Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP030764 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence 0 crisprs csa3,DEDDh 0 0 0 0
CP030762 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed2, complete sequence 0 crisprs PD-DExK 0 0 2 0
CP030763 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence 0 crisprs NA 0 0 0 0
CP030760 Rhizobium leguminosarum strain ATCC 14479 chromosome, complete genome 1 crisprs csa3,DEDDh,WYL,cas3 0 1 5 0
CP030761 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence 0 crisprs csa3 0 0 0 0

Results visualization

1. CP030762
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6421 : 70954 67 Mycobacterium_phage(16.67%) transposase,integrase attL 36152:36211|attR 71702:71715
DBSCAN-SWA_2 121061 : 136652 19 Escherichia_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP030760
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030760_1 4119676-4119755 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP030760_1 1.1|4119699|34|CP030760|CRISPRCasFinder 4119699-4119732 34 NC_012858 Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence 179879-179912 9 0.735

1. spacer 1.1|4119699|34|CP030760|CRISPRCasFinder matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 9, identity: 0.735

cgggcaacatcatgctcccactattaaagcatgg	CRISPR spacer
cggacaacatcatgctccaactatataatttaga	Protospacer
***.************** *****  ** .  *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4126 : 14835 7 Bacillus_phage(16.67%) protease NA
DBSCAN-SWA_2 303406 : 316787 13 uncultured_Mediterranean_phage(90.91%) tRNA NA
DBSCAN-SWA_3 594028 : 604297 10 uncultured_Mediterranean_phage(83.33%) NA NA
DBSCAN-SWA_4 1578908 : 1592711 10 Vibrio_phage(25.0%) NA NA
DBSCAN-SWA_5 2557658 : 2567569 9 Mycobacterium_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage