Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029369 Escherichia coli strain WCHEC035148 chromosome, complete genome 10 crisprs RT,csa3,PD-DExK,cas5,cas6e,cas1,cas2,cas3,DEDDh,c2c9_V-U4,DinG 0 17 10 0
CP029366 Escherichia coli strain WCHEC035148 plasmid p2_035148, complete sequence 0 crisprs NA 0 0 0 0
CP029368 Escherichia coli strain WCHEC035148 plasmid pQnrS1_035148, complete sequence 0 crisprs NA 0 0 2 0
CP029367 Escherichia coli strain WCHEC035148 plasmid pCMY42_035148, complete sequence 0 crisprs NA 0 0 0 0
CP029365 Escherichia coli strain WCHEC035148 plasmid p1_035148, complete sequence 0 crisprs cas14j 0 0 1 0

Results visualization

1. CP029369
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029369_1 621472-621611 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029369_2 651427-651678 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029369_3 666259-666376 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029369_4 1050535-1051051 Orphan I-E
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029369_5 1073436-1074014 Unclear I-E
9 spacers
cas2,cas1,cas6e,cas5

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029369_6 1575337-1575454 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029369_7 2169840-2169963 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029369_9 3130405-3130549 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029369_10 3624679-3624832 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029369_11 3814744-3814859 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029369_8 8.1|2824811|40|CP029369|CRISPRCasFinder 2824811-2824850 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP029369_7 7.1|2169883|38|CP029369|CRISPRCasFinder 2169883-2169920 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP029369_10 10.1|3624732|48|CP029369|CRISPRCasFinder 3624732-3624779 48 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4089-4136 3 0.938
CP029369_10 10.1|3624732|48|CP029369|CRISPRCasFinder 3624732-3624779 48 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4088-4135 3 0.938
CP029369_10 10.1|3624732|48|CP029369|CRISPRCasFinder 3624732-3624779 48 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4088-4135 3 0.938
CP029369_10 10.1|3624732|48|CP029369|CRISPRCasFinder 3624732-3624779 48 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4088-4135 3 0.938
CP029369_1 1.1|621521|42|CP029369|CRISPRCasFinder 621521-621562 42 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30214-30255 7 0.833
CP029369_4 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT 1050930-1050961 32 NZ_MG299151 Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence 51276-51307 7 0.781
CP029369_4 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT 1050930-1050961 32 NZ_KY471628 Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence 45716-45747 7 0.781
CP029369_4 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT 1050930-1050961 32 NZ_MG299131 Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence 51276-51307 7 0.781
CP029369_4 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT 1050930-1050961 32 NZ_KY471629 Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence 45716-45747 7 0.781
CP029369_4 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT 1050930-1050961 32 NZ_MG299133 Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence 51276-51307 7 0.781
CP029369_4 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT 1050930-1050961 32 NZ_MG299128 Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence 51276-51307 7 0.781
CP029369_4 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT 1050930-1050961 32 NZ_MG299147 Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence 51276-51307 7 0.781
CP029369_4 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT 1050930-1050961 32 NC_018995 Escherichia coli plasmid pHUSEC41-1, complete sequence 29015-29046 7 0.781
CP029369_4 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT 1050930-1050961 32 NZ_CP053235 Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence 78292-78323 7 0.781
CP029369_4 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT 1050930-1050961 32 NZ_CP005999 Escherichia coli B7A plasmid pEB1, complete sequence 39563-39594 7 0.781
CP029369_4 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT 1050930-1050961 32 KU932021 Escherichia coli plasmid pEC3I, complete sequence 51902-51933 7 0.781
CP029369_4 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT 1050930-1050961 32 NZ_CP024154 Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence 18560-18591 7 0.781
CP029369_4 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT 1050930-1050961 32 NC_011754 Escherichia coli ED1a plasmid pECOED, complete sequence 49240-49271 7 0.781
CP029369_4 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT 1050930-1050961 32 NZ_CP015141 Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence 81434-81465 7 0.781
CP029369_4 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT 1050930-1050961 32 NZ_LR213460 Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3 28916-28947 7 0.781
CP029369_4 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT 1050930-1050961 32 NZ_MH287044 Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence 36182-36213 7 0.781
CP029369_4 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT 1050930-1050961 32 NZ_MH618673 Escherichia coli strain 838B plasmid p838B-R, complete sequence 32230-32261 7 0.781
CP029369_5 5.1|1073466|31|CP029369|CRISPRCasFinder 1073466-1073496 31 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 62682-62712 7 0.774
CP029369_5 5.1|1073466|31|CP029369|CRISPRCasFinder 1073466-1073496 31 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1222106-1222136 7 0.774
CP029369_5 5.1|1073466|31|CP029369|CRISPRCasFinder 1073466-1073496 31 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 2467672-2467702 7 0.774
CP029369_5 5.4|1073649|31|CP029369|CRISPRCasFinder 1073649-1073679 31 NZ_CP034185 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence 17977-18007 7 0.774
CP029369_5 5.7|1073832|31|CP029369|CRISPRCasFinder 1073832-1073862 31 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 530641-530671 7 0.774
CP029369_1 1.1|621521|42|CP029369|CRISPRCasFinder 621521-621562 42 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24899-24940 8 0.81
CP029369_4 4.6|1050869|32|CP029369|PILER-CR,CRISPRCasFinder,CRT 1050869-1050900 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 1417960-1417991 8 0.75
CP029369_5 5.4|1073649|31|CP029369|CRISPRCasFinder 1073649-1073679 31 NZ_CP017753 Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence 97498-97528 8 0.742
CP029369_5 5.7|1073832|31|CP029369|CRISPRCasFinder 1073832-1073862 31 NZ_CP036297 Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence 14953-14983 8 0.742
CP029369_5 5.7|1073832|31|CP029369|CRISPRCasFinder 1073832-1073862 31 NZ_CP036288 Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence 14983-15013 8 0.742
CP029369_5 5.7|1073832|31|CP029369|CRISPRCasFinder 1073832-1073862 31 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 3454-3484 8 0.742
CP029369_5 5.7|1073832|31|CP029369|CRISPRCasFinder 1073832-1073862 31 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 148992-149022 8 0.742
CP029369_5 5.10|1073466|32|CP029369|PILER-CR,CRT 1073466-1073497 32 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 62682-62713 8 0.75
CP029369_5 5.10|1073466|32|CP029369|PILER-CR,CRT 1073466-1073497 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1222106-1222137 8 0.75
CP029369_5 5.10|1073466|32|CP029369|PILER-CR,CRT 1073466-1073497 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 2467671-2467702 8 0.75
CP029369_5 5.10|1073466|32|CP029369|PILER-CR,CRT 1073466-1073497 32 NC_008759 Polaromonas naphthalenivorans CJ2 plasmid pPNAP03, complete sequence 12670-12701 8 0.75
CP029369_5 5.13|1073649|32|CP029369|PILER-CR,CRT 1073649-1073680 32 NZ_CP034185 Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence 17977-18008 8 0.75
CP029369_5 5.13|1073649|32|CP029369|PILER-CR,CRT 1073649-1073680 32 NZ_CP017753 Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence 97497-97528 8 0.75
CP029369_5 5.16|1073832|32|CP029369|PILER-CR,CRT 1073832-1073863 32 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 148991-149022 8 0.75
CP029369_5 5.16|1073832|32|CP029369|PILER-CR,CRT 1073832-1073863 32 NC_007336 Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence 530640-530671 8 0.75
CP029369_5 5.17|1073893|32|CP029369|PILER-CR,CRT 1073893-1073924 32 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 532343-532374 8 0.75
CP029369_1 1.1|621521|42|CP029369|CRISPRCasFinder 621521-621562 42 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24786-24827 9 0.786
CP029369_5 5.1|1073466|31|CP029369|CRISPRCasFinder 1073466-1073496 31 NC_011987 Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence 86182-86212 9 0.71
CP029369_5 5.2|1073527|31|CP029369|CRISPRCasFinder 1073527-1073557 31 CP011075 Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence 244686-244716 9 0.71
CP029369_5 5.2|1073527|31|CP029369|CRISPRCasFinder 1073527-1073557 31 GU075905 Prochlorococcus phage P-HM2, complete genome 78536-78566 9 0.71
CP029369_5 5.4|1073649|31|CP029369|CRISPRCasFinder 1073649-1073679 31 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 405875-405905 9 0.71
CP029369_5 5.4|1073649|31|CP029369|CRISPRCasFinder 1073649-1073679 31 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2248363-2248393 9 0.71
CP029369_5 5.8|1073893|31|CP029369|CRISPRCasFinder 1073893-1073923 31 NZ_CP040723 Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence 35740-35770 9 0.71
CP029369_5 5.13|1073649|32|CP029369|PILER-CR,CRT 1073649-1073680 32 NZ_CP017750 Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence 405875-405906 9 0.719
CP029369_5 5.16|1073832|32|CP029369|PILER-CR,CRT 1073832-1073863 32 NZ_CP036297 Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence 14953-14984 9 0.719
CP029369_5 5.16|1073832|32|CP029369|PILER-CR,CRT 1073832-1073863 32 NZ_CP036288 Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence 14983-15014 9 0.719
CP029369_5 5.16|1073832|32|CP029369|PILER-CR,CRT 1073832-1073863 32 NZ_CP015882 Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence 3454-3485 9 0.719
CP029369_5 5.17|1073893|32|CP029369|PILER-CR,CRT 1073893-1073924 32 NZ_CP040723 Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence 35740-35771 9 0.719
CP029369_4 4.1|1050564|32|CP029369|PILER-CR,CRISPRCasFinder,CRT 1050564-1050595 32 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 51062-51093 10 0.688
CP029369_5 5.10|1073466|32|CP029369|PILER-CR,CRT 1073466-1073497 32 NC_011987 Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence 86181-86212 10 0.688
CP029369_5 5.11|1073527|32|CP029369|PILER-CR,CRT 1073527-1073558 32 CP011075 Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence 244686-244717 10 0.688
CP029369_5 5.11|1073527|32|CP029369|PILER-CR,CRT 1073527-1073558 32 GU075905 Prochlorococcus phage P-HM2, complete genome 78536-78567 10 0.688
CP029369_5 5.13|1073649|32|CP029369|PILER-CR,CRT 1073649-1073680 32 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 2248362-2248393 10 0.688

1. spacer 8.1|2824811|40|CP029369|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 7.1|2169883|38|CP029369|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 10.1|3624732|48|CP029369|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

4. spacer 10.1|3624732|48|CP029369|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

5. spacer 10.1|3624732|48|CP029369|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

6. spacer 10.1|3624732|48|CP029369|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 3, identity: 0.938

tcagcgtcgcatcaggcatctgcgcataaccgccggatgcggcgtaaa	CRISPR spacer
ccagcgtcgcatcaggcatctgcgcataactgccggatgcggcataaa	Protospacer
.*****************************.************.****

7. spacer 1.1|621521|42|CP029369|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.833

acagcagtcggatgcggcgtaaacaccttatctgacctacgt	CRISPR spacer
acaaatgccggatgcggcgtaaacgccttatctggcctacgc	Protospacer
***.  *.****************.*********.******.

8. spacer 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299151 (Shigella sonnei strain SH287-2 plasmid pSH287-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

9. spacer 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY471628 (Shigella sonnei strain SH15sh99 plasmid pSH15sh99, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

10. spacer 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299131 (Shigella sonnei strain SH271-2 plasmid pSH271-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

11. spacer 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY471629 (Shigella sonnei strain SH15sh105 plasmid pSH15sh104, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

12. spacer 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299133 (Shigella sonnei strain SH272-2 plasmid pSH272-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

13. spacer 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299128 (Shigella sonnei strain SH262-2 plasmid pSH262-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

14. spacer 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG299147 (Shigella sonnei strain SH284-2 plasmid pSH284-2, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

15. spacer 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT matches to NC_018995 (Escherichia coli plasmid pHUSEC41-1, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

16. spacer 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053235 (Escherichia coli strain SCU-106 plasmid pSCU-106-1, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

17. spacer 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP005999 (Escherichia coli B7A plasmid pEB1, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

18. spacer 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT matches to KU932021 (Escherichia coli plasmid pEC3I, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

19. spacer 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024154 (Escherichia coli strain 14EC033 plasmid p14EC033g, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

20. spacer 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT matches to NC_011754 (Escherichia coli ED1a plasmid pECOED, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

21. spacer 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015141 (Escherichia coli strain Ecol_732 plasmid pEC732_3, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

22. spacer 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR213460 (Shigella sonnei strain AUSMDU00008333 isolate AUSMDU00008333 plasmid 3) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

23. spacer 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH287044 (Escherichia coli strain 5.1-R1 plasmid pCERC6, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

24. spacer 4.7|1050930|32|CP029369|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MH618673 (Escherichia coli strain 838B plasmid p838B-R, complete sequence) position: , mismatch: 7, identity: 0.781

aaatatccagggctgggctggaggcagacggc--	CRISPR spacer
cgttatccagggctgagctgcaggcag--ggcca	Protospacer
 . ************.**** ******  ***  

25. spacer 5.1|1073466|31|CP029369|CRISPRCasFinder matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.774

ttgcccgcgcaattccgggagcatccgcaat	CRISPR spacer
tccctatcgcaatgccggcagcatccgcaat	Protospacer
*. *.  ****** **** ************

26. spacer 5.1|1073466|31|CP029369|CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 7, identity: 0.774

ttgcccgcgcaattccgggagcatccgcaat	CRISPR spacer
ttgcgcgcgcaattccgtgagcagcgccatc	Protospacer
**** ************ ***** *  ** .

27. spacer 5.1|1073466|31|CP029369|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774

ttgcccgcgcaattccgggagcatccgcaat	CRISPR spacer
ttgcgcgcgcaattccgtgagcagcgccatc	Protospacer
**** ************ ***** *  ** .

28. spacer 5.4|1073649|31|CP029369|CRISPRCasFinder matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774

cccgtcaccgacgcgcagtggcgctaccgtg	CRISPR spacer
agcgtcaccgacgcgcagggccgctaccaac	Protospacer
  **************** * *******.  

29. spacer 5.7|1073832|31|CP029369|CRISPRCasFinder matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.774

ccgaacggctggcgaagcaggtggctggcgt	CRISPR spacer
ccgaacaggtggcgaagcaggtgatgggcca	Protospacer
******.* **************.. ***  

30. spacer 1.1|621521|42|CP029369|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 8, identity: 0.81

acagcagtcggatgcggcgtaaacaccttatctgacctacgt	CRISPR spacer
attgatgtcggatgcggcgtaaacgccttatccgacctacaa	Protospacer
*. *  ******************.*******.*******. 

31. spacer 4.6|1050869|32|CP029369|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

tcaacgcgctcagacgttgcgtgagtgaacca	CRISPR spacer
acaacgcggtcggacgttgcgtgattaccccg	Protospacer
 ******* **.************ *.  **.

32. spacer 5.4|1073649|31|CP029369|CRISPRCasFinder matches to NZ_CP017753 (Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

cccgtcaccgacgcgcagtggcgctaccgtg	CRISPR spacer
gacgtcaccgacgcgcagtcgcgcttcttca	Protospacer
  ***************** ***** *. ..

33. spacer 5.7|1073832|31|CP029369|CRISPRCasFinder matches to NZ_CP036297 (Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence) position: , mismatch: 8, identity: 0.742

ccgaacggctggcgaagcaggtggctggcgt	CRISPR spacer
agcggcagctggcgatgcaggtggcttgcgt	Protospacer
   ..*.******** ********** ****

34. spacer 5.7|1073832|31|CP029369|CRISPRCasFinder matches to NZ_CP036288 (Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence) position: , mismatch: 8, identity: 0.742

ccgaacggctggcgaagcaggtggctggcgt	CRISPR spacer
agcggcagctggcgatgcaggtggcttgcgt	Protospacer
   ..*.******** ********** ****

35. spacer 5.7|1073832|31|CP029369|CRISPRCasFinder matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 8, identity: 0.742

ccgaacggctggcgaagcaggtggctggcgt	CRISPR spacer
ttgcgcagctggcgcagcaggtggctgccga	Protospacer
..* .*.******* ************ ** 

36. spacer 5.7|1073832|31|CP029369|CRISPRCasFinder matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742

ccgaacggctggcgaagcaggtggctggcgt	CRISPR spacer
gggtacggctggcgaaggaggcggctgcgga	Protospacer
  * ************* ***.*****  * 

37. spacer 5.10|1073466|32|CP029369|PILER-CR,CRT matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

ttgcccgcgcaattccgggagcatccgcaatt	CRISPR spacer
tccctatcgcaatgccggcagcatccgcaatc	Protospacer
*. *.  ****** **** ************.

38. spacer 5.10|1073466|32|CP029369|PILER-CR,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75

ttgcccgcgcaattccgggagcatccgcaatt	CRISPR spacer
ttgcgcgcgcaattccgtgagcagcgccatca	Protospacer
**** ************ ***** *  ** . 

39. spacer 5.10|1073466|32|CP029369|PILER-CR,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75

ttgcccgcgcaattccgggagcatccgcaatt	CRISPR spacer
ttgcgcgcgcaattccgtgagcagcgccatca	Protospacer
**** ************ ***** *  ** . 

40. spacer 5.10|1073466|32|CP029369|PILER-CR,CRT matches to NC_008759 (Polaromonas naphthalenivorans CJ2 plasmid pPNAP03, complete sequence) position: , mismatch: 8, identity: 0.75

ttgcccgcg-----caattccgggagcatccgcaatt	CRISPR spacer
-----cgtgaaactcatttccgggagcatccgcattt	Protospacer
     **.*     ** ***************** **

41. spacer 5.13|1073649|32|CP029369|PILER-CR,CRT matches to NZ_CP034185 (Deinococcus sp. S14-83 strain S14-83T plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cccgtcaccgacgcgcagtggcgctaccgtga	CRISPR spacer
agcgtcaccgacgcgcagggccgctaccaact	Protospacer
  **************** * *******.   

42. spacer 5.13|1073649|32|CP029369|PILER-CR,CRT matches to NZ_CP017753 (Cupriavidus sp. USMAHM13 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cccgtcaccgacgcgcagtggcgctaccgtga	CRISPR spacer
gacgtcaccgacgcgcagtcgcgcttcttcaa	Protospacer
  ***************** ***** *. ..*

43. spacer 5.16|1073832|32|CP029369|PILER-CR,CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
gggtacggctggcgaaggaggcggctgcggaa	Protospacer
  * ************* ***.*****  * *

44. spacer 5.16|1073832|32|CP029369|PILER-CR,CRT matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
ccgaacaggtggcgaagcaggtgatgggccag	Protospacer
******.* **************.. ***  .

45. spacer 5.17|1073893|32|CP029369|PILER-CR,CRT matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 8, identity: 0.75

gtttaccgccccgcagaggcgctggcagatcc	CRISPR spacer
catcatcctcccgcagatgcgctggccgatcc	Protospacer
  *.*.* .******** ******** *****

46. spacer 1.1|621521|42|CP029369|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.786

acagcagtcggatgcggcgtaaacaccttatctgacctacgt	CRISPR spacer
gttgatgtcggatgcggcgtaaacgccttatccgacctacaa	Protospacer
.. *  ******************.*******.*******. 

47. spacer 5.1|1073466|31|CP029369|CRISPRCasFinder matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 9, identity: 0.71

ttgcccgcgcaattccgggagcatccgcaat	CRISPR spacer
gctaccgcgcaattcgaggagcatccgctgg	Protospacer
 .  *********** .*********** . 

48. spacer 5.2|1073527|31|CP029369|CRISPRCasFinder matches to CP011075 (Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

acggacaaaatatatattgatttgcgaatta	CRISPR spacer
tgaggcaaaatatagattgatttccgaaaat	Protospacer
  .*.********* ******** ****   

49. spacer 5.2|1073527|31|CP029369|CRISPRCasFinder matches to GU075905 (Prochlorococcus phage P-HM2, complete genome) position: , mismatch: 9, identity: 0.71

acggacaaaatatatattgatttgcgaatta	CRISPR spacer
acggaaaaattatatattgattttacttctg	Protospacer
***** *** *************     .*.

50. spacer 5.4|1073649|31|CP029369|CRISPRCasFinder matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71

cccgtcaccgacgcgcagtggcgctaccgtg	CRISPR spacer
gacgtcactgacgcgcagtcgcgcttcttca	Protospacer
  ******.********** ***** *. ..

51. spacer 5.4|1073649|31|CP029369|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.71

cccgtcaccgacgcgcagtggcgctaccgtg	CRISPR spacer
gacatcaccgacgcccagtggcgcgacgtcc	Protospacer
  *.********** ********* **  . 

52. spacer 5.8|1073893|31|CP029369|CRISPRCasFinder matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.71

gtttaccgccccgcagaggcgctggcagatc	CRISPR spacer
cgagaccgcctcgccgaggcgctggcagcga	Protospacer
    ******.*** *************   

53. spacer 5.13|1073649|32|CP029369|PILER-CR,CRT matches to NZ_CP017750 (Cupriavidus sp. USMAA2-4 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

cccgtcaccgacgcgcagtggcgctaccgtga	CRISPR spacer
gacgtcactgacgcgcagtcgcgcttcttcaa	Protospacer
  ******.********** ***** *. ..*

54. spacer 5.16|1073832|32|CP029369|PILER-CR,CRT matches to NZ_CP036297 (Planctomycetes bacterium Pla86 plasmid pPla86_1, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
agcggcagctggcgatgcaggtggcttgcgtg	Protospacer
   ..*.******** ********** ****.

55. spacer 5.16|1073832|32|CP029369|PILER-CR,CRT matches to NZ_CP036288 (Planctomycetes bacterium Pla133 plasmid pPla133_1, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
agcggcagctggcgatgcaggtggcttgcgtg	Protospacer
   ..*.******** ********** ****.

56. spacer 5.16|1073832|32|CP029369|PILER-CR,CRT matches to NZ_CP015882 (Ensifer adhaerens strain Casida A plasmid pCasidaAB, complete sequence) position: , mismatch: 9, identity: 0.719

ccgaacggctggcgaagcaggtggctggcgta	CRISPR spacer
ttgcgcagctggcgcagcaggtggctgccgag	Protospacer
..* .*.******* ************ ** .

57. spacer 5.17|1073893|32|CP029369|PILER-CR,CRT matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

gtttaccgccccgcagaggcgctggcagatcc	CRISPR spacer
cgagaccgcctcgccgaggcgctggcagcgac	Protospacer
    ******.*** *************   *

58. spacer 4.1|1050564|32|CP029369|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 10, identity: 0.688

tccacgctgtaacggccatcattaagtttagt	CRISPR spacer
ccgctgctgtgacgcccatcattaagttactc	Protospacer
.*  .*****.*** *************   .

59. spacer 5.10|1073466|32|CP029369|PILER-CR,CRT matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 10, identity: 0.688

ttgcccgcgcaattccgggagcatccgcaatt	CRISPR spacer
gctaccgcgcaattcgaggagcatccgctggg	Protospacer
 .  *********** .*********** .  

60. spacer 5.11|1073527|32|CP029369|PILER-CR,CRT matches to CP011075 (Brevibacillus laterosporus strain B9 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

acggacaaaatatatattgatttgcgaattat	CRISPR spacer
tgaggcaaaatatagattgatttccgaaaata	Protospacer
  .*.********* ******** ****    

61. spacer 5.11|1073527|32|CP029369|PILER-CR,CRT matches to GU075905 (Prochlorococcus phage P-HM2, complete genome) position: , mismatch: 10, identity: 0.688

acggacaaaatatatattgatttgcgaattat	CRISPR spacer
acggaaaaattatatattgattttacttctgg	Protospacer
***** *** *************     .*. 

62. spacer 5.13|1073649|32|CP029369|PILER-CR,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 10, identity: 0.688

cccgtcaccgacgcgcagtggcgctaccgtga	CRISPR spacer
gacatcaccgacgcccagtggcgcgacgtccc	Protospacer
  *.********** ********* **  .  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 248206 : 262288 12 Escherichia_phage(50.0%) transposase,integrase attL 250589:250603|attR 262681:262695
DBSCAN-SWA_2 1081439 : 1094622 12 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_3 1836083 : 1890912 46 Shigella_phage(16.67%) transposase,integrase attL 1835328:1835342|attR 1893855:1893869
DBSCAN-SWA_4 1947318 : 1973562 44 Klebsiella_phage(21.21%) holin,tail,terminase,head NA
DBSCAN-SWA_5 2255623 : 2284226 33 Enterobacteria_phage(30.0%) tail,integrase attL 2256688:2256702|attR 2280466:2280480
DBSCAN-SWA_6 2685473 : 2698211 13 Enterobacteria_phage(33.33%) transposase,integrase attL 2683446:2683469|attR 2696914:2696937
DBSCAN-SWA_7 3013364 : 3022134 12 Salmonella_phage(90.0%) integrase attL 3013034:3013047|attR 3022176:3022189
DBSCAN-SWA_8 3101717 : 3128921 52 Enterobacteria_phage(47.06%) tail,capsid,lysis,terminase,integrase attL 3103633:3103647|attR 3128995:3129009
DBSCAN-SWA_9 3910165 : 3957141 56 Enterobacteria_phage(48.08%) capsid,tail,lysis,terminase,portal,integrase attL 3912977:3912996|attR 3957372:3957391
DBSCAN-SWA_10 4033903 : 4095024 55 Escherichia_phage(14.29%) transposase,integrase,protease,tRNA attL 4054496:4054523|attR 4061810:4061837
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP029368
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 9716 : 55765 44 Escherichia_phage(38.89%) transposase NA
DBSCAN-SWA_2 83195 : 91575 14 Stx2-converting_phage(50.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP029365
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 88835 99 Escherichia_phage(91.3%) lysis,transposase,integrase,plate,holin,terminase,protease,tail,capsid,head,tRNA,portal attL 46228:46254|attR 66986:67012
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage