Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP022294 Lactobacillus plantarum strain DSR_M2 chromosome, complete genome 1 crisprs csa3,DinG,cas3,DEDDh 1 1 5 0
CP022293 Lactobacillus plantarum strain DSR_M2 plasmid pDSRM202, complete sequence 0 crisprs csa3 0 0 0 0
CP022292 Lactobacillus plantarum strain DSR_M2 plasmid pDSRM201, complete sequence 0 crisprs NA 0 0 1 0

Results visualization

1. CP022294
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP022294_3 2731092-2731177 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP022294_2 2.1|2551380|26|CP022294|PILER-CR 2551380-2551405 26 CP022294.1 2551296-2551321 0 1.0

1. spacer 2.1|2551380|26|CP022294|PILER-CR matches to position: 2551296-2551321, mismatch: 0, identity: 1.0

cattcaatgttccaagcccattagta	CRISPR spacer
cattcaatgttccaagcccattagta	Protospacer
**************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP022294_2 2.1|2551380|26|CP022294|PILER-CR 2551380-2551405 26 AP014283 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S23-C59, *** SEQUENCING IN PROGRESS *** 15532-15557 4 0.846

1. spacer 2.1|2551380|26|CP022294|PILER-CR matches to AP014283 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S23-C59, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 4, identity: 0.846

cattcaatgttccaagcccattagta	CRISPR spacer
cattaaatgttccatgcccattaaaa	Protospacer
**** ********* ********. *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 360234 : 428866 67 Tupanvirus(20.0%) protease,bacteriocin,tRNA NA
DBSCAN-SWA_2 1226124 : 1235133 9 Lactobacillus_phage(100.0%) NA NA
DBSCAN-SWA_3 1719418 : 1820863 106 Lactobacillus_phage(67.92%) tail,capsid,portal,tRNA,transposase,head,terminase,protease,integrase,holin attL 1761316:1761333|attR 1827802:1827819
DBSCAN-SWA_4 2142502 : 2179627 47 Lactobacillus_phage(37.5%) tail,capsid,portal,head,terminase,holin NA
DBSCAN-SWA_5 2379998 : 2388512 9 Synechococcus_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP022292
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 45428 40 Paenibacillus_phage(18.18%) transposase,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage