Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP030039 Kocuria sp. BT304 chromosome, complete genome 1 crisprs NA 0 1 0 0

Results visualization

1. CP030039
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030039_1 1000778-1000861 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP030039_1 1.1|1000803|34|CP030039|CRISPRCasFinder 1000803-1000836 34 NZ_CP013110 Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence 46658-46691 9 0.735
CP030039_1 1.1|1000803|34|CP030039|CRISPRCasFinder 1000803-1000836 34 NZ_CP023068 Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence 97769-97802 9 0.735
CP030039_1 1.1|1000803|34|CP030039|CRISPRCasFinder 1000803-1000836 34 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 179509-179542 10 0.706
CP030039_1 1.1|1000803|34|CP030039|CRISPRCasFinder 1000803-1000836 34 NZ_CP030263 Ensifer adhaerens strain Corn53 plasmid AA, complete sequence 1771381-1771414 10 0.706
CP030039_1 1.1|1000803|34|CP030039|CRISPRCasFinder 1000803-1000836 34 NZ_CP013054 Sinorhizobium americanum CCGM7 plasmid C, complete sequence 46313-46346 10 0.706
CP030039_1 1.1|1000803|34|CP030039|CRISPRCasFinder 1000803-1000836 34 NZ_CP025513 Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence 734898-734931 10 0.706
CP030039_1 1.1|1000803|34|CP030039|CRISPRCasFinder 1000803-1000836 34 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 1591518-1591551 10 0.706
CP030039_1 1.1|1000803|34|CP030039|CRISPRCasFinder 1000803-1000836 34 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1040430-1040463 10 0.706
CP030039_1 1.1|1000803|34|CP030039|CRISPRCasFinder 1000803-1000836 34 NZ_CP015881 Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence 446049-446082 10 0.706
CP030039_1 1.1|1000803|34|CP030039|CRISPRCasFinder 1000803-1000836 34 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 540866-540899 10 0.706
CP030039_1 1.1|1000803|34|CP030039|CRISPRCasFinder 1000803-1000836 34 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 1353350-1353383 10 0.706
CP030039_1 1.1|1000803|34|CP030039|CRISPRCasFinder 1000803-1000836 34 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 1927329-1927362 10 0.706
CP030039_1 1.1|1000803|34|CP030039|CRISPRCasFinder 1000803-1000836 34 NC_016586 Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence 693126-693159 10 0.706
CP030039_1 1.1|1000803|34|CP030039|CRISPRCasFinder 1000803-1000836 34 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 1355524-1355557 11 0.676

1. spacer 1.1|1000803|34|CP030039|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 9, identity: 0.735 

cccctcctgtcggccggctggacaaggcgccccc	CRISPR spacer
tctcgccggtcggccggctcgacaaggcgagcga	Protospacer
.*.* ** *********** *********  *

2. spacer 1.1|1000803|34|CP030039|CRISPRCasFinder matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 9, identity: 0.735 

cccctcctgtcggccggctggacaaggcgccccc	CRISPR spacer
tctccccggtcggccggctcgacaaggcgagcga	Protospacer
.*.*.** *********** *********  *

3. spacer 1.1|1000803|34|CP030039|CRISPRCasFinder matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 10, identity: 0.706 

cccctcctgtcggccggctggacaaggcgccccc	CRISPR spacer
tcctcgacatcgaccggctggacaaggcgaccct	Protospacer
.**..  ..***.**************** ***.

4. spacer 1.1|1000803|34|CP030039|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 10, identity: 0.706 

cccctcctgtcggccggctggacaaggcgccccc	CRISPR spacer
aatcgcctgtcggcaagctggacaaggcgatgac	Protospacer
  .* ********* .************* .  *

5. spacer 1.1|1000803|34|CP030039|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 10, identity: 0.706 

cccctcctgtcggccggctggacaaggcgccccc	CRISPR spacer
tctcgccggtcggccggctcgacaaggcgagtga	Protospacer
.*.* ** *********** *********  .

6. spacer 1.1|1000803|34|CP030039|CRISPRCasFinder matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706 

cccctcctgtcggccggctggacaaggcgccccc	CRISPR spacer
tgtcgccggtcggccggctggacaaagcgagcga	Protospacer
. .* ** *****************.***  *

7. spacer 1.1|1000803|34|CP030039|CRISPRCasFinder matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 10, identity: 0.706 

cccctcctgtcggccggctggacaaggcgccccc	CRISPR spacer
tcctcgacatcgaccggctggacaaggcgaccct	Protospacer
.**..  ..***.**************** ***.

8. spacer 1.1|1000803|34|CP030039|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 10, identity: 0.706 

cccctcctgtcggccggctggacaaggcgccccc	CRISPR spacer
tcctcgacatcgaccggctggacaaggcgaccct	Protospacer
.**..  ..***.**************** ***.

9. spacer 1.1|1000803|34|CP030039|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 10, identity: 0.706 

cccctcctgtcggccggctggacaaggcgccccc	CRISPR spacer
aatcgcctgtcggcaagctggacaaggcgatgac	Protospacer
  .* ********* .************* .  *

10. spacer 1.1|1000803|34|CP030039|CRISPRCasFinder matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.706 

cccctcctgtcggccggctggacaaggcgccccc	CRISPR spacer
tcctcgacatcgaccggctggacaaggcgaccct	Protospacer
.**..  ..***.**************** ***.

11. spacer 1.1|1000803|34|CP030039|CRISPRCasFinder matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.706 

cccctcctgtcggccggctggacaaggcgccccc	CRISPR spacer
tcctcgacatcgaccggctggacaaggcgaccct	Protospacer
.**..  ..***.**************** ***.

12. spacer 1.1|1000803|34|CP030039|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 10, identity: 0.706 

cccctcctgtcggccggctggacaaggcgccccc	CRISPR spacer
tgtcgccggtcggccggctcgacaaggcgagcga	Protospacer
. .* ** *********** *********  *

13. spacer 1.1|1000803|34|CP030039|CRISPRCasFinder matches to NC_016586 (Azospirillum lipoferum 4B plasmid AZO_p2, complete sequence) position: , mismatch: 10, identity: 0.706 

cccctcctgtcggccggctggacaaggcgccccc	CRISPR spacer
tcatccctgtcggcaggctggacagggcgagacg	Protospacer
.* ..********* *********.****   *

14. spacer 1.1|1000803|34|CP030039|CRISPRCasFinder matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 11, identity: 0.676 

cccctcctgtcggccggctggacaaggcgccccc	CRISPR spacer
ttctcgacatcgaccggctggacaaggcgaccct	Protospacer
..*..  ..***.**************** ***.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage