1. spacer 2.3|1494075|30|CP025419|CRISPRCasFinder,CRT,PILER-CR matches to MK448982 (Streptococcus phage Javan554, complete genome) position: , mismatch: 0, identity: 1.0
gacaaggtcgaaaagaaatacattgatgtt CRISPR spacer
gacaaggtcgaaaagaaatacattgatgtt Protospacer
******************************
2. spacer 1.1|1236419|28|CP025419|CRISPRCasFinder matches to NZ_CP043555 (Vibrio cholerae strain RFB16 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786
catttctacaaaggtttggggaaacttg CRISPR spacer
aatttctacaaagttttggggaaggtat Protospacer
************ *********. *
3. spacer 2.8|1494404|30|CP025419|CRISPRCasFinder,CRT,PILER-CR matches to MK448365 (Streptococcus satellite phage Javan212, complete genome) position: , mismatch: 6, identity: 0.8
cagtattaattgggatattatttatcttag CRISPR spacer
tagtattaattggaatagtatttatctctt Protospacer
.************.*** *********.
4. spacer 2.8|1494404|30|CP025419|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026119 (Halobacillus litoralis strain ERB 031 plasmid pLDW-31, complete sequence) position: , mismatch: 6, identity: 0.8
cagtattaattgggatattatttatcttag CRISPR spacer
gagtattaattgggttattatttattgttc Protospacer
************* **********. *
5. spacer 2.9|1494470|29|CP025419|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012032 (Leptospira borgpetersenii serovar Ballum strain 56604 plasmid lbp2, complete sequence) position: , mismatch: 6, identity: 0.793
caacatggttttgatcccacgtttggcca CRISPR spacer
aaaatcggtttttttcccacgtttggcca Protospacer
** .****** ***************
6. spacer 2.10|1494535|29|CP025419|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012032 (Leptospira borgpetersenii serovar Ballum strain 56604 plasmid lbp2, complete sequence) position: , mismatch: 6, identity: 0.793
caacatggttttgatcccacgtttggcca CRISPR spacer
aaaatcggtttttttcccacgtttggcca Protospacer
** .****** ***************
7. spacer 1.1|1236419|28|CP025419|CRISPRCasFinder matches to NZ_CP040462 (Enterococcus sp. M190262 plasmid pM190262, complete sequence) position: , mismatch: 7, identity: 0.75
catttctacaaaggtttggggaaacttg CRISPR spacer
catttctacaacggtttgcggaacaaat Protospacer
*********** ****** ****
8. spacer 2.1|1493943|30|CP025419|CRISPRCasFinder,CRT matches to AJ609634 (Bacteriophage EJ-1 proviral DNA, complete genome) position: , mismatch: 7, identity: 0.767
tacaaatgttatggggataactaccagaag CRISPR spacer
taaaaatgttaaggggataactaaagaaac Protospacer
** ******** *********** ..**
9. spacer 2.1|1493943|30|CP025419|CRISPRCasFinder,CRT matches to NC_005294 (Streptococcus prophage EJ-1, complete genome) position: , mismatch: 7, identity: 0.767
tacaaatgttatggggataactaccagaag CRISPR spacer
taaaaatgttaaggggataactaaagaaac Protospacer
** ******** *********** ..**
10. spacer 2.1|1493943|30|CP025419|CRISPRCasFinder,CRT matches to KY065449 (Streptococcus phage IPP5, complete genome) position: , mismatch: 7, identity: 0.767
tacaaatgttatggggataactaccagaag CRISPR spacer
taaaaatgttaaggggataactaaagaaac Protospacer
** ******** *********** ..**
11. spacer 2.3|1494075|30|CP025419|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013208 (Paenibacillus sp. IHB B 3084 plasmid pHD05, complete sequence) position: , mismatch: 7, identity: 0.767
gacaaggtcgaaaagaaatacattgatgtt CRISPR spacer
aagcaggacgaaaagaaatccattgatgca Protospacer
.* *** *********** ********.
12. spacer 2.3|1494075|30|CP025419|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG205643 (Paeniclostridium sordellii strain S0804018 plasmid pCS1-5, complete sequence) position: , mismatch: 7, identity: 0.767
gacaaggtcgaaaagaaatacattgatgtt CRISPR spacer
gatacacccgaaaagaaagacattgatgtc Protospacer
**.* . .********** **********.
13. spacer 2.8|1494404|30|CP025419|CRISPRCasFinder,CRT,PILER-CR matches to AP019559 (Escherichia phage SP15 DNA, complete genome) position: , mismatch: 7, identity: 0.767
cagtattaattgggatattatttatcttag CRISPR spacer
cagtatttaatgggatattatttagaacaa Protospacer
******* * ************** .*.
14. spacer 2.8|1494404|30|CP025419|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014221 (Clostridium botulinum strain B515 plasmid pRSJ21_2, complete sequence) position: , mismatch: 7, identity: 0.767
cagtattaattgggatattatttatcttag CRISPR spacer
taagactaattgggatagtatttttcttat Protospacer
.*. *.*********** ***** *****
15. spacer 2.8|1494404|30|CP025419|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013852 (Clostridium botulinum strain B305 plasmid pRSJ6_2, complete sequence) position: , mismatch: 7, identity: 0.767
cagtattaattgggatattatttatcttag CRISPR spacer
taagactaattgggatagtatttttcttat Protospacer
.*. *.*********** ***** *****
16. spacer 2.8|1494404|30|CP025419|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014172 (Clostridium botulinum strain B609 plasmid pRSJ22_1, complete sequence) position: , mismatch: 7, identity: 0.767
cagtattaattgggatattatttatcttag CRISPR spacer
taagactaattgggatagtatttttcttat Protospacer
.*. *.*********** ***** *****
17. spacer 2.8|1494404|30|CP025419|CRISPRCasFinder,CRT,PILER-CR matches to MT679222 (Proteus phage 2, complete genome) position: , mismatch: 8, identity: 0.733
cagtattaattgggatattatttatcttag CRISPR spacer
tcgtattagttgggatattagttatccgta Protospacer
. ******.*********** *****. .
18. spacer 2.8|1494404|30|CP025419|CRISPRCasFinder,CRT,PILER-CR matches to MT679223 (Proteus phage 1, complete genome) position: , mismatch: 8, identity: 0.733
cagtattaattgggatattatttatcttag CRISPR spacer
tcgtattagttgggatattagttatccgta Protospacer
. ******.*********** *****. .
19. spacer 2.8|1494404|30|CP025419|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053952 (Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cagtattaattgggatattatttatcttag CRISPR spacer
agagattgattgggatattttttatcttga Protospacer
.. ***.*********** ********..
20. spacer 2.8|1494404|30|CP025419|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053949 (Bacillus cereus strain FDAARGOS_799 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.733
cagtattaattgggatattatttatcttag CRISPR spacer
agagattgattgggatattttttatcttga Protospacer
.. ***.*********** ********..
21. spacer 2.5|1494206|30|CP025419|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011666 (Streptomyces sp. Mg1 plasmid pSMg1-2, complete sequence) position: , mismatch: 9, identity: 0.7
tggccacgatgcggtccaaagagataatta CRISPR spacer
cggccacgatgcggttcaaagacgccacct Protospacer
.**************.****** .. *..
