HvKP4 plasmid pCR-HvKP4-pKPC, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

466. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_013507 (Escherichia coli ETEC H10407 plasmid pEntH10407, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

467. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_002134 (Shigella flexneri 2b plasmid R100 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

468. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_002483 (Escherichia coli K-12 plasmid F DNA, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

469. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026584 (Klebsiella pneumoniae strain WCHKP649 plasmid pKPC2_095649, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

470. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP045934 (Shigella sonnei strain AUSMDU00010534 plasmid pAUSMDU00010534_02, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

471. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023358 (Escherichia coli strain 317 plasmid p100, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

472. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027589 (Escherichia coli strain 2014C-3011 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

473. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011417 (Escherichia coli strain CFSAN029787 plasmid pCFSAN029787_01, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

474. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011418 (Escherichia coli strain CFSAN029787 plasmid pCFSAN029787_02, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

475. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP013028 (Escherichia coli strain 2012C-4227 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

476. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_017630 (Escherichia coli UM146 plasmid pUM146, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

477. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027554 (Escherichia coli strain 2013C-3513 plasmid unnamed1) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

478. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032205 (Escherichia coli strain AR_0013 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

479. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP048648 (Escherichia coli strain GW-AmxH19 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

480. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034396 (Escherichia coli strain CRE1 plasmid pCRE1.1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

481. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP035722 (Escherichia coli strain U15A plasmid pU15A_B, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

482. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP048440 (Escherichia coli strain NBRC 3301 plasmid putative_pEcol1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

483. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029058 (Escherichia coli strain FORC_081 plasmid pFORC_081_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

484. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029058 (Escherichia coli strain FORC_081 plasmid pFORC_081_1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

485. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP050384 (Escherichia coli strain 52148 plasmid p52148_NDM_5, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

486. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MH061383 (Pseudomonas aeruginosa plasmid pP6qnrS1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

487. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024268 (Escherichia coli O6:H16 strain F6699 plasmid unnamed2) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

488. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP049186 (Shigella sonnei strain 19.0821.3486 plasmid p19-0821-3486, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

489. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LR025097 (Escherichia coli isolate EC-7215 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

490. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS992191 (Escherichia coli isolate Escherichia coli str. TO148 plasmid 2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

491. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_006671 (Escherichia coli A2363 plasmid pAPEC-O2-R, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

492. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_013542 (Klebsiella pneumoniae plasmid pKF3-70, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

493. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_016039 (Escherichia coli plasmid pHK17a, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

494. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP046285 (Shigella sonnei strain FDAARGOS_715 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

495. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023361 (Escherichia coli strain 1943 plasmid p80, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

496. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023354 (Escherichia coli strain 746 plasmid p62, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

497. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023355 (Escherichia coli strain 746 plasmid p72, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

498. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP025677 (Escherichia albertii strain ChinaSP140150 plasmid pEA-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

499. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027551 (Escherichia coli strain 2015C-4136CT1 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

500. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to AP022364 (Escherichia coli E309 plasmid pE309_IMP6 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

501. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to AP022366 (Escherichia coli E312 plasmid pE312_IMP6 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

502. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to AP022368 (Escherichia coli E318 plasmid pE318_IMP6 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

503. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to AP022369 (Escherichia coli E319 plasmid pE319_IMP6 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

504. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030283 (Escherichia coli strain E308 plasmid pLKSZ02, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

505. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN823993 (Klebsiella pneumoniae strain 20130907-4 plasmid p309074-2FII, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

506. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN822124 (Escherichia coli strain 14E509 plasmid p14E509-1FII, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

507. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN822125 (Escherichia coli strain 14E509 plasmid p14E509-2FII, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

508. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053282 (Escherichia coli strain SCU-308 plasmid pSCU-308-1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

509. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_HG941719 (Escherichia coli O25b:H4-ST131 strain EC958 plasmid pEC958, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

510. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_009133 (Escherichia coli plasmid NR1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

511. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_020271 (Escherichia coli O25b:H4-ST131 str. EC958 strain ST131 plasmid pJIE186-2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

512. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP000039 (Shigella sonnei Ss046 plasmid pSS_046, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

513. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028582 (Klebsiella pneumoniae strain WCHKP36 plasmid pKPC2_020036, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

514. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026576 (Escherichia coli strain WCHEC005237 plasmid pCTX-M-55_005237, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

515. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP014668 (Escherichia coli strain ECONIH2 plasmid pECO-bc6, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

516. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP010239 (Escherichia coli strain S50 plasmid A, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

517. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021871 (Escherichia coli strain H105 plasmid pH105, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

518. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to AP022363 (Escherichia coli E303 plasmid pE303_IMP6 DNA, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

519. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015914 (Escherichia coli strain 210205630 isolate 210205630 plasmid pSLy2, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

520. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032258 (Escherichia coli strain AR_0067 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

521. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032262 (Escherichia coli strain AR_0067 plasmid unnamed4, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

522. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036366 (Klebsiella pneumoniae strain WCHKP115068 plasmid pCTXM65_115068, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

523. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP036367 (Klebsiella pneumoniae strain WCHKP115068 plasmid pKPC12_115068, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

524. spacer 2.6|3064640|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN865122 (Escherichia coli strain SCNJ06 plasmid prmtB_SCNJ06, complete sequence) position: , mismatch: 0, identity: 1.0

gtggaagagaaaattgagaaaacggcgatttc	CRISPR spacer
gtggaagagaaaattgagaaaacggcgatttc	Protospacer
********************************

525. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042249 (Escherichia coli strain BCE049 plasmid pBCE049-3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

526. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042249 (Escherichia coli strain BCE049 plasmid pBCE049-3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

527. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP045935 (Shigella sonnei strain AUSMDU00010534 plasmid pAUSMDU00010534_03, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

528. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP045935 (Shigella sonnei strain AUSMDU00010534 plasmid pAUSMDU00010534_03, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

529. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP015845 (Escherichia coli O157:H7 strain FRIK2455 plasmid p35K, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

530. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053083 (Escherichia coli strain HB37 plasmid pHB37-3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

531. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG904994 (Escherichia coli strain 14OD0056 plasmid p14ODV, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

532. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX580716 (Escherichia coli strain ZJ1635 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

533. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX580716 (Escherichia coli strain ZJ1635 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

534. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX580716 (Escherichia coli strain ZJ1635 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

535. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU934208 (Escherichia coli strain HeN867 plasmid pHeN867, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

536. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU934208 (Escherichia coli strain HeN867 plasmid pHeN867, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

537. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KU934208 (Escherichia coli strain HeN867 plasmid pHeN867, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

538. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX013538 (Escherichia coli strain ABC149 plasmid pABC149-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

539. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX013538 (Escherichia coli strain ABC149 plasmid pABC149-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

540. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX013538 (Escherichia coli strain ABC149 plasmid pABC149-MCR-1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

541. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX772778 (Escherichia coli strain E15017_00 plasmid pE15017_00, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

542. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX772778 (Escherichia coli strain E15017_00 plasmid pE15017_00, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

543. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX772778 (Escherichia coli strain E15017_00 plasmid pE15017_00, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

544. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY120366 (Salmonella enterica subsp. enterica serovar Typhimurium strain R150626 plasmid pR150626, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

545. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY120366 (Salmonella enterica subsp. enterica serovar Typhimurium strain R150626 plasmid pR150626, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

546. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY120366 (Salmonella enterica subsp. enterica serovar Typhimurium strain R150626 plasmid pR150626, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

547. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY075656 (Escherichia coli strain WH13 plasmid pWH13-4, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

548. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY075656 (Escherichia coli strain WH13 plasmid pWH13-4, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

549. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY075656 (Escherichia coli strain WH13 plasmid pWH13-4, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

550. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY075650 (Escherichia coli strain GD17 plasmid pGD17-2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

551. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY075650 (Escherichia coli strain GD17 plasmid pGD17-2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

552. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY446064 (Escherichia coli strain GD81 plasmid pGD81-1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

553. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY446064 (Escherichia coli strain GD81 plasmid pGD81-1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

554. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY446064 (Escherichia coli strain GD81 plasmid pGD81-1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

555. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY471309 (Escherichia coli strain M15224 plasmid pMCR-M15224, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

556. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY471309 (Escherichia coli strain M15224 plasmid pMCR-M15224, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

557. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY471309 (Escherichia coli strain M15224 plasmid pMCR-M15224, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

558. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY471145 (Escherichia coli strain EC019 plasmid pEC019, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

559. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY471145 (Escherichia coli strain EC019 plasmid pEC019, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

560. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY471145 (Escherichia coli strain EC019 plasmid pEC019, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

561. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY471313 (Escherichia coli strain M19441 plasmid pMCR-M19441, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

562. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY471313 (Escherichia coli strain M19441 plasmid pMCR-M19441, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

563. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY471307 (Escherichia coli strain GN775 plasmid pMCR-GN775, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

564. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY471307 (Escherichia coli strain GN775 plasmid pMCR-GN775, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

565. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY471307 (Escherichia coli strain GN775 plasmid pMCR-GN775, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

566. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY471312 (Escherichia coli strain M19242 plasmid pMCR-M19242, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

567. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY471312 (Escherichia coli strain M19242 plasmid pMCR-M19242, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

568. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY471311 (Escherichia coli strain M19241 plasmid pMCR-M19241, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

569. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY471311 (Escherichia coli strain M19241 plasmid pMCR-M19241, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

570. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY405001 (Escherichia coli strain Ec28 plasmid pEC28, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

571. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY405001 (Escherichia coli strain Ec28 plasmid pEC28, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

572. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY405001 (Escherichia coli strain Ec28 plasmid pEC28, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

573. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY471308 (Escherichia coli strain M15049 plasmid pMCR-M15049, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

574. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY471308 (Escherichia coli strain M15049 plasmid pMCR-M15049, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

575. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY471310 (Escherichia coli strain M17059 plasmid pMCR-M17059, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

576. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY471310 (Escherichia coli strain M17059 plasmid pMCR-M17059, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

577. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY075658 (Escherichia coli strain WH07 plasmid pWH07-3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

578. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY075658 (Escherichia coli strain WH07 plasmid pWH07-3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

579. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY075658 (Escherichia coli strain WH07 plasmid pWH07-3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

580. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY075657 (Escherichia coli strain WH09 plasmid pWH09-3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

581. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY075657 (Escherichia coli strain WH09 plasmid pWH09-3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

582. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY075657 (Escherichia coli strain WH09 plasmid pWH09-3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

583. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX032519 (Escherichia coli strain Af23 isolate A plasmid pAF23, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

584. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX032519 (Escherichia coli strain Af23 isolate A plasmid pAF23, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

585. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX032519 (Escherichia coli strain Af23 isolate A plasmid pAF23, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

586. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY363997 (Shigella sonnei strain SH11Sh418 plasmid pSh418-m3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

587. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY363997 (Shigella sonnei strain SH11Sh418 plasmid pSh418-m3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

588. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY363997 (Shigella sonnei strain SH11Sh418 plasmid pSh418-m3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

589. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KP347127 (Escherichia coli strain SHP45 plasmid pHNSHP45, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

590. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KP347127 (Escherichia coli strain SHP45 plasmid pHNSHP45, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

591. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KP347127 (Escherichia coli strain SHP45 plasmid pHNSHP45, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

592. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP043017 (Escherichia coli strain 388808_gen plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

593. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP043017 (Escherichia coli strain 388808_gen plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

594. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP043017 (Escherichia coli strain 388808_gen plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

595. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP043014 (Escherichia coli strain 388755_gen plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

596. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP043014 (Escherichia coli strain 388755_gen plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

597. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP043014 (Escherichia coli strain 388755_gen plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

598. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042629 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

599. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042629 (Escherichia coli strain NCYU-25-82 plasmid pNCYU-25-82-2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

600. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP017614 (Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_4, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

601. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP017614 (Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_4, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

602. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP017614 (Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_4, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

603. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to LC469775 (Escherichia coli C1 plasmid pC1 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

604. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to LC469775 (Escherichia coli C1 plasmid pC1 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

605. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to LC469775 (Escherichia coli C1 plasmid pC1 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

606. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to LC473131 (Escherichia coli C2 plasmid pC2 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

607. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to LC473131 (Escherichia coli C2 plasmid pC2 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

608. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to LC473131 (Escherichia coli C2 plasmid pC2 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

609. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041625 (Escherichia coli O157:H7 strain ATCC 43888 plasmid p35K_like, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

610. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041625 (Escherichia coli O157:H7 strain ATCC 43888 plasmid p35K_like, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

611. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034405 (Escherichia coli strain CRE10 plasmid pCRE10.3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

612. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034405 (Escherichia coli strain CRE10 plasmid pCRE10.3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

613. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY784668 (Shigella flexneri Y strain C960 plasmid pRC960-2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

614. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY784668 (Shigella flexneri Y strain C960 plasmid pRC960-2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

615. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY784668 (Shigella flexneri Y strain C960 plasmid pRC960-2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

616. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP017619 (Escherichia coli strain MRY15-117 plasmid pMRY15-117_2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

617. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP017619 (Escherichia coli strain MRY15-117 plasmid pMRY15-117_2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

618. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP017619 (Escherichia coli strain MRY15-117 plasmid pMRY15-117_2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

619. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011294 (Salmonella enterica subsp. diarizonae strain 11-01854 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

620. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011294 (Salmonella enterica subsp. diarizonae strain 11-01854 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

621. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011294 (Salmonella enterica subsp. diarizonae strain 11-01854 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

622. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011291 (Salmonella enterica subsp. diarizonae strain 11-01853 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

623. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011291 (Salmonella enterica subsp. diarizonae strain 11-01853 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

624. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011291 (Salmonella enterica subsp. diarizonae strain 11-01853 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

625. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP010220 (Escherichia coli strain M18 plasmid A, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

626. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP010220 (Escherichia coli strain M18 plasmid A, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

627. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP010220 (Escherichia coli strain M18 plasmid A, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

628. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028594 (Escherichia coli strain 150 plasmid pTA150-2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

629. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028594 (Escherichia coli strain 150 plasmid pTA150-2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

630. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MK875287 (Escherichia coli strain MFDS2054 plasmid pMFDS2054.1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

631. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MK852553 (Escherichia coli strain MFDS1339 plasmid pMFDS1339.1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

632. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MK852553 (Escherichia coli strain MFDS1339 plasmid pMFDS1339.1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

633. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MK852553 (Escherichia coli strain MFDS1339 plasmid pMFDS1339.1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

634. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034061 (Shigella flexneri strain FDAARGOS_535 plasmid unnamed2) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

635. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034061 (Shigella flexneri strain FDAARGOS_535 plasmid unnamed2) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

636. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034061 (Shigella flexneri strain FDAARGOS_535 plasmid unnamed2) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

637. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028153 (Salmonella enterica subsp. enterica serovar Enteritidis str. RM2968 plasmid pRM2968-2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

638. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028153 (Salmonella enterica subsp. enterica serovar Enteritidis str. RM2968 plasmid pRM2968-2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

639. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028155 (Salmonella enterica subsp. enterica serovar Enteritidis strain RM4283 plasmid pRM4283-2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

640. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028155 (Salmonella enterica subsp. enterica serovar Enteritidis strain RM4283 plasmid pRM4283-2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

641. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028155 (Salmonella enterica subsp. enterica serovar Enteritidis strain RM4283 plasmid pRM4283-2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

642. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033341 (Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN076214 plasmid pCFSAN076214_1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

643. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033341 (Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN076214 plasmid pCFSAN076214_1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

644. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031550 (Escherichia coli strain cq9 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

645. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031550 (Escherichia coli strain cq9 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

646. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031550 (Escherichia coli strain cq9 plasmid unnamed4, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

647. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN232187 (Escherichia coli plasmid pGD16-131, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

648. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN232187 (Escherichia coli plasmid pGD16-131, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

649. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN232187 (Escherichia coli plasmid pGD16-131, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

650. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN232193 (Escherichia coli plasmid pGD27-63, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

651. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN232193 (Escherichia coli plasmid pGD27-63, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

652. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN232193 (Escherichia coli plasmid pGD27-63, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

653. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN232209 (Escherichia coli plasmid pHLJ111-9, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

654. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN232209 (Escherichia coli plasmid pHLJ111-9, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

655. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN232209 (Escherichia coli plasmid pHLJ111-9, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

656. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN232214 (Escherichia fergusonii plasmid pHLJ179-85, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

657. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN232214 (Escherichia fergusonii plasmid pHLJ179-85, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

658. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN232214 (Escherichia fergusonii plasmid pHLJ179-85, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

659. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020924 (Salmonella enterica subsp. enterica strain 16A242 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

660. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020924 (Salmonella enterica subsp. enterica strain 16A242 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

661. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP020924 (Salmonella enterica subsp. enterica strain 16A242 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

662. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to AP018412 (Escherichia coli plasmid pRYU2912C-1 RYU 2912 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

663. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to AP018412 (Escherichia coli plasmid pRYU2912C-1 RYU 2912 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

664. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to AP018412 (Escherichia coli plasmid pRYU2912C-1 RYU 2912 DNA, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

665. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP037942 (Escherichia coli strain CFSAN027350 plasmid pCFSAN027350, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

666. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP037942 (Escherichia coli strain CFSAN027350 plasmid pCFSAN027350, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

667. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038409 (Escherichia coli O157:H7 strain 86-24 plasmid p86-24-2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

668. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038334 (Escherichia coli O157:H7 strain N8B7-2 plasmid pN8B7-2) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

669. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038334 (Escherichia coli O157:H7 strain N8B7-2 plasmid pN8B7-2) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

670. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038334 (Escherichia coli O157:H7 strain N8B7-2 plasmid pN8B7-2) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

671. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038381 (Escherichia coli O157:H7 strain E32511 plasmid pE32511-2) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

672. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038381 (Escherichia coli O157:H7 strain E32511 plasmid pE32511-2) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

673. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to LT174530 (Shigella sonnei plasmid pEG430-1, strain EG0430) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

674. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to LT174530 (Shigella sonnei plasmid pEG430-1, strain EG0430) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

675. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to LT174530 (Shigella sonnei plasmid pEG430-1, strain EG0430) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

676. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY363995 (Shigella sonnei strain SH13Sh069 plasmid pSh069-m6, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

677. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY363995 (Shigella sonnei strain SH13Sh069 plasmid pSh069-m6, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

678. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY363995 (Shigella sonnei strain SH13Sh069 plasmid pSh069-m6, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

679. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY363999 (Shigella sonnei strain SH10Sh016 plasmid pSh016-m1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

680. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY363999 (Shigella sonnei strain SH10Sh016 plasmid pSh016-m1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

681. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY363999 (Shigella sonnei strain SH10Sh016 plasmid pSh016-m1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

682. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY363996 (Shigella sonnei strain SH11Sh487 plasmid pSh487-m4, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

683. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY363996 (Shigella sonnei strain SH11Sh487 plasmid pSh487-m4, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

684. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY363996 (Shigella sonnei strain SH11Sh487 plasmid pSh487-m4, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

685. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY363998 (Shigella sonnei strain SH11Sh125 plasmid pSh125-m2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

686. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY363998 (Shigella sonnei strain SH11Sh125 plasmid pSh125-m2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

687. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY363998 (Shigella sonnei strain SH11Sh125 plasmid pSh125-m2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

688. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY363994 (Shigella sonnei strain SH12Sh113 plasmid pSh113-m4, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

689. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY363994 (Shigella sonnei strain SH12Sh113 plasmid pSh113-m4, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

690. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY363994 (Shigella sonnei strain SH12Sh113 plasmid pSh113-m4, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

691. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028605 (Escherichia coli strain 144 plasmid pTA144-2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

692. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028605 (Escherichia coli strain 144 plasmid pTA144-2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

693. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027334 (Escherichia coli strain 2013C-3277 plasmid unnamed3) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

694. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027334 (Escherichia coli strain 2013C-3277 plasmid unnamed3) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

695. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP039587 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014859 plasmid p11-0225.2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

696. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP039587 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014859 plasmid p11-0225.2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

697. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KX592672 (Escherichia coli plasmid pEc_04HAE12, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

698. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KX592672 (Escherichia coli plasmid pEc_04HAE12, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

699. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KX592672 (Escherichia coli plasmid pEc_04HAE12, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

700. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038307 (Escherichia coli O157:H7 strain SS NE 1040-1 plasmid pNE1040-3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

701. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038307 (Escherichia coli O157:H7 strain SS NE 1040-1 plasmid pNE1040-3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

702. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038311 (Escherichia coli O157:H7 strain Show KS 470-1 plasmid pKS470-3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

703. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038311 (Escherichia coli O157:H7 strain Show KS 470-1 plasmid pKS470-3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

704. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038367 (Escherichia coli O157:H7 strain F6667 plasmid pF6667-2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

705. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038367 (Escherichia coli O157:H7 strain F6667 plasmid pF6667-2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

706. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016388 (Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid p931IncI2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

707. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016388 (Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid p931IncI2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

708. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016388 (Salmonella enterica subsp. enterica serovar Typhimurium strain 13-931 plasmid p931IncI2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

709. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038303 (Escherichia coli O157:H7 strain SS TX 313-1 plasmid pTX313-2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

710. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038340 (Escherichia coli O157:H7 strain H6437 plasmid pH6437-2) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

711. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038340 (Escherichia coli O157:H7 strain H6437 plasmid pH6437-2) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

712. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038340 (Escherichia coli O157:H7 strain H6437 plasmid pH6437-2) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

713. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038361 (Escherichia coli O157:H7 strain F7386 plasmid pF7386-2) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

714. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038361 (Escherichia coli O157:H7 strain F7386 plasmid pF7386-2) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

715. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MK836306 (Escherichia coli strain NMG21 plasmid pMCR-NMG21, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

716. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MK836306 (Escherichia coli strain NMG21 plasmid pMCR-NMG21, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

717. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MK836306 (Escherichia coli strain NMG21 plasmid pMCR-NMG21, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

718. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034798 (Escherichia coli strain 08-3918 plasmid p08-3918-2) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

719. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034798 (Escherichia coli strain 08-3918 plasmid p08-3918-2) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

720. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034798 (Escherichia coli strain 08-3918 plasmid p08-3918-2) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

721. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018806 (Escherichia coli strain E2863 plasmid pE2863-4, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

722. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018806 (Escherichia coli strain E2863 plasmid pE2863-4, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

723. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018806 (Escherichia coli strain E2863 plasmid pE2863-4, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

724. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018807 (Escherichia coli strain E2863 plasmid pE2863-5, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

725. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018807 (Escherichia coli strain E2863 plasmid pE2863-5, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

726. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040110 (Escherichia coli O157:H7 strain MB9-1 plasmid pMB9_3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

727. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP040110 (Escherichia coli O157:H7 strain MB9-1 plasmid pMB9_3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

728. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021205 (Escherichia coli strain Z1002 plasmid p1002-MCR1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

729. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021205 (Escherichia coli strain Z1002 plasmid p1002-MCR1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

730. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021205 (Escherichia coli strain Z1002 plasmid p1002-MCR1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

731. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP007134 (Escherichia coli O145:H28 str. RM12761 plasmid pRM12761, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

732. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP007134 (Escherichia coli O145:H28 str. RM12761 plasmid pRM12761, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

733. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP008807 (Escherichia coli O157:H7 str. SS17 plasmid pSS17, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

734. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP008807 (Escherichia coli O157:H7 str. SS17 plasmid pSS17, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

735. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP006264 (Escherichia coli O145:H28 str. RM13516 plasmid pRM13516, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

736. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP006264 (Escherichia coli O145:H28 str. RM13516 plasmid pRM13516, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

737. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018812 (Escherichia coli strain E2865 plasmid pE2865-4, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

738. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018812 (Escherichia coli strain E2865 plasmid pE2865-4, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

739. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP018812 (Escherichia coli strain E2865 plasmid pE2865-4, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

740. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024858 (Escherichia coli strain AR_0011 plasmid tig00013784_pilon, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

741. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024858 (Escherichia coli strain AR_0011 plasmid tig00013784_pilon, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

742. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KU932022 (Escherichia coli plasmid pEC3II_1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

743. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KU932022 (Escherichia coli plasmid pEC3II_1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

744. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KU932023 (Escherichia coli plasmid pEC3II_2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

745. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KU932023 (Escherichia coli plasmid pEC3II_2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

746. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024156 (Escherichia coli strain 14EC047 plasmid p14EC047a, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

747. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024156 (Escherichia coli strain 14EC047 plasmid p14EC047a, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

748. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024156 (Escherichia coli strain 14EC047 plasmid p14EC047a, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

749. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024148 (Escherichia coli strain 14EC033 plasmid p14EC033a, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

750. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024148 (Escherichia coli strain 14EC033 plasmid p14EC033a, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

751. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024148 (Escherichia coli strain 14EC033 plasmid p14EC033a, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

752. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP017622 (Escherichia coli strain MRY15-131 plasmid pMRY15-131_2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

753. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP017622 (Escherichia coli strain MRY15-131 plasmid pMRY15-131_2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

754. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP017622 (Escherichia coli strain MRY15-131 plasmid pMRY15-131_2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

755. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019199 (Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_02, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

756. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019199 (Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_02, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

757. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_019039 (Escherichia coli plasmid pChi7122-3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

758. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_019039 (Escherichia coli plasmid pChi7122-3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

759. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_019039 (Escherichia coli plasmid pChi7122-3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

760. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

761. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

762. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041113 (Escherichia coli strain ECCTRSRTH03 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

763. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041113 (Escherichia coli strain ECCTRSRTH03 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

764. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041113 (Escherichia coli strain ECCTRSRTH03 plasmid unnamed3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

765. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN746291 (Escherichia coli strain GN2982 plasmid p25, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

766. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN746291 (Escherichia coli strain GN2982 plasmid p25, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

767. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN746291 (Escherichia coli strain GN2982 plasmid p25, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

768. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026644 (Escherichia coli strain FORC_082 plasmid pFORC82_3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

769. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026644 (Escherichia coli strain FORC_082 plasmid pFORC82_3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

770. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026644 (Escherichia coli strain FORC_082 plasmid pFORC82_3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

771. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026644 (Escherichia coli strain FORC_082 plasmid pFORC82_3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

772. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP026644 (Escherichia coli strain FORC_082 plasmid pFORC82_3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

773. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_002525 (Escherichia coli K-12 plasmid R721, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

774. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_002525 (Escherichia coli K-12 plasmid R721, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

775. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027450 (Escherichia coli strain 2014C-3097 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

776. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027450 (Escherichia coli strain 2014C-3097 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

777. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_011351 (Escherichia coli O157:H7 str. EC4115 plasmid pEC4115, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

778. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_011351 (Escherichia coli O157:H7 str. EC4115 plasmid pEC4115, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

779. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042885 (Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_01, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

780. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042888 (Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_04, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

781. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042888 (Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_04, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

782. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042888 (Escherichia coli O10:H32 strain NMBU-W12E19 plasmid pNMBU-W12E19_04, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

783. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034400 (Escherichia coli strain CRE1 plasmid pCRE1.3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

784. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034400 (Escherichia coli strain CRE1 plasmid pCRE1.3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

785. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034400 (Escherichia coli strain CRE1 plasmid pCRE1.3, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

786. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030284 (Escherichia coli strain E308 plasmid pLKSZ03, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

787. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030284 (Escherichia coli strain E308 plasmid pLKSZ03, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

788. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030284 (Escherichia coli strain E308 plasmid pLKSZ03, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

789. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MG557851 (Escherichia coli plasmid PN21, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

790. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MG557851 (Escherichia coli plasmid PN21, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

791. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MG557851 (Escherichia coli plasmid PN21, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

792. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KX856067 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pHSSH22-MCR1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

793. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KX856067 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pHSSH22-MCR1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

794. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KX856068 (Salmonella enterica subsp. enterica serovar Enteritidis plasmid pHSSH23-MCR1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

795. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KX856068 (Salmonella enterica subsp. enterica serovar Enteritidis plasmid pHSSH23-MCR1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

796. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KX856068 (Salmonella enterica subsp. enterica serovar Enteritidis plasmid pHSSH23-MCR1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

797. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KY657477 (Klebsiella aerogenes plasmid pCRENT-301_1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

798. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KY657477 (Klebsiella aerogenes plasmid pCRENT-301_1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

799. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KY657477 (Klebsiella aerogenes plasmid pCRENT-301_1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

800. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022051 (Escherichia coli O157 strain FDAARGOS_293 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

801. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022051 (Escherichia coli O157 strain FDAARGOS_293 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

802. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019052 (Escherichia coli strain CRE1540 plasmid p1540-1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

803. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019052 (Escherichia coli strain CRE1540 plasmid p1540-1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

804. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019052 (Escherichia coli strain CRE1540 plasmid p1540-1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

805. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038317 (Escherichia coli O157:H7 strain NE92 plasmid pNE92-2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

806. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029977 (Escherichia coli strain 51008369SK1 plasmid p51008369SK1_D, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

807. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029977 (Escherichia coli strain 51008369SK1 plasmid p51008369SK1_D, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

808. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029977 (Escherichia coli strain 51008369SK1 plasmid p51008369SK1_D, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

809. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041921 (Escherichia coli strain Ec40743 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

810. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041921 (Escherichia coli strain Ec40743 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

811. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041921 (Escherichia coli strain Ec40743 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

812. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041926 (Klebsiella aerogenes strain Ka37751 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

813. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041926 (Klebsiella aerogenes strain Ka37751 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

814. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041926 (Klebsiella aerogenes strain Ka37751 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

815. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051226 (Escherichia coli strain SCZE5 plasmid pSCZE4) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

816. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051226 (Escherichia coli strain SCZE5 plasmid pSCZE4) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

817. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051226 (Escherichia coli strain SCZE5 plasmid pSCZE4) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

818. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018106 (Escherichia coli strain MRSN352231 plasmid pMR0716_mcr1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

819. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018106 (Escherichia coli strain MRSN352231 plasmid pMR0716_mcr1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

820. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018106 (Escherichia coli strain MRSN352231 plasmid pMR0716_mcr1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

821. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016405 (Escherichia coli strain 210205630 plasmid pSLy21, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

822. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016405 (Escherichia coli strain 210205630 plasmid pSLy21, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

823. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP016405 (Escherichia coli strain 210205630 plasmid pSLy21, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

824. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031296 (Escherichia coli strain EC17GD31 plasmid pGD31-MCR, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

825. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031296 (Escherichia coli strain EC17GD31 plasmid pGD31-MCR, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

826. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018124 (Escherichia coli strain MRSN346355 plasmid pMRSN346355_65.5, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

827. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018124 (Escherichia coli strain MRSN346355 plasmid pMRSN346355_65.5, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

828. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP018124 (Escherichia coli strain MRSN346355 plasmid pMRSN346355_65.5, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

829. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH213346 (Escherichia coli strain EC1188 plasmid pEC1188-MCR, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

830. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH213346 (Escherichia coli strain EC1188 plasmid pEC1188-MCR, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

831. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH213346 (Escherichia coli strain EC1188 plasmid pEC1188-MCR, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

832. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG210940 (Escherichia coli strain GZ49273 plasmid pGZ49273, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

833. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG210940 (Escherichia coli strain GZ49273 plasmid pGZ49273, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

834. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG210940 (Escherichia coli strain GZ49273 plasmid pGZ49273, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

835. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF175187 (Escherichia coli strain PC11 plasmid pPC11, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

836. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF175187 (Escherichia coli strain PC11 plasmid pPC11, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

837. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG489944 (Escherichia coli strain PN16 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

838. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG489944 (Escherichia coli strain PN16 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

839. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG489944 (Escherichia coli strain PN16 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

840. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG825369 (Escherichia coli strain 974 plasmid p974-MCR, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

841. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG825369 (Escherichia coli strain 974 plasmid p974-MCR, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

842. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG825369 (Escherichia coli strain 974 plasmid p974-MCR, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

843. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG598815 (Escherichia coli isolate 4070 plasmid p4070, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

844. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG598815 (Escherichia coli isolate 4070 plasmid p4070, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

845. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG598815 (Escherichia coli isolate 4070 plasmid p4070, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

846. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG594798 (Escherichia coli strain 6383 plasmid p6383, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

847. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG594798 (Escherichia coli strain 6383 plasmid p6383, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

848. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG598816 (Escherichia coli isolate 979 plasmid p979, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

849. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG598816 (Escherichia coli isolate 979 plasmid p979, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

850. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG598816 (Escherichia coli isolate 979 plasmid p979, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

851. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG515249 (Escherichia coli strain EC16-50 plasmid pEC16-50-MCR, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

852. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG515249 (Escherichia coli strain EC16-50 plasmid pEC16-50-MCR, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

853. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG515249 (Escherichia coli strain EC16-50 plasmid pEC16-50-MCR, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

854. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG594799 (Escherichia coli isolate 4222 plasmid p4222, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

855. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG594799 (Escherichia coli isolate 4222 plasmid p4222, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

856. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG594799 (Escherichia coli isolate 4222 plasmid p4222, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

857. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH522409 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH12G402 plasmid pSH12G402, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

858. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH522409 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH12G402 plasmid pSH12G402, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

859. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH522409 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH12G402 plasmid pSH12G402, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

860. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH522410 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH12G950 plasmid pSH12G950, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

861. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH522410 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH12G950 plasmid pSH12G950, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

862. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH522410 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH12G950 plasmid pSH12G950, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

863. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH522411 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH13G841 plasmid pSH13G841, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

864. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH522411 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH13G841 plasmid pSH13G841, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

865. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH522411 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH13G841 plasmid pSH13G841, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

866. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH522416 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH15G1531 plasmid pSH15G1531, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

867. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH522416 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH15G1531 plasmid pSH15G1531, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

868. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH522416 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH15G1531 plasmid pSH15G1531, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

869. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH271383 (Escherichia coli strain V80 plasmid mcr-1_pV80_dog, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

870. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH271383 (Escherichia coli strain V80 plasmid mcr-1_pV80_dog, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

871. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH271383 (Escherichia coli strain V80 plasmid mcr-1_pV80_dog, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

872. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH522414 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH15G1493 plasmid pSH15G1493, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

873. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH522414 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH15G1493 plasmid pSH15G1493, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

874. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH522414 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH15G1493 plasmid pSH15G1493, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

875. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH522415 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH15G1527 plasmid pSH15G1527, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

876. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH522415 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH15G1527 plasmid pSH15G1527, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

877. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH522415 (Salmonella enterica subsp. enterica serovar Typhimurium strain SH15G1527 plasmid pSH15G1527, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

878. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK041211 (Citrobacter amalonaticus strain M21015 plasmid pMCR-M21015, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

879. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK041211 (Citrobacter amalonaticus strain M21015 plasmid pMCR-M21015, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

880. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK041211 (Citrobacter amalonaticus strain M21015 plasmid pMCR-M21015, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

881. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY802014 (Escherichia coli strain ZE36 plasmid pZE36, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

882. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY802014 (Escherichia coli strain ZE36 plasmid pZE36, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

883. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY802014 (Escherichia coli strain ZE36 plasmid pZE36, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

884. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY795977 (Escherichia coli strain JIE2288 plasmid pJIE2288-1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

885. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY795977 (Escherichia coli strain JIE2288 plasmid pJIE2288-1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

886. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KY795977 (Escherichia coli strain JIE2288 plasmid pJIE2288-1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

887. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF521836 (Escherichia coli str. K-12 substr. MG1655 strain K-12 plasmid TP114, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

888. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF521836 (Escherichia coli str. K-12 substr. MG1655 strain K-12 plasmid TP114, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

889. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF521836 (Escherichia coli str. K-12 substr. MG1655 strain K-12 plasmid TP114, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

890. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG747472 (Klebsiella pneumoniae strain 09-20 plasmid pK09-20-mcr-1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

891. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG747472 (Klebsiella pneumoniae strain 09-20 plasmid pK09-20-mcr-1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccggg	Protospacer
***************************.****

892. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG747472 (Klebsiella pneumoniae strain 09-20 plasmid pK09-20-mcr-1, complete sequence) position: , mismatch: 1, identity: 0.969

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgtcggg	Protospacer
******************.*************

893. spacer 2.4|3064518|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN927225 (Escherichia phage vB_EcoS_XY1, complete genome) position: , mismatch: 1, identity: 0.969

atgaagagtattgatatcgcccgtaaatacgg	CRISPR spacer
atgaagattattgatatcgcccgtaaatacgg	Protospacer
******* ************************

894. spacer 2.4|3064518|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MG252615 (Escherichia phage vB_EcoS_HSE2, complete genome) position: , mismatch: 1, identity: 0.969

atgaagagtattgatatcgcccgtaaatacgg	CRISPR spacer
atgaagattattgatatcgcccgtaaatacgg	Protospacer
******* ************************

895. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021754 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_3, complete sequence) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccggg	Protospacer
*****************.*********.****

896. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011978 (Klebsiella pneumoniae DMC1097 plasmid pDMC1097-77.775kb, complete sequence) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccggg	Protospacer
*****************.*********.****

897. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS992189 (Escherichia coli isolate Escherichia coli str. 3426 plasmid 5) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccggg	Protospacer
*****************.*********.****

898. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021546 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000002, complete sequence) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccggg	Protospacer
*****************.*********.****

899. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021861 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000009_pilon, complete sequence) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccggg	Protospacer
*****************.*********.****

900. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011645 (Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-78, complete sequence) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccggg	Protospacer
*****************.*********.****

901. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_022520 (Klebsiella pneumoniae plasmid pBK15692, complete sequence) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccggg	Protospacer
*****************.*********.****

902. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP028153 (Salmonella enterica subsp. enterica serovar Enteritidis str. RM2968 plasmid pRM2968-2, complete sequence) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccggg	Protospacer
*****************.*********.****

903. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP033341 (Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN076214 plasmid pCFSAN076214_1, complete sequence) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccggg	Protospacer
*****************.*********.****

904. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038381 (Escherichia coli O157:H7 strain E32511 plasmid pE32511-2) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccggg	Protospacer
*****************.*********.****

905. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP039587 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014859 plasmid p11-0225.2, complete sequence) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgctctgtcggg	Protospacer
******************.****.********

906. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038361 (Escherichia coli O157:H7 strain F7386 plasmid pF7386-2) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccggg	Protospacer
*****************.*********.****

907. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP007134 (Escherichia coli O145:H28 str. RM12761 plasmid pRM12761, complete sequence) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgctctgtcggg	Protospacer
******************.****.********

908. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP006264 (Escherichia coli O145:H28 str. RM13516 plasmid pRM13516, complete sequence) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgctctgtcggg	Protospacer
******************.****.********

909. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024858 (Escherichia coli strain AR_0011 plasmid tig00013784_pilon, complete sequence) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccggg	Protospacer
*****************.*********.****

910. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KU932022 (Escherichia coli plasmid pEC3II_1, complete sequence) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccggg	Protospacer
*****************.*********.****

911. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to KU932023 (Escherichia coli plasmid pEC3II_2, complete sequence) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccggg	Protospacer
*****************.*********.****

912. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_002525 (Escherichia coli K-12 plasmid R721, complete sequence) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccggg	Protospacer
*****************.*********.****

913. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029977 (Escherichia coli strain 51008369SK1 plasmid p51008369SK1_D, complete sequence) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccggg	Protospacer
*****************.*********.****

914. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF175187 (Escherichia coli strain PC11 plasmid pPC11, complete sequence) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttccatgccctgccggg	Protospacer
******************.********.****

915. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027455 (Escherichia coli strain 2014C-4423 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccgga	Protospacer
***************************.***.

916. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP023367 (Escherichia coli strain 1428 plasmid p111, complete sequence) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgccgga	Protospacer
***************************.***.

917. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK416152 (Escherichia coli strain 6BS17eCTX plasmid pHNBS17e, complete sequence) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgtcgga	Protospacer
*****************.*************.

918. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024283 (Escherichia albertii strain 2014C-4356 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgctggg	Protospacer
***************************..***

919. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024283 (Escherichia albertii strain 2014C-4356 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgctggg	Protospacer
***************************..***

920. spacer 2.4|3064518|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_042084 (Escherichia phage VB_EcoS-Golestan, complete genome) position: , mismatch: 2, identity: 0.938

atgaagagtattgatatcgcccgtaaatacgg	CRISPR spacer
atgaagaatatcgatatcgcccgtaaatacgg	Protospacer
*******.***.********************

921. spacer 2.4|3064518|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MK737937 (Raoultella phage RP180, complete genome) position: , mismatch: 2, identity: 0.938

atgaagagtattgatatcgcccgtaaatacgg	CRISPR spacer
atgaagaatatcgatatcgcccgtaaatacgg	Protospacer
*******.***.********************

922. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_KX276657 (Escherichia coli strain MRSN388634 plasmid pMR0516mcr, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

923. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP010232 (Escherichia coli strain S30 plasmid A, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

924. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP023192 (Escherichia coli strain TUM18530 plasmid pMTY18530-2, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

925. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP038182 (Escherichia coli strain 2 HS-C plasmid p2HS-C-2, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

926. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053732 (Escherichia coli strain CP55_Sichuan plasmid pCP55-IncFIB, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

927. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS999561 (Escherichia coli isolate EC-TO143 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

928. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LS992167 (Escherichia coli isolate Escherichia coli str. TO6 plasmid 2, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

929. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_010488 (Escherichia coli SMS-3-5 plasmid pSMS35_130, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

930. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019282 (Escherichia coli strain 13P484A plasmid p13P484A-2, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

931. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP034739 (Escherichia coli strain L65 plasmid pL65-2, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

932. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051220 (Escherichia coli strain SFE8 plasmid pSCZP1, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttctccccttctatgccctgccgga	Protospacer
********** ****************.***.

933. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP054364 (Escherichia coli strain SCU-171 plasmid pSCU-171-1, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

934. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP054364 (Escherichia coli strain SCU-171 plasmid pSCU-171-1, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttcaatgccctgccgga	Protospacer
****************** ********.***.

935. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP021728 (Escherichia coli strain Combat11I9 plasmid pCombat11I9-2, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

936. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP049082 (Escherichia coli strain p10A plasmid p10A_p1, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

937. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN158992 (Escherichia coli strain TREC9 plasmid pTREC9, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

938. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019247 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-2, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

939. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029243 (Escherichia coli strain ECCRA-119 plasmid pTB201, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

940. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029748 (Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

941. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CM019851 (Escherichia coli strain CVM N17EC0326 plasmid pN17EC0326-1, complete sequence, whole genome shotgun sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttctccccttctatgccctgccgga	Protospacer
********** ****************.***.

942. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041434 (Escherichia coli strain STEC313 plasmid pSTEC313, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatggcctgccgga	Protospacer
********************** ****.***.

943. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041430 (Escherichia coli strain STEC367 plasmid pSTEC367, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatggcctgccgga	Protospacer
********************** ****.***.

944. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to LT906556 (Escherichia coli isolate E. coli RL465 genome assembly, plasmid: I) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

945. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP032263 (Escherichia coli strain AR_0089 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

946. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN158991 (Escherichia coli strain TREC8 plasmid pTREC8, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

947. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP053236 (Escherichia coli strain SCU-106 plasmid pSCU-106-2, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

948. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP044347 (Escherichia coli strain P225M plasmid pP225M-CTX-M-55, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

949. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP027357 (Escherichia coli strain 2013C-4991 plasmid unnamed2) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

950. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041424 (Escherichia coli strain STEC409 plasmid pSTEC409_2, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatggcctgccgga	Protospacer
********************** ****.***.

951. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041432 (Escherichia coli strain STEC316 plasmid pSTEC316, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatggcctgccgga	Protospacer
********************** ****.***.

952. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP019007 (Escherichia coli strain Ecol_AZ159 plasmid pECAZ159_1, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

953. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP011916 (Escherichia coli strain PSUO2 plasmid pPSUO2, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

954. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012500 (Escherichia coli strain 09-00049 plasmid pCFSAN004180G, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgcagga	Protospacer
***************************. **.

955. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012501 (Escherichia coli strain 08-00022 plasmid pCFSAN004179G, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgcagga	Protospacer
***************************. **.

956. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP047878 (Escherichia coli strain LD22-1 plasmid pLD22-1-135kb, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

957. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP046718 (Escherichia coli strain T16R plasmid pT16R-2, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

958. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041303 (Escherichia coli strain MSHS 133 plasmid pCys-11, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

959. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_011964 (Escherichia coli plasmid pAPEC-O103-ColBM, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

960. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024852 (Escherichia coli strain AR_0006 plasmid tig00000164, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

961. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP022732 (Escherichia coli strain SA186 plasmid pSA186_3, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

962. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_LT985319 (Escherichia coli strain ECOR 30 genome assembly, plasmid: RCS96_pII) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

963. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP019676 (Escherichia coli strain GSH8M-2 plasmid pGSH8M-2-1, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

964. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051739 (Escherichia coli strain SCU-105 plasmid pSCU-105-1, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgcagga	Protospacer
***************************. **.

965. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012377 (Escherichia coli strain GE3 isolate human faeces plasmid pGE3, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

966. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024827 (Escherichia coli strain CREC-544 plasmid pCREC-544_1, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

967. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024158 (Escherichia coli strain 14EC047 plasmid p14EC047c, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

968. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_025175 (Escherichia coli plasmid pH2332-166, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

969. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_025139 (Escherichia coli plasmid pH2291-144, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

970. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042296 (Escherichia coli strain RM9088 plasmid p1RM9088, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgcagga	Protospacer
***************************. **.

971. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP010149 (Escherichia coli strain D6 plasmid A, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

972. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN158989 (Escherichia coli strain TREC1 plasmid pTREC1, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

973. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041301 (Escherichia coli strain MSHS 472 plasmid pCys-6, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

974. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP047577 (Escherichia coli strain 94EC plasmid p94EC-1, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

975. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP042586 (Escherichia coli strain LD91-1 plasmid pLD91-1-146kb, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

976. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_010409 (Escherichia coli plasmid pVM01, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

977. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP043743 (Escherichia coli strain CVM N17EC0211 plasmid pN17EC0211, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

978. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN419430 (Escherichia coli strain 2016-4017437 plasmid p17437, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

979. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012499 (Escherichia coli strain GB089 plasmid pCFSAN004181P, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgcagga	Protospacer
***************************. **.

980. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP030282 (Escherichia coli strain E308 plasmid pLKSZ01, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttctccccttctatgccctgccgga	Protospacer
********** ****************.***.

981. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_020271 (Escherichia coli O25b:H4-ST131 str. EC958 strain ST131 plasmid pJIE186-2, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

982. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN848327 (Escherichia coli strain T16RC plasmid pT16RC-1, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

983. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to MN823988 (Escherichia coli strain 14406 plasmid p14406-FII, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

984. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP047667 (Escherichia coli strain LD26-1 plasmid pLD26-1-135kb, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

985. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP048026 (Escherichia coli strain GZEC065 plasmid pTEM1-GZEC065, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

986. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_AP023199 (Escherichia coli strain TUM18780 plasmid pMTY18780-2, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

987. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041920 (Escherichia coli strain Ec40743 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

988. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051224 (Escherichia coli strain SCZE5 plasmid pSCZE2) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

989. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP029842 (Salmonella enterica subsp. enterica serovar Typhimurium strain 01ST04081 plasmid p01ST04081B, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttctccccttctatgccctgccgga	Protospacer
********** ****************.***.

990. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP041997 (Escherichia coli strain AR Bank #0349 plasmid pAR349, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

991. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_014615 (Escherichia coli plasmid pETN48, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

992. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP027377 (Escherichia coli strain 2013C-4404 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttctatgccctgcagga	Protospacer
***************************. **.

993. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024140 (Escherichia coli strain 14EC020 plasmid p14EC020b, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

994. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024137 (Escherichia coli strain 14EC017 plasmid p14EC017c, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

995. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031295 (Escherichia coli strain EC17GD31 plasmid pGD31-F1928, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

996. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_017659 (Escherichia coli O83:H1 str. NRG 857C plasmid pO83_CORR, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

997. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK430046 (Escherichia coli strain 11.4-R4 plasmid pCERC13, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

998. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MK416151 (Escherichia coli strain 6TC9eCTX plasmid pHNTC9e, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

999. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MN053930 (Escherichia coli strain 2.3-R4 plasmid pCERC14, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

1000. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MH580302 (Escherichia coli strain 1107 plasmid p1107-118K, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

1001. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG014722 (Escherichia coli strain P2-3 plasmid pP2-3T, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

1002. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF474175 (Escherichia coli strain J53/pNIT-HK plasmid pNIT-HK, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

1003. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF589339 (Escherichia coli strain 2271 plasmid pCTXM-2271, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

1004. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MF174860 (Escherichia coli strain 6/14/6b plasmid pIncF-MU4, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

1005. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG385063 (Escherichia coli strain WF5-29 plasmid pWF5-29, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

1006. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_MG838205 (Escherichia coli strain 92944 plasmid p92944-mph, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

1007. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to CP043741 (Escherichia coli strain CVM N17EC0320 plasmid pN17EC0320-2, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

1008. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_009837 (Escherichia coli APEC O1 plasmid pAPEC-O1-ColBM, complete sequence) position: , mismatch: 3, identity: 0.906

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccccttttatgccctgccgga	Protospacer
*****************.*********.***.

1009. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP012498 (Escherichia coli strain 06-00048 plasmid pCFSAN004178P_02, complete sequence) position: , mismatch: 4, identity: 0.875

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgcctcttctatgccctgcagga	Protospacer
*************.*************. **.

1010. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024150 (Escherichia coli strain 14EC033 plasmid p14EC033c, complete sequence) position: , mismatch: 4, identity: 0.875

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
attttctttcgccacttctatgccctgcagga	Protospacer
************* *************. **.

1011. spacer 2.3|3064457|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP051699 (Escherichia coli strain SCU-152 plasmid pSCU-152-1, complete sequence) position: , mismatch: 7, identity: 0.781

ttatcctgcgcagcgttgaacgc---cagaacagc	CRISPR spacer
ttatcctgcgcagccttcaacgcattcagttc---	Protospacer
************** ** *****   ***  *   

1012. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NC_005247 (Erwinia amylovora UTRJ2 plasmid pEU30, complete sequence) position: , mismatch: 8, identity: 0.75

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
acgttctttcgcgccttccatgccctccgggc	Protospacer
*. ********* *****.******* . ** 

1013. spacer 2.4|3064518|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP024789 (Nostoc flagelliforme CCNUN1 plasmid pNFSY04, complete sequence) position: , mismatch: 8, identity: 0.75

atgaagagtattgatatcgcccgtaaatacgg	CRISPR spacer
aataagagtattgatatcttccgtaaagaatt	Protospacer
*  *************** .******* *   

1014. spacer 2.1|3064335|32|CP030783|CRT matches to MF417888 (Uncultured Caudovirales phage clone 9S_3, partial genome) position: , mismatch: 9, identity: 0.719

gtaactcttcttctgtgccgtgatttttctcc	CRISPR spacer
ataactcttcttctgtgtagtgatgtgcgtgt	Protospacer
.****************. ***** * . * .

1015. spacer 2.2|3064396|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP049355 (Escherichia coli strain T28R plasmid pT28R-2, complete sequence) position: , mismatch: 10, identity: 0.688

attttctttcgccccttctatgccctgtcggg	CRISPR spacer
gcatcacctcgccccttttatgccctgccgga	Protospacer
.. *. ..*********.*********.***.

1016. spacer 2.3|3064457|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ttatcctgcgcagcgttgaacgccagaacagc	CRISPR spacer
cgtgtcaaagcagcgttgaacgccaaaacggc	Protospacer
.   .* . ****************.***.**

1017. spacer 2.7|3064701|32|CP030783|CRT,PILER-CR,CRISPRCasFinder matches to NZ_CP031608 (Xanthomonas hortorum strain VT106 plasmid pVT106, complete sequence) position: , mismatch: 10, identity: 0.688

tatcaagcaacgtggtgcgggttcaaatctga	CRISPR spacer
gagcaagcgacgtggtgcaggttcaagggctg	Protospacer
 * *****.*********.*******.  . .

1018. spacer 1.1|2731858|54|CP030783|CRISPRCasFinder matches to NZ_CP019906 (Escherichia coli strain MDR_56 plasmid unnamed5, complete sequence) position: , mismatch: 12, identity: 0.778

tcccgcaggccggataagacgcggcaagcgtcgcatcaggcaatgcgtcactaa	CRISPR spacer
attcgtcggccggataagacgcggcaagcgtcgcatccggcaatgtgcttcaac	Protospacer
 ..**. ****************************** *******.*.. * * 

1019. spacer 1.1|2731858|54|CP030783|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 12, identity: 0.778

tcccgcaggccggataagacgcggcaagcgtcgcatcaggcaatgcgtcactaa-	CRISPR spacer
tggcgtaggcctgataagacgcggcaagcgtcgcatcaggcgttg-atgtcggat	Protospacer
*  **.***** *****************************. ** .*  * .* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage