Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP030780 Escherichia albertii strain 05-3106 plasmid unnamed2, complete sequence 0 crisprs NA 0 0 0 0
CP030778 Escherichia albertii strain 05-3106 chromosome, complete genome 5 crisprs NA 0 3 0 0
CP030779 Escherichia albertii strain 05-3106 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP030778
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030778_1 449225-449348 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030778_2 1176560-1176707 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030778_3 1386807-1386937 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030778_4 3992603-3992745 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030778_5 4342051-4342139 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP030778_5 5.1|4342074|43|CP030778|CRISPRCasFinder 4342074-4342116 43 NC_016160 Escherichia phage HK75, complete genome 28589-28631 0 1.0
CP030778_5 5.1|4342074|43|CP030778|CRISPRCasFinder 4342074-4342116 43 NC_019705 Enterobacteria phage mEpX2, complete genome 29043-29085 0 1.0
CP030778_5 5.1|4342074|43|CP030778|CRISPRCasFinder 4342074-4342116 43 KY979108 Escherichia phage ECP1, complete genome 424-466 0 1.0
CP030778_5 5.1|4342074|43|CP030778|CRISPRCasFinder 4342074-4342116 43 NC_019719 Enterobacteria phage HK633, complete genome 31737-31779 0 1.0
CP030778_5 5.1|4342074|43|CP030778|CRISPRCasFinder 4342074-4342116 43 JF974339 Enterobacteria phage IME10, complete genome 9720-9762 0 1.0
CP030778_5 5.1|4342074|43|CP030778|CRISPRCasFinder 4342074-4342116 43 NC_005344 Enterobacteria phage Sf6, complete genome 28407-28449 1 0.977
CP030778_5 5.1|4342074|43|CP030778|CRISPRCasFinder 4342074-4342116 43 NC_019715 Enterobacterial phage mEp234, complete genome 30405-30447 1 0.977
CP030778_5 5.1|4342074|43|CP030778|CRISPRCasFinder 4342074-4342116 43 NC_019711 Enterobacteria phage HK629, complete genome 37166-37208 1 0.977
CP030778_5 5.1|4342074|43|CP030778|CRISPRCasFinder 4342074-4342116 43 NC_019769 Enterobacteria phage HK542, complete genome 29172-29214 1 0.977
CP030778_5 5.1|4342074|43|CP030778|CRISPRCasFinder 4342074-4342116 43 NC_019768 Enterobacteria phage HK106, complete genome 32701-32743 1 0.977
CP030778_1 1.1|449268|38|CP030778|CRISPRCasFinder 449268-449305 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 3 0.921
CP030778_5 5.1|4342074|43|CP030778|CRISPRCasFinder 4342074-4342116 43 MW013502 Salmonella virus L cI-40 13-am43, complete genome 31669-31711 5 0.884
CP030778_5 5.1|4342074|43|CP030778|CRISPRCasFinder 4342074-4342116 43 NC_004348 Enterobacteria phage ST64T, complete genome 14871-14913 5 0.884
CP030778_5 5.1|4342074|43|CP030778|CRISPRCasFinder 4342074-4342116 43 MW013503 Salmonella virus L cII-101, complete genome 31670-31712 5 0.884
CP030778_5 5.1|4342074|43|CP030778|CRISPRCasFinder 4342074-4342116 43 AY052766 Salmonella typhimurium bacteriophage ST64T, complete genome 14871-14913 5 0.884
CP030778_5 5.1|4342074|43|CP030778|CRISPRCasFinder 4342074-4342116 43 MF188997 Salmonella phage vB_SalP_PM43, complete genome 14766-14808 5 0.884
CP030778_2 2.1|1176588|32|CP030778|CRISPRCasFinder 1176588-1176619 32 MH533020 Acinetobacter phage ABPH49, complete genome 116253-116284 10 0.688

1. spacer 5.1|4342074|43|CP030778|CRISPRCasFinder matches to NC_016160 (Escherichia phage HK75, complete genome) position: , mismatch: 0, identity: 1.0 

gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	CRISPR spacer
gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	Protospacer
*******************************************

2. spacer 5.1|4342074|43|CP030778|CRISPRCasFinder matches to NC_019705 (Enterobacteria phage mEpX2, complete genome) position: , mismatch: 0, identity: 1.0 

gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	CRISPR spacer
gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	Protospacer
*******************************************

3. spacer 5.1|4342074|43|CP030778|CRISPRCasFinder matches to KY979108 (Escherichia phage ECP1, complete genome) position: , mismatch: 0, identity: 1.0 

gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	CRISPR spacer
gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	Protospacer
*******************************************

4. spacer 5.1|4342074|43|CP030778|CRISPRCasFinder matches to NC_019719 (Enterobacteria phage HK633, complete genome) position: , mismatch: 0, identity: 1.0 

gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	CRISPR spacer
gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	Protospacer
*******************************************

5. spacer 5.1|4342074|43|CP030778|CRISPRCasFinder matches to JF974339 (Enterobacteria phage IME10, complete genome) position: , mismatch: 0, identity: 1.0 

gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	CRISPR spacer
gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	Protospacer
*******************************************

6. spacer 5.1|4342074|43|CP030778|CRISPRCasFinder matches to NC_005344 (Enterobacteria phage Sf6, complete genome) position: , mismatch: 1, identity: 0.977 

gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	CRISPR spacer
tttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	Protospacer
 ******************************************

7. spacer 5.1|4342074|43|CP030778|CRISPRCasFinder matches to NC_019715 (Enterobacterial phage mEp234, complete genome) position: , mismatch: 1, identity: 0.977 

gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	CRISPR spacer
gttgtccaacgcaaacaccagtaatggcgcggatctcagcgga	Protospacer
******************************** **********

8. spacer 5.1|4342074|43|CP030778|CRISPRCasFinder matches to NC_019711 (Enterobacteria phage HK629, complete genome) position: , mismatch: 1, identity: 0.977 

gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	CRISPR spacer
gttgtccaacgcaaacaccagtaatggcgcgtctctcagcgga	Protospacer
******************************* ***********

9. spacer 5.1|4342074|43|CP030778|CRISPRCasFinder matches to NC_019769 (Enterobacteria phage HK542, complete genome) position: , mismatch: 1, identity: 0.977 

gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	CRISPR spacer
gttgtccaacgcaaacaccagtaatggtgcggctctcagcgga	Protospacer
***************************.***************

10. spacer 5.1|4342074|43|CP030778|CRISPRCasFinder matches to NC_019768 (Enterobacteria phage HK106, complete genome) position: , mismatch: 1, identity: 0.977 

gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	CRISPR spacer
gttgtccaacgcaaacaccagtaatggcgcggatctcagcgga	Protospacer
******************************** **********

11. spacer 1.1|449268|38|CP030778|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 3, identity: 0.921 

cggacgcaatatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.******. ****************************

12. spacer 5.1|4342074|43|CP030778|CRISPRCasFinder matches to MW013502 (Salmonella virus L cI-40 13-am43, complete genome) position: , mismatch: 5, identity: 0.884 

gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	CRISPR spacer
gatgtccaacgcaaacaccagtaatgacgcggctcacagcaaa	Protospacer
* ************************.******** ****..*

13. spacer 5.1|4342074|43|CP030778|CRISPRCasFinder matches to NC_004348 (Enterobacteria phage ST64T, complete genome) position: , mismatch: 5, identity: 0.884 

gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	CRISPR spacer
gatgtccaacgcaaacaccagtaatgacgcggctcacagcaaa	Protospacer
* ************************.******** ****..*

14. spacer 5.1|4342074|43|CP030778|CRISPRCasFinder matches to MW013503 (Salmonella virus L cII-101, complete genome) position: , mismatch: 5, identity: 0.884 

gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	CRISPR spacer
gatgtccaacgcaaacaccagtaatgacgcggctcacagcaaa	Protospacer
* ************************.******** ****..*

15. spacer 5.1|4342074|43|CP030778|CRISPRCasFinder matches to AY052766 (Salmonella typhimurium bacteriophage ST64T, complete genome) position: , mismatch: 5, identity: 0.884 

gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	CRISPR spacer
gatgtccaacgcaaacaccagtaatgacgcggctcacagcaaa	Protospacer
* ************************.******** ****..*

16. spacer 5.1|4342074|43|CP030778|CRISPRCasFinder matches to MF188997 (Salmonella phage vB_SalP_PM43, complete genome) position: , mismatch: 5, identity: 0.884 

gttgtccaacgcaaacaccagtaatggcgcggctctcagcgga	CRISPR spacer
gatgtccaacgcaaacaccagtaatgacgcggctcacagcaaa	Protospacer
* ************************.******** ****..*

17. spacer 2.1|1176588|32|CP030778|CRISPRCasFinder matches to MH533020 (Acinetobacter phage ABPH49, complete genome) position: , mismatch: 10, identity: 0.688 

atcaccgcttgttccagcgttgcgaactcatc	CRISPR spacer
gcatctgcttgttccagcgtgtcgaactccca	Protospacer
..  *.**************  ******* .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage