Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP036176 Klebsiella sp. WCHKl090001 plasmid p1_090001, complete sequence 0 crisprs csa3 0 0 2 0
CP036175 Klebsiella sp. WCHKl090001 chromosome, complete genome 6 crisprs cas14j,csa3,cas3,DEDDh,DinG,WYL,RT 2 3 4 0

Results visualization

1. CP036176
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1480 : 63194 58 Bacillus_phage(23.53%) protease,integrase,transposase NA
DBSCAN-SWA_2 95464 : 109970 16 Vibrio_phage(28.57%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP036175
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP036175_1 729534-729973 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP036175_2 1211635-1211965 Orphan I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP036175_3 1953811-1953961 Orphan NA:I-E
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP036175_4 2554903-2555003 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP036175_6 5406456-5406603 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP036175_7 5783772-5783911 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP036175_1 1.2|729728|61|CP036175|PILER-CR 729728-729788 61 CP036175.1 729473-729533 1 0.984
CP036175_1 1.1|729598|66|CP036175|PILER-CR 729598-729663 66 CP036175.1 729473-729538 6 0.909

1. spacer 1.2|729728|61|CP036175|PILER-CR matches to position: 729473-729533, mismatch: 1, identity: 0.984

ggtcagcttcctcattcaacaaaaccccgtcagaaatggcggggtttttgctttctggta	CRISPR spacer
ggtcagcttcctcattcaacaaaaccccgtcagaaatggcggggtttttgctttctggta	Protospacer
************************************************************

2. spacer 1.1|729598|66|CP036175|PILER-CR matches to position: 729473-729538, mismatch: 6, identity: 0.909

ggtcagcttcctcattcaacaaaaccccgtcagaaatggcggggtttttgctttctggta	CRISPR spacer
ggtcagcttcctcattcaacaaaaccccgtcagaaatggcggggtttttgctttctggta	Protospacer
************************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP036175_5 5.1|2645841|34|CP036175|CRISPRCasFinder 2645841-2645874 34 MH178096 Aeromonas phage AsXd-1, complete genome 10853-10886 4 0.882
CP036175_2 2.14|1211906|30|CP036175|CRT 1211906-1211935 30 NZ_CP025929 Microcystis aeruginosa NIES-2481 plasmid p1, complete sequence 145579-145608 7 0.767
CP036175_2 2.6|1211726|31|CP036175|CRISPRCasFinder 1211726-1211756 31 MN693758 Marine virus AFVG_250M1033, complete genome 32527-32557 8 0.742
CP036175_5 5.1|2645841|34|CP036175|CRISPRCasFinder 2645841-2645874 34 MK135468 Klebsiella phage 1 TK-2018, complete genome 7436-7469 10 0.706
CP036175_5 5.1|2645841|34|CP036175|CRISPRCasFinder 2645841-2645874 34 AJ564013 Bacteriophage PY54 complete genome 31548-31581 12 0.647
CP036175_5 5.1|2645841|34|CP036175|CRISPRCasFinder 2645841-2645874 34 NC_005069 Yersinia phage PY54, complete genome 31548-31581 12 0.647

1. spacer 5.1|2645841|34|CP036175|CRISPRCasFinder matches to MH178096 (Aeromonas phage AsXd-1, complete genome) position: , mismatch: 4, identity: 0.882

aatcgtgcactacttggtgcagcagattcaccag	CRISPR spacer
aatcgttcactacctggtgcagcagattcacccc	Protospacer
****** ******.******************  

2. spacer 2.14|1211906|30|CP036175|CRT matches to NZ_CP025929 (Microcystis aeruginosa NIES-2481 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.767

cgctaattaacctgacgaatataagtactg	CRISPR spacer
agctaatgaacctgaccaatataacgattt	Protospacer
 ****** ******** *******  *.* 

3. spacer 2.6|1211726|31|CP036175|CRISPRCasFinder matches to MN693758 (Marine virus AFVG_250M1033, complete genome) position: , mismatch: 8, identity: 0.742

gtttggtttatctggccgcttgtggaggcgt	CRISPR spacer
attgaaaatatctggccgctcgtggaggcgg	Protospacer
.** ..  ************.********* 

4. spacer 5.1|2645841|34|CP036175|CRISPRCasFinder matches to MK135468 (Klebsiella phage 1 TK-2018, complete genome) position: , mismatch: 10, identity: 0.706

aatcgtgcactacttggtgcagcagattcaccag	CRISPR spacer
tatgatggactacttggtgcagcaggttcgtacc	Protospacer
 ** .** *****************.***..   

5. spacer 5.1|2645841|34|CP036175|CRISPRCasFinder matches to AJ564013 (Bacteriophage PY54 complete genome) position: , mismatch: 12, identity: 0.647

aatcgtgcactacttggtgcagcagattcaccag	CRISPR spacer
ccatttgcactacttgatgcagcacattctgagc	Protospacer
   . ***********.******* ****   . 

6. spacer 5.1|2645841|34|CP036175|CRISPRCasFinder matches to NC_005069 (Yersinia phage PY54, complete genome) position: , mismatch: 12, identity: 0.647

aatcgtgcactacttggtgcagcagattcaccag	CRISPR spacer
ccatttgcactacttgatgcagcacattctgagc	Protospacer
   . ***********.******* ****   . 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2637055 : 2707252 88 Klebsiella_phage(47.06%) capsid,protease,portal,tail,tRNA,holin,head,terminase NA
DBSCAN-SWA_2 3280478 : 3284632 6 Enterobacterial_phage(33.33%) holin,tail NA
DBSCAN-SWA_3 4445807 : 4504832 51 Escherichia_phage(42.86%) protease,transposase,tRNA NA
DBSCAN-SWA_4 4509322 : 4549167 40 Escherichia_phage(25.0%) integrase,transposase,tRNA attL 4515877:4515891|attR 4534934:4534948
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage