Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029978 Escherichia coli strain 51008369SK1 plasmid p51008369SK1_E, complete sequence 0 crisprs NA 0 0 1 0
CP029975 Escherichia coli strain 51008369SK1 plasmid p51008369SK1_B, complete sequence 0 crisprs c2c9_V-U4,RT,DEDDh 0 0 6 0
CP029974 Escherichia coli strain 51008369SK1 plasmid p51008369SK1_A, complete sequence 0 crisprs RT 0 0 0 0
CP029976 Escherichia coli strain 51008369SK1 plasmid p51008369SK1_C, complete sequence 0 crisprs NA 0 0 3 0
CP029973 Escherichia coli strain 51008369SK1 chromosome, complete genome 6 crisprs c2c9_V-U4,RT,DEDDh,DinG,cas3,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,WYL,PD-DExK 0 9 9 0
CP029977 Escherichia coli strain 51008369SK1 plasmid p51008369SK1_D, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP029978
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 18805 : 63005 54 Macacine_betaherpesvirus(26.67%) transposase,protease,integrase attL 14087:14146|attR 31489:31593
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP029975
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 7647 6 Wolbachia_phage(50.0%) NA NA
DBSCAN-SWA_2 22875 : 67993 56 Enterobacteria_phage(15.79%) transposase,integrase attL 60958:61017|attR 76651:77473
DBSCAN-SWA_3 71956 : 77409 7 Salmonella_phage(33.33%) transposase NA
DBSCAN-SWA_4 87908 : 88757 1 Vibrio_phage(100.0%) NA NA
DBSCAN-SWA_5 92256 : 92520 1 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_6 109405 : 110560 1 Pseudomonas_phage(100.0%) integrase attL 106609:106621|attR 110754:110766
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP029976
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 5115 8 Macacine_betaherpesvirus(100.0%) NA NA
DBSCAN-SWA_2 9773 : 11612 2 Klosneuvirus(50.0%) NA NA
DBSCAN-SWA_3 30429 : 32266 3 Aeromonas_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. CP029973
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029973_1 596742-596891 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029973_2 1160538-1160682 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029973_3 1300723-1300819 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029973_4 3196977-3197103 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029973_5 3692834-3693533 TypeI-E I-E
11 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029973_6 3719082-3719411 Unclear I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029973_5 5.7|3693227|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693227-3693258 32 NC_021229 Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919 65474-65505 5 0.844
CP029973_5 5.7|3693227|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693227-3693258 32 NZ_CP017422 Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence 208287-208318 6 0.812
CP029973_5 5.5|3693105|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693105-3693136 32 MF351863 Synechococcus phage Bellamy, complete genome 123998-124029 7 0.781
CP029973_5 5.6|3693166|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693166-3693197 32 MK416018 Klebsiella phage ST147-VIM1phi7.1, complete genome 24790-24821 7 0.781
CP029973_5 5.1|3692863|32|CP029973|CRISPRCasFinder,CRT 3692863-3692894 32 NZ_AP018516 Acetobacter orientalis strain FAN1 plasmid pAOF1, complete sequence 48296-48327 8 0.75
CP029973_5 5.7|3693227|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693227-3693258 32 MK113951 Phage 5P_3, complete genome 11967-11998 8 0.75
CP029973_5 5.7|3693227|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693227-3693258 32 AP017924 Ralstonia phage RP12 DNA, complete genome 11643-11674 8 0.75
CP029973_5 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693410-3693442 33 NC_013856 Azospirillum sp. B510 plasmid pAB510b, complete sequence 375744-375776 8 0.758
CP029973_6 6.6|3719291|34|CP029973|CRISPRCasFinder,CRT 3719291-3719324 34 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 755172-755205 8 0.765
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229083-229131 9 0.816
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229184-229232 9 0.816
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229285-229333 9 0.816
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239577-239625 9 0.816
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239678-239726 9 0.816
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239779-239827 9 0.816
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230489-230537 9 0.816
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230590-230638 9 0.816
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230691-230739 9 0.816
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211459-211507 9 0.816
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211560-211608 9 0.816
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211661-211709 9 0.816
CP029973_5 5.6|3693166|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693166-3693197 32 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 1143591-1143622 9 0.719
CP029973_5 5.6|3693166|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693166-3693197 32 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 891493-891524 9 0.719
CP029973_5 5.6|3693166|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693166-3693197 32 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 1143594-1143625 9 0.719
CP029973_5 5.6|3693166|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693166-3693197 32 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 315030-315061 9 0.719
CP029973_5 5.6|3693166|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693166-3693197 32 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 1123532-1123563 9 0.719
CP029973_5 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693410-3693442 33 NZ_CP010957 Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence 26182-26214 9 0.727
CP029973_2 2.1|1160581|59|CP029973|CRISPRCasFinder 1160581-1160639 59 MT230312 Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence 97-155 10 0.831
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229386-229434 10 0.796
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239880-239928 10 0.796
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230792-230840 10 0.796
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211762-211810 10 0.796
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP044147 Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2 7442-7490 10 0.796
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 CP044351 Escherichia coli strain 194195 plasmid p194195_1, complete sequence 84266-84314 10 0.796
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386508-386556 10 0.796
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14196-14244 10 0.796
CP029973_5 5.7|3693227|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693227-3693258 32 NC_002580 Propionibacterium freudenreichii plasmid p545, complete sequence 2898-2929 10 0.688
CP029973_5 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693288-3693319 32 NZ_CP028970 Aminobacter sp. MSH1 plasmid pUSP2, complete sequence 156123-156154 10 0.688
CP029973_5 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693288-3693319 32 NZ_CP053984 Achromobacter pestifer strain FDAARGOS_790 plasmid unnamed, complete sequence 21888-21919 10 0.688
CP029973_5 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693288-3693319 32 NC_010935 Comamonas testosteroni CNB-1 plasmid pCNB, complete sequence 28766-28797 10 0.688
CP029973_5 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693288-3693319 32 JX469826 Uncultured bacterium plasmid pB12, complete sequence 11283-11314 10 0.688
CP029973_5 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693288-3693319 32 JN106171 Uncultured bacterium plasmid pAKD26, complete sequence 11289-11320 10 0.688
CP029973_5 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693288-3693319 32 NC_016968 Comamonas testosteroni plasmid pTB30, complete sequence 11287-11318 10 0.688
CP029973_5 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693288-3693319 32 NC_016978 Comamonas testosteroni plasmid pI2, complete sequence 11272-11303 10 0.688
CP029973_5 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693288-3693319 32 NZ_CP017760 Cupriavidus necator strain NH9 plasmid pENH91, complete sequence 67078-67109 10 0.688
CP029973_5 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693288-3693319 32 NZ_CP053554 Diaphorobacter sp. JS3050 plasmid pDCNB, complete sequence 4235-4266 10 0.688
CP029973_5 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693288-3693319 32 NC_019263 Delftia acidovorans plasmid pLME1, complete sequence 11288-11319 10 0.688
CP029973_5 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693288-3693319 32 NC_019264 Delftia acidovorans plasmid pNB8c, complete sequence 11288-11319 10 0.688
CP029973_5 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693288-3693319 32 NC_019283 Delftia acidovorans plasmid pC1-1, complete sequence 11288-11319 10 0.688
CP029973_5 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693288-3693319 32 NC_006830 Achromobacter xylosoxidans A8 plasmid pA81, complete sequence 11350-11381 10 0.688
CP029973_5 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693410-3693442 33 CP046443 Pseudomonas coronafaciens pv. coronafaciens strain B19001 plasmid unnamed2, complete sequence 31933-31965 10 0.697
CP029973_5 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693410-3693442 33 NZ_LT963392 Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP1, complete sequence 103013-103045 10 0.697
CP029973_5 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693410-3693442 33 NZ_LT963392 Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP1, complete sequence 110510-110542 10 0.697
CP029973_5 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693410-3693442 33 NZ_CP034079 Pseudomonas syringae pv. pisi str. PP1 plasmid pPP1-1, complete sequence 48454-48486 10 0.697
CP029973_5 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693410-3693442 33 NZ_CP034080 Pseudomonas syringae pv. pisi str. PP1 plasmid pPP1-2, complete sequence 39480-39512 10 0.697
CP029973_5 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693410-3693442 33 NC_005918 Pseudomonas syringae pv. maculicola strain ES4326 plasmid pPMA4326A, complete sequence 31117-31149 10 0.697
CP029973_5 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693410-3693442 33 NZ_CP047262 Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326A, complete sequence 30966-30998 10 0.697
CP029973_5 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693410-3693442 33 NZ_CP026560 Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p3_tig5, complete sequence 19118-19150 10 0.697
CP029973_5 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693410-3693442 33 NZ_LT963406 Pseudomonas syringae pv. avii isolate CFBP3846 plasmid PP4, complete sequence 54820-54852 10 0.697
CP029973_5 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693410-3693442 33 LT985193 Pseudomonas syringae strain CFBP 2116 genome assembly, plasmid: PP2 32077-32109 10 0.697
CP029973_5 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693410-3693442 33 NZ_LT963393 Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP2, complete sequence 50597-50629 10 0.697
CP029973_5 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693410-3693442 33 NZ_LT985210 Pseudomonas syringae pv. cerasicola strain CFBP 6110 plasmid PP1, complete sequence 105842-105874 10 0.697
CP029973_5 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR 3693410-3693442 33 NZ_LT985211 Pseudomonas syringae pv. cerasicola strain CFBP 6110 plasmid PP2, complete sequence 84272-84304 10 0.697
CP029973_2 2.1|1160581|59|CP029973|CRISPRCasFinder 1160581-1160639 59 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40375-40433 11 0.814
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194003-194051 11 0.776
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194096-194144 11 0.776
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194282-194330 11 0.776
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204497-204545 11 0.776
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204590-204638 11 0.776
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204776-204824 11 0.776
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195331-195379 11 0.776
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195424-195472 11 0.776
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195610-195658 11 0.776
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176286-176334 11 0.776
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176379-176427 11 0.776
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176565-176613 11 0.776
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27282-27330 11 0.776
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 27381-27429 11 0.776
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 51834-51882 11 0.776
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_AP023209 Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence 19389-19437 11 0.776
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 211730-211778 12 0.755
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 211930-211978 12 0.755
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 194189-194237 12 0.755
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 222224-222272 12 0.755
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 222424-222472 12 0.755
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 204683-204731 12 0.755
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 213058-213106 12 0.755
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 213258-213306 12 0.755
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 195517-195565 12 0.755
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 194013-194061 12 0.755
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 194213-194261 12 0.755
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 176472-176520 12 0.755
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 11511-11559 12 0.755
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 397088-397136 12 0.755
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 404133-404181 12 0.755
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 27994-28042 12 0.755
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31299-31347 12 0.755
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 33059-33107 12 0.755
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 141016-141064 12 0.755
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 MF374379 Escherichia phage DN1, complete genome 31158-31206 12 0.755
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14105-14153 13 0.735
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 6859-6907 13 0.735
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NC_049343 Escherichia phage 500465-2, complete genome 31797-31845 13 0.735
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 MT230112 Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence 94-142 13 0.735
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 82842-82890 14 0.714
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 313592-313640 14 0.714
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 MG065691 UNVERIFIED: Campylobacter phage A11a, complete genome 63889-63937 14 0.714
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 MG065686 UNVERIFIED: Campylobacter phage A18a, complete genome 110186-110234 14 0.714
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP053721 Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence 198909-198957 14 0.714
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 40305-40353 14 0.714
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP044299 Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence 91418-91466 14 0.714
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 102544-102592 15 0.694
CP029973_4 4.1|3197016|49|CP029973|CRISPRCasFinder 3197016-3197064 49 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 56031-56079 15 0.694

1. spacer 5.7|3693227|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NC_021229 (Arthrobacter nicotinovorans pAO1 megaplasmid sequence, strain ATCC 49919) position: , mismatch: 5, identity: 0.844

tgggcggcttgccttgcagccagctccagcag-	CRISPR spacer
tgggcggcttgcgttgcagcctgc-cgagcgga	Protospacer
************ ******** ** * ***.* 

2. spacer 5.7|3693227|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017422 (Arthrobacter sp. ZXY-2 plasmid pZXY21, complete sequence) position: , mismatch: 6, identity: 0.812

tgggcggcttgccttgcagccagctccagcag-	CRISPR spacer
ggggcggcttgcgttgcagcctgc-cgagcgga	Protospacer
 *********** ******** ** * ***.* 

3. spacer 5.5|3693105|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to MF351863 (Synechococcus phage Bellamy, complete genome) position: , mismatch: 7, identity: 0.781

atcgtccatattaacaatcgtggtgagttcaa	CRISPR spacer
atcgcccatatcaacaatcgtggtgatacctt	Protospacer
****.******.**************  .*  

4. spacer 5.6|3693166|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to MK416018 (Klebsiella phage ST147-VIM1phi7.1, complete genome) position: , mismatch: 7, identity: 0.781

actatggccccggcaaaaaacgcgctggtggg	CRISPR spacer
tccatcacaccgccaaaaaacgcgctgatggg	Protospacer
 *.** .* *** **************.****

5. spacer 5.1|3692863|32|CP029973|CRISPRCasFinder,CRT matches to NZ_AP018516 (Acetobacter orientalis strain FAN1 plasmid pAOF1, complete sequence) position: , mismatch: 8, identity: 0.75

cagcgtcaggcgtgaaatctcaccgtcgttgc	CRISPR spacer
attctttaggcgtgacatcttaccgtcgttga	Protospacer
   * *.******** ****.********** 

6. spacer 5.7|3693227|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to MK113951 (Phage 5P_3, complete genome) position: , mismatch: 8, identity: 0.75

tgggcggcttgccttgcagccagctccagcag	CRISPR spacer
ggggcagcttgccttgcagccagccgatgctc	Protospacer
 ****.******************.   **  

7. spacer 5.7|3693227|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to AP017924 (Ralstonia phage RP12 DNA, complete genome) position: , mismatch: 8, identity: 0.75

tgggcggcttgccttgcagccagctccagcag	CRISPR spacer
tgggccgcttgccgtgcagccagcgcttccgc	Protospacer
***** ******* ********** *.  *. 

8. spacer 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 8, identity: 0.758

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
cgcgtcggcgacgcgcaggtaatgcgcgatcag	Protospacer
   * **************  *********. *

9. spacer 6.6|3719291|34|CP029973|CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.765

ctggctctgcaacagcagcacccatgaccacgtc	CRISPR spacer
ccgctccagcaacagcagcacccacgaccacgga	Protospacer
*.* ..* ****************.*******  

10. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

11. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

12. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

13. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

14. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

15. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

16. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

17. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

18. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

19. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

20. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacggatggcg	Protospacer
. **. **********.************************** * * .

21. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.816

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtgaacgccttatccggcctacgggtggcg	Protospacer
. **. **********.************************** * * .

22. spacer 5.6|3693166|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 9, identity: 0.719

actatggccccggcaaaaaacgcgctggtggg	CRISPR spacer
atatccggcccggcaaaaaaagcgcgggtggc	Protospacer
*.  . * ************ **** ***** 

23. spacer 5.6|3693166|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 9, identity: 0.719

actatggccccggcaaaaaacgcgctggtggg	CRISPR spacer
atatccggcccggcaaaaaaagcgcgggtggc	Protospacer
*.  . * ************ **** ***** 

24. spacer 5.6|3693166|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 9, identity: 0.719

actatggccccggcaaaaaacgcgctggtggg	CRISPR spacer
atatccggcccggcaaaaaaagcgcgggtggc	Protospacer
*.  . * ************ **** ***** 

25. spacer 5.6|3693166|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 9, identity: 0.719

actatggccccggcaaaaaacgcgctggtggg	CRISPR spacer
atatccggcccggcaaaaaaagcgcgggtggc	Protospacer
*.  . * ************ **** ***** 

26. spacer 5.6|3693166|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 9, identity: 0.719

actatggccccggcaaaaaacgcgctggtggg	CRISPR spacer
atatccggcccggcaaaaaaagcgcgggtggc	Protospacer
*.  . * ************ **** ***** 

27. spacer 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010957 (Sphingobium sp. YBL2 plasmid 3pYBL2-3, complete sequence) position: , mismatch: 9, identity: 0.727

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
cgaggcggcgacacgcaaggtatgcgggtcgag	Protospacer
  **********.****.******** * .  *

28. spacer 2.1|1160581|59|CP029973|CRISPRCasFinder matches to MT230312 (Escherichia coli strain DH5alpha plasmid pESBL31, complete sequence) position: , mismatch: 10, identity: 0.831

ggtgccagaaccgtaggccggataaggcgttcacgccgcatccggcaataagtgctccg-	CRISPR spacer
gagcacagaaccgtaggacggataaggcgttcacgccgcatccggcgat-cgtgcactga	Protospacer
*.   ************ ****************************.**  **** *.* 

29. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

30. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

31. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

32. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacgactgccggatgcggcgtaaacgccttatccggcctacggatggcg	Protospacer
. **. **********.****.********************* * * .

33. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP044147 (Escherichia coli O157 strain AR-0428 plasmid pAR-0428-2) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaattgccggatgcggcgtgaacgccttatccggcctacggttgagt	Protospacer
. *.. **********.**************************.* .* 

34. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to CP044351 (Escherichia coli strain 194195 plasmid p194195_1, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaattgccggatgcggcgtgaacgccttatccggcctacggttgagt	Protospacer
. *.. **********.**************************.* .* 

35. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga--	CRISPR spacer
cacaagtgccggatgcggcgtaaacgccttatccggcctacg--ccagact	Protospacer
. *..***********.****.********************  .*.**  

36. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 10, identity: 0.796

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gctggttgccggatgcggcgtgaacgccttatccggcctacattcggca	Protospacer
 *.** **********.************************. .. * *

37. spacer 5.7|3693227|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NC_002580 (Propionibacterium freudenreichii plasmid p545, complete sequence) position: , mismatch: 10, identity: 0.688

tgggcggcttgccttgcagccagctccagcag	CRISPR spacer
ccagcggcttgcgtggcagccagctctcaggg	Protospacer
. .********* * ***********. . .*

38. spacer 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028970 (Aminobacter sp. MSH1 plasmid pUSP2, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
gcgtgtgctggcaatcgcttccggggtgacgt	Protospacer
. *.  ********** ***.********  .

39. spacer 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053984 (Achromobacter pestifer strain FDAARGOS_790 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

40. spacer 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NC_010935 (Comamonas testosteroni CNB-1 plasmid pCNB, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

41. spacer 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to JX469826 (Uncultured bacterium plasmid pB12, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

42. spacer 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to JN106171 (Uncultured bacterium plasmid pAKD26, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

43. spacer 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NC_016968 (Comamonas testosteroni plasmid pTB30, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

44. spacer 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NC_016978 (Comamonas testosteroni plasmid pI2, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

45. spacer 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017760 (Cupriavidus necator strain NH9 plasmid pENH91, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

46. spacer 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053554 (Diaphorobacter sp. JS3050 plasmid pDCNB, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

47. spacer 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NC_019263 (Delftia acidovorans plasmid pLME1, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

48. spacer 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NC_019264 (Delftia acidovorans plasmid pNB8c, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

49. spacer 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NC_019283 (Delftia acidovorans plasmid pC1-1, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

50. spacer 5.8|3693288|32|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NC_006830 (Achromobacter xylosoxidans A8 plasmid pA81, complete sequence) position: , mismatch: 10, identity: 0.688

aagctggctggcaatctctttcggggtgagtc	CRISPR spacer
aagctggctggcattctcattcgtcagtacct	Protospacer
************* **** ****  .  * ..

51. spacer 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to CP046443 (Pseudomonas coronafaciens pv. coronafaciens strain B19001 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

52. spacer 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT963392 (Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP1, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

53. spacer 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT963392 (Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP1, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

54. spacer 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034079 (Pseudomonas syringae pv. pisi str. PP1 plasmid pPP1-1, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

55. spacer 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034080 (Pseudomonas syringae pv. pisi str. PP1 plasmid pPP1-2, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

56. spacer 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NC_005918 (Pseudomonas syringae pv. maculicola strain ES4326 plasmid pPMA4326A, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

57. spacer 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047262 (Pseudomonas syringae pv. maculicola str. ES4326 plasmid pPma4326A, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

58. spacer 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026560 (Pseudomonas amygdali pv. morsprunorum strain R15244 plasmid p3_tig5, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

59. spacer 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT963406 (Pseudomonas syringae pv. avii isolate CFBP3846 plasmid PP4, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

60. spacer 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to LT985193 (Pseudomonas syringae strain CFBP 2116 genome assembly, plasmid: PP2) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

61. spacer 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT963393 (Pseudomonas syringae pv. cerasicola isolate CFBP6109 plasmid PP2, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

62. spacer 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT985210 (Pseudomonas syringae pv. cerasicola strain CFBP 6110 plasmid PP1, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

63. spacer 5.10|3693410|33|CP029973|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT985211 (Pseudomonas syringae pv. cerasicola strain CFBP 6110 plasmid PP2, complete sequence) position: , mismatch: 10, identity: 0.697

gcaggcggcgacgcgcagggtatgcgcgattcg	CRISPR spacer
accggcggcgacgcgcaggagatgcgcagcgaa	Protospacer
.* ****************. ******...  .

64. spacer 2.1|1160581|59|CP029973|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 11, identity: 0.814

-ggtgccagaaccgtaggccggataaggcgttcacgccgcatccggcaataagtgctccg	CRISPR spacer
tcgcacca-aaccgtaggccggataaggcgtttacgccgcatccggcaaaaagccgtacc	Protospacer
  *..*** ***********************.**************** ***.  * * 

65. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

66. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

67. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

68. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

69. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

70. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

71. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

72. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

73. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

74. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
* .  .**********.*************************. * * .

75. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgaatggcg	Protospacer
. * . **********.*************************. * * .

76. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtgaacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*************************. * * .

77. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaaccgccggatgcggcgtgaacgccttatccggcctacgggtgagc	Protospacer
. *.. .*********.************************** * .* 

78. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
cacaaccgccggatgcggcgtgaacgccttatccggcctacgggtgagt	Protospacer
. *.. .*********.************************** * .* 

79. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agctggtgccggatgcggcgtaaacgccttatccggcctacaaatgcgc	Protospacer
  * ************.****.*******************.. *  * 

80. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_AP023209 (Escherichia coli strain TUM18781 plasmid pMTY18781-4, complete sequence) position: , mismatch: 11, identity: 0.776

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgtttatgccggatgcggtgtgaacgccttatccggcctacggatggcc	Protospacer
* .  .**********.*.************************ * *  

81. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

82. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

83. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

84. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

85. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

86. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

87. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

88. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

89. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

90. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

91. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtttatgccggatgcggcgtgaacgccttatccggcctacgtagagca	Protospacer
  .  .**********.*************************    * *

92. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccactgccggatgcggcgtggacgccttatccggcctacgagtggcg	Protospacer
. * . **********.*****.*******************. * * .

93. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
aatttttgccggatgcggcgtgaacgccttatccggcctacaacgggca	Protospacer
  .   **********.************************..*  * *

94. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga---	CRISPR spacer
cacaattgccggatgcggcgtaaacgccttatccggcctaca---tggataa	Protospacer
. *.. **********.****.*******************.   .***   

95. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ttttcttgccggatgcggcgtaaacgccttatccggcctacaggacgtg	Protospacer
*..   **********.****.*******************.*  ** .

96. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ctcaaatgccggatgcggcgtgaacgccttatccggcctacgcacacta	Protospacer
..*...**********.*************************  .   *

97. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agcaaatgccggatgcggcgtaaacgccttatccggcctacatttggca	Protospacer
  *...**********.****.*******************. .* * *

98. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
acactttgccggatgcggcgtgaacgcctgatccggcctacggtaagcc	Protospacer
 *    **********.************ *************.  *  

99. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
acactttgccggatgcggcgtgaacgcctgatccggcctacggtaagcc	Protospacer
 *    **********.************ *************.  *  

100. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to MF374379 (Escherichia phage DN1, complete genome) position: , mismatch: 12, identity: 0.755

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgtttatgccggatgcggcgtgaacgccttatccggcctacaaaccgcg	Protospacer
* .  .**********.************************.. .** .

101. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gttgattgccggatgcggcgtaaacgccttatccggcctacattcggca	Protospacer
 ..*. **********.****.*******************. .. * *

102. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ttgttttgccggatgcggcgtgaacgccttatccggcctacaaaaccat	Protospacer
*.    **********.************************..  * . 

103. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NC_049343 (Escherichia phage 500465-2, complete genome) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtgtttgccggatgcggcgtgaacgccttatccgacctacgtgtgacg	Protospacer
  .*  **********.******************.******  * . .

104. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to MT230112 (Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence) position: , mismatch: 13, identity: 0.735

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
ttatgttgccggatgcggcgtaaacgccttatccggcctacaaaagcaa	Protospacer
*.  * **********.****.*******************..    .*

105. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gtaaaatgccggatgcggcgtgaacgccttatccggcctacaaaccaag	Protospacer
 . ...**********.************************.. .*...

106. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
acaaaatgccggatgcggcgtaaacgccttatccggcctacaaaatcgt	Protospacer
 * ...**********.****.*******************..  . * 

107. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gcttcttgccggatgcggcgtgaacgccttatccggcctacaaaatcat	Protospacer
 *.   **********.************************..  . . 

108. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
gcttcttgccggatgcggcgtgaacgccttatccggcctacaaaatcat	Protospacer
 *.   **********.************************..  . . 

109. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP053721 (Escherichia coli strain CP131_Sichuan plasmid pCP131-IncHI1, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccagcctacaaaattgt	Protospacer
* .  .**********.*****************.******..  . * 

110. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgtttatgccggatgcggcgtaaacgccttatccggcctacaaaaagcg	Protospacer
* .  .**********.****.*******************..   * .

111. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP044299 (Escherichia coli strain P59A plasmid pP59A-CTX-M-55, complete sequence) position: , mismatch: 14, identity: 0.714

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
tgttcatgccggatgcggcgtgaacgccttatccagcctacaaaattgt	Protospacer
* .  .**********.*****************.******..  . * 

112. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 15, identity: 0.694

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
agtcaatgccggatgcggcgtgaacgccttatccggcctacaaaagcat	Protospacer
  . ..**********.************************..    . 

113. spacer 4.1|3197016|49|CP029973|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 15, identity: 0.694

tccgggtgccggatgcagcgtgaacgccttatccggcctacggctcgga	CRISPR spacer
caccattgccggatgcggcgtaaacgccttatccggcctacaaaaaacg	Protospacer
. * . **********.****.*******************..   . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 151126 : 199268 52 Escherichia_phage(48.15%) integrase,transposase,tRNA,tail attL 150509:150523|attR 185476:185490
DBSCAN-SWA_2 569469 : 627519 54 Enterobacteria_phage(16.67%) holin,protease,transposase,tRNA NA
DBSCAN-SWA_3 932158 : 1005001 60 uncultured_Caudovirales_phage(20.0%) protease,transposase,tRNA,plate NA
DBSCAN-SWA_4 1023891 : 1042339 22 Enterobacteria_phage(21.43%) holin NA
DBSCAN-SWA_5 1928590 : 1987218 69 Escherichia_phage(40.43%) head,capsid,portal,tRNA,integrase,terminase,holin,transposase,tail attL 1923685:1923699|attR 1930165:1930179
DBSCAN-SWA_6 2913533 : 2923845 10 Escherichia_phage(22.22%) NA NA
DBSCAN-SWA_7 3012710 : 3022153 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_8 3048341 : 3134926 97 Enterobacteria_phage(36.84%) head,capsid,lysis,portal,tRNA,terminase,holin,tail NA
DBSCAN-SWA_9 3672227 : 3685409 12 Escherichia_phage(50.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage