Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
AP018446 Helicobacter cinaedi P03D0629 DNA, complete genome 4 crisprs NA 5 16 0 0

Results visualization

1. AP018446
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018446_1 155132-155255 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018446_2 565641-565764 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018446_3 1372300-1372932 Orphan NA
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018446_4 1892134-1892434 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
AP018446_4 4.1|1892171|29|AP018446|CRT 1892171-1892199 29 AP018446.1 1710868-1710896 0 1.0
AP018446_4 4.3|1892303|29|AP018446|CRT 1892303-1892331 29 AP018446.1 990797-990825 0 1.0
AP018446_4 4.4|1892369|29|AP018446|CRT 1892369-1892397 29 AP018446.1 888637-888665 0 1.0
AP018446_4 4.5|1892171|30|AP018446|CRISPRCasFinder 1892171-1892200 30 AP018446.1 1710867-1710896 0 1.0
AP018446_4 4.7|1892303|30|AP018446|CRISPRCasFinder 1892303-1892332 30 AP018446.1 990797-990826 0 1.0

1. spacer 4.1|1892171|29|AP018446|CRT matches to position: 1710868-1710896, mismatch: 0, identity: 1.0 

catcttttgtggctgcctttgagctgaca	CRISPR spacer
catcttttgtggctgcctttgagctgaca	Protospacer
*****************************

2. spacer 4.3|1892303|29|AP018446|CRT matches to position: 990797-990825, mismatch: 0, identity: 1.0 

tcaatcgtttgcgtcctaagtttgaaagc	CRISPR spacer
tcaatcgtttgcgtcctaagtttgaaagc	Protospacer
*****************************

3. spacer 4.4|1892369|29|AP018446|CRT matches to position: 888637-888665, mismatch: 0, identity: 1.0 

tacacgctcacagcccataagctagattc	CRISPR spacer
tacacgctcacagcccataagctagattc	Protospacer
*****************************

4. spacer 4.5|1892171|30|AP018446|CRISPRCasFinder matches to position: 1710867-1710896, mismatch: 0, identity: 1.0 

catcttttgtggctgcctttgagctgacaa	CRISPR spacer
catcttttgtggctgcctttgagctgacaa	Protospacer
******************************

5. spacer 4.7|1892303|30|AP018446|CRISPRCasFinder matches to position: 990797-990826, mismatch: 0, identity: 1.0 

tcaatcgtttgcgtcctaagtttgaaagca	CRISPR spacer
tcaatcgtttgcgtcctaagtttgaaagca	Protospacer
******************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
AP018446_4 4.4|1892369|29|AP018446|CRT 1892369-1892397 29 NC_010180 Bacillus mycoides KBAB4 plasmid pBWB401, complete sequence 18028-18056 5 0.828
AP018446_3 3.3|1372470|29|AP018446|CRISPRCasFinder 1372470-1372498 29 NZ_CP033045 Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence 233109-233137 6 0.793
AP018446_3 3.18|1372866|30|AP018446|CRT 1372866-1372895 30 NZ_CP041133 Serratia marcescens strain WVU-009 plasmid pWVU-009, complete sequence 75006-75035 6 0.8
AP018446_3 3.27|1372867|30|AP018446|PILER-CR 1372867-1372896 30 NZ_CP041133 Serratia marcescens strain WVU-009 plasmid pWVU-009, complete sequence 75006-75035 6 0.8
AP018446_4 4.3|1892303|29|AP018446|CRT 1892303-1892331 29 MN582098 Podoviridae sp. ctKoA10, complete genome 22097-22125 6 0.793
AP018446_3 3.2|1372404|29|AP018446|CRISPRCasFinder 1372404-1372432 29 NZ_CP007453 Peptoclostridium acidaminophilum DSM 3953 strain al-2 plasmid EAL2_808p, complete sequence 509035-509063 7 0.759
AP018446_3 3.9|1372867|29|AP018446|CRISPRCasFinder 1372867-1372895 29 MT375528 Pelagibacter phage Jormungand E, complete genome 3617-3645 7 0.759
AP018446_3 3.9|1372867|29|AP018446|CRISPRCasFinder 1372867-1372895 29 MH598803 Pelagibacter phage HTVC121P, complete genome 10074-10102 7 0.759
AP018446_3 3.9|1372867|29|AP018446|CRISPRCasFinder 1372867-1372895 29 MH598798 Pelagibacter phage HTVC022P, complete genome 8984-9012 7 0.759
AP018446_3 3.9|1372867|29|AP018446|CRISPRCasFinder 1372867-1372895 29 AP014234 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C93-MedDCM-OCT-S32-C16, *** SEQUENCING IN PROGRESS *** 15085-15113 7 0.759
AP018446_3 3.9|1372867|29|AP018446|CRISPRCasFinder 1372867-1372895 29 KC465901 Pelagibacter phage HTVC019P, complete genome 9765-9793 7 0.759
AP018446_3 3.9|1372867|29|AP018446|CRISPRCasFinder 1372867-1372895 29 MH598804 Pelagibacter phage HTVC105P, complete genome 9889-9917 7 0.759
AP018446_3 3.9|1372867|29|AP018446|CRISPRCasFinder 1372867-1372895 29 AP014235 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C93-MedDCM-OCT-S38-C9, *** SEQUENCING IN PROGRESS *** 17084-17112 7 0.759
AP018446_3 3.9|1372867|29|AP018446|CRISPRCasFinder 1372867-1372895 29 MH579717 Pelagibacter phage HTVC021P, complete genome 9802-9830 7 0.759
AP018446_3 3.9|1372867|29|AP018446|CRISPRCasFinder 1372867-1372895 29 MT375530 Pelagibacter phage Ran EXVC014P, complete genome 26403-26431 7 0.759
AP018446_3 3.11|1372403|30|AP018446|CRT 1372403-1372432 30 NZ_CP007453 Peptoclostridium acidaminophilum DSM 3953 strain al-2 plasmid EAL2_808p, complete sequence 509034-509063 7 0.767
AP018446_3 3.12|1372469|30|AP018446|CRT 1372469-1372498 30 NZ_CP033045 Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence 233108-233137 7 0.767
AP018446_3 3.17|1372800|30|AP018446|CRT 1372800-1372829 30 MN694094 Marine virus AFVG_250M290, complete genome 17952-17981 7 0.767
AP018446_3 3.20|1372404|30|AP018446|PILER-CR 1372404-1372433 30 NZ_CP007453 Peptoclostridium acidaminophilum DSM 3953 strain al-2 plasmid EAL2_808p, complete sequence 509034-509063 7 0.767
AP018446_3 3.21|1372470|30|AP018446|PILER-CR 1372470-1372499 30 NZ_CP033045 Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence 233108-233137 7 0.767
AP018446_3 3.26|1372801|30|AP018446|PILER-CR 1372801-1372830 30 MN694094 Marine virus AFVG_250M290, complete genome 17952-17981 7 0.767
AP018446_4 4.7|1892303|30|AP018446|CRISPRCasFinder 1892303-1892332 30 MN582098 Podoviridae sp. ctKoA10, complete genome 22097-22126 7 0.767
AP018446_3 3.9|1372867|29|AP018446|CRISPRCasFinder 1372867-1372895 29 KJ749827 Escherichia phage ECBP5, complete genome 42265-42293 8 0.724
AP018446_3 3.18|1372866|30|AP018446|CRT 1372866-1372895 30 MT375530 Pelagibacter phage Ran EXVC014P, complete genome 26402-26431 8 0.733
AP018446_3 3.18|1372866|30|AP018446|CRT 1372866-1372895 30 MT375528 Pelagibacter phage Jormungand E, complete genome 3617-3646 8 0.733
AP018446_3 3.18|1372866|30|AP018446|CRT 1372866-1372895 30 MH598803 Pelagibacter phage HTVC121P, complete genome 10074-10103 8 0.733
AP018446_3 3.18|1372866|30|AP018446|CRT 1372866-1372895 30 MH598798 Pelagibacter phage HTVC022P, complete genome 8984-9013 8 0.733
AP018446_3 3.18|1372866|30|AP018446|CRT 1372866-1372895 30 AP014234 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C93-MedDCM-OCT-S32-C16, *** SEQUENCING IN PROGRESS *** 15085-15114 8 0.733
AP018446_3 3.18|1372866|30|AP018446|CRT 1372866-1372895 30 KC465901 Pelagibacter phage HTVC019P, complete genome 9765-9794 8 0.733
AP018446_3 3.18|1372866|30|AP018446|CRT 1372866-1372895 30 MH598804 Pelagibacter phage HTVC105P, complete genome 9889-9918 8 0.733
AP018446_3 3.18|1372866|30|AP018446|CRT 1372866-1372895 30 AP014235 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C93-MedDCM-OCT-S38-C9, *** SEQUENCING IN PROGRESS *** 17084-17113 8 0.733
AP018446_3 3.18|1372866|30|AP018446|CRT 1372866-1372895 30 MH579717 Pelagibacter phage HTVC021P, complete genome 9802-9831 8 0.733
AP018446_3 3.18|1372866|30|AP018446|CRT 1372866-1372895 30 KJ749827 Escherichia phage ECBP5, complete genome 42265-42294 8 0.733
AP018446_3 3.27|1372867|30|AP018446|PILER-CR 1372867-1372896 30 MT375530 Pelagibacter phage Ran EXVC014P, complete genome 26402-26431 8 0.733
AP018446_3 3.27|1372867|30|AP018446|PILER-CR 1372867-1372896 30 MT375528 Pelagibacter phage Jormungand E, complete genome 3617-3646 8 0.733
AP018446_3 3.27|1372867|30|AP018446|PILER-CR 1372867-1372896 30 MH598803 Pelagibacter phage HTVC121P, complete genome 10074-10103 8 0.733
AP018446_3 3.27|1372867|30|AP018446|PILER-CR 1372867-1372896 30 MH598798 Pelagibacter phage HTVC022P, complete genome 8984-9013 8 0.733
AP018446_3 3.27|1372867|30|AP018446|PILER-CR 1372867-1372896 30 AP014234 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C93-MedDCM-OCT-S32-C16, *** SEQUENCING IN PROGRESS *** 15085-15114 8 0.733
AP018446_3 3.27|1372867|30|AP018446|PILER-CR 1372867-1372896 30 KC465901 Pelagibacter phage HTVC019P, complete genome 9765-9794 8 0.733
AP018446_3 3.27|1372867|30|AP018446|PILER-CR 1372867-1372896 30 MH598804 Pelagibacter phage HTVC105P, complete genome 9889-9918 8 0.733
AP018446_3 3.27|1372867|30|AP018446|PILER-CR 1372867-1372896 30 AP014235 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C93-MedDCM-OCT-S38-C9, *** SEQUENCING IN PROGRESS *** 17084-17113 8 0.733
AP018446_3 3.27|1372867|30|AP018446|PILER-CR 1372867-1372896 30 MH579717 Pelagibacter phage HTVC021P, complete genome 9802-9831 8 0.733
AP018446_3 3.27|1372867|30|AP018446|PILER-CR 1372867-1372896 30 KJ749827 Escherichia phage ECBP5, complete genome 42265-42294 8 0.733
AP018446_1 1.1|155150|32|AP018446|PILER-CR 155150-155181 32 NC_014628 Paenibacillus polymyxa SC2 plasmid pSC2, complete sequence 386096-386127 10 0.688
AP018446_1 1.1|155150|32|AP018446|PILER-CR 155150-155181 32 HG531805 Clostridium phage CDMH1 complete genome 38487-38518 10 0.688
AP018446_2 2.1|565659|32|AP018446|PILER-CR 565659-565690 32 NC_014628 Paenibacillus polymyxa SC2 plasmid pSC2, complete sequence 386096-386127 10 0.688
AP018446_2 2.1|565659|32|AP018446|PILER-CR 565659-565690 32 HG531805 Clostridium phage CDMH1 complete genome 38487-38518 10 0.688

1. spacer 4.4|1892369|29|AP018446|CRT matches to NC_010180 (Bacillus mycoides KBAB4 plasmid pBWB401, complete sequence) position: , mismatch: 5, identity: 0.828 

tacacgctcacagcccataagctagattc	CRISPR spacer
aacacggtcacagccgataagctagttgc	Protospacer
 ***** ******** ********* * *

2. spacer 3.3|1372470|29|AP018446|CRISPRCasFinder matches to NZ_CP033045 (Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793 

taattgtagtttgctagtagaaaattata	CRISPR spacer
taattgtagtttgctagaaggaacacaca	Protospacer
***************** **.**  .*.*

3. spacer 3.18|1372866|30|AP018446|CRT matches to NZ_CP041133 (Serratia marcescens strain WVU-009 plasmid pWVU-009, complete sequence) position: , mismatch: 6, identity: 0.8 

ttttatgattttgtattccacatagcagca	CRISPR spacer
tttcttgattttgtattccacataaacgcc	Protospacer
***. *******************.  **

4. spacer 3.27|1372867|30|AP018446|PILER-CR matches to NZ_CP041133 (Serratia marcescens strain WVU-009 plasmid pWVU-009, complete sequence) position: , mismatch: 6, identity: 0.8 

ttttatgattttgtattccacatagcagca	CRISPR spacer
tttcttgattttgtattccacataaacgcc	Protospacer
***. *******************.  **

5. spacer 4.3|1892303|29|AP018446|CRT matches to MN582098 (Podoviridae sp. ctKoA10, complete genome) position: , mismatch: 6, identity: 0.793 

tcaatcgtttgcgtcctaagtttgaaagc	CRISPR spacer
accttcgtttgcgtcagaagtttgaaatc	Protospacer
 *  ***********  ********** *

6. spacer 3.2|1372404|29|AP018446|CRISPRCasFinder matches to NZ_CP007453 (Peptoclostridium acidaminophilum DSM 3953 strain al-2 plasmid EAL2_808p, complete sequence) position: , mismatch: 7, identity: 0.759 

tgacaagtctatacccgtttttatactcg	CRISPR spacer
agacaattctacacccgtttttattcgtc	Protospacer
 ***** ****.************ * .

7. spacer 3.9|1372867|29|AP018446|CRISPRCasFinder matches to MT375528 (Pelagibacter phage Jormungand E, complete genome) position: , mismatch: 7, identity: 0.759 

tttatgattttgtattccacatagcagca	CRISPR spacer
tatatggttttgcattccacatagctttt	Protospacer
* ****.*****.************  .

8. spacer 3.9|1372867|29|AP018446|CRISPRCasFinder matches to MH598803 (Pelagibacter phage HTVC121P, complete genome) position: , mismatch: 7, identity: 0.759 

tttatgattttgtattccacatagcagca	CRISPR spacer
tatatggttttgcattccacatagcttgt	Protospacer
* ****.*****.************

9. spacer 3.9|1372867|29|AP018446|CRISPRCasFinder matches to MH598798 (Pelagibacter phage HTVC022P, complete genome) position: , mismatch: 7, identity: 0.759 

tttatgattttgtattccacatagcagca	CRISPR spacer
tatatggttttgcattccacatagctttt	Protospacer
* ****.*****.************  .

10. spacer 3.9|1372867|29|AP018446|CRISPRCasFinder matches to AP014234 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C93-MedDCM-OCT-S32-C16, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.759 

tttatgattttgtattccacatagcagca	CRISPR spacer
tatatggttttgcattccacatagcttgt	Protospacer
* ****.*****.************

11. spacer 3.9|1372867|29|AP018446|CRISPRCasFinder matches to KC465901 (Pelagibacter phage HTVC019P, complete genome) position: , mismatch: 7, identity: 0.759 

tttatgattttgtattccacatagcagca	CRISPR spacer
tatatggttttgcattccacatagctttt	Protospacer
* ****.*****.************  .

12. spacer 3.9|1372867|29|AP018446|CRISPRCasFinder matches to MH598804 (Pelagibacter phage HTVC105P, complete genome) position: , mismatch: 7, identity: 0.759 

tttatgattttgtattccacatagcagca	CRISPR spacer
tatatggttttgcattccacatagcttgt	Protospacer
* ****.*****.************

13. spacer 3.9|1372867|29|AP018446|CRISPRCasFinder matches to AP014235 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C93-MedDCM-OCT-S38-C9, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.759 

tttatgattttgtattccacatagcagca	CRISPR spacer
tatatggttttgcattccacatagcttgt	Protospacer
* ****.*****.************

14. spacer 3.9|1372867|29|AP018446|CRISPRCasFinder matches to MH579717 (Pelagibacter phage HTVC021P, complete genome) position: , mismatch: 7, identity: 0.759 

tttatgattttgtattccacatagcagca	CRISPR spacer
tatatggttttgcattccacatagcttgt	Protospacer
* ****.*****.************

15. spacer 3.9|1372867|29|AP018446|CRISPRCasFinder matches to MT375530 (Pelagibacter phage Ran EXVC014P, complete genome) position: , mismatch: 7, identity: 0.759 

tttatgattttgtattccacatagcagca	CRISPR spacer
tatatggttttgcattccacatagctttt	Protospacer
* ****.*****.************  .

16. spacer 3.11|1372403|30|AP018446|CRT matches to NZ_CP007453 (Peptoclostridium acidaminophilum DSM 3953 strain al-2 plasmid EAL2_808p, complete sequence) position: , mismatch: 7, identity: 0.767 

atgacaagtctatacccgtttttatactcg	CRISPR spacer
aagacaattctacacccgtttttattcgtc	Protospacer
* ***** ****.************ * .

17. spacer 3.12|1372469|30|AP018446|CRT matches to NZ_CP033045 (Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

ataattgtagtttgctagtagaaaattata	CRISPR spacer
ttaattgtagtttgctagaaggaacacaca	Protospacer
 ***************** **.**  .*.*

18. spacer 3.17|1372800|30|AP018446|CRT matches to MN694094 (Marine virus AFVG_250M290, complete genome) position: , mismatch: 7, identity: 0.767 

taaaaatcctcctattattcctaaagttag	CRISPR spacer
taataatcctgctattattcctacgataat	Protospacer
*** ****** ************ ..* *

19. spacer 3.20|1372404|30|AP018446|PILER-CR matches to NZ_CP007453 (Peptoclostridium acidaminophilum DSM 3953 strain al-2 plasmid EAL2_808p, complete sequence) position: , mismatch: 7, identity: 0.767 

atgacaagtctatacccgtttttatactcg	CRISPR spacer
aagacaattctacacccgtttttattcgtc	Protospacer
* ***** ****.************ * .

20. spacer 3.21|1372470|30|AP018446|PILER-CR matches to NZ_CP033045 (Bacillus foraminis strain Bac44 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767 

ataattgtagtttgctagtagaaaattata	CRISPR spacer
ttaattgtagtttgctagaaggaacacaca	Protospacer
 ***************** **.**  .*.*

21. spacer 3.26|1372801|30|AP018446|PILER-CR matches to MN694094 (Marine virus AFVG_250M290, complete genome) position: , mismatch: 7, identity: 0.767 

taaaaatcctcctattattcctaaagttag	CRISPR spacer
taataatcctgctattattcctacgataat	Protospacer
*** ****** ************ ..* *

22. spacer 4.7|1892303|30|AP018446|CRISPRCasFinder matches to MN582098 (Podoviridae sp. ctKoA10, complete genome) position: , mismatch: 7, identity: 0.767 

tcaatcgtttgcgtcctaagtttgaaagca	CRISPR spacer
accttcgtttgcgtcagaagtttgaaatct	Protospacer
 *  ***********  ********** *

23. spacer 3.9|1372867|29|AP018446|CRISPRCasFinder matches to KJ749827 (Escherichia phage ECBP5, complete genome) position: , mismatch: 8, identity: 0.724 

tttatgattttgtattccacatagcagca	CRISPR spacer
gccatgaggttgtattccacatagcaaag	Protospacer
 ..****  *****************. .

24. spacer 3.18|1372866|30|AP018446|CRT matches to MT375530 (Pelagibacter phage Ran EXVC014P, complete genome) position: , mismatch: 8, identity: 0.733 

ttttatgattttgtattccacatagcagca	CRISPR spacer
ctatatggttttgcattccacatagctttt	Protospacer
.* ****.*****.************  .

25. spacer 3.18|1372866|30|AP018446|CRT matches to MT375528 (Pelagibacter phage Jormungand E, complete genome) position: , mismatch: 8, identity: 0.733 

ttttatgattttgtattccacatagcagca	CRISPR spacer
ctatatggttttgcattccacatagctttt	Protospacer
.* ****.*****.************  .

26. spacer 3.18|1372866|30|AP018446|CRT matches to MH598803 (Pelagibacter phage HTVC121P, complete genome) position: , mismatch: 8, identity: 0.733 

ttttatgattttgtattccacatagcagca	CRISPR spacer
ctatatggttttgcattccacatagcttgt	Protospacer
.* ****.*****.************

27. spacer 3.18|1372866|30|AP018446|CRT matches to MH598798 (Pelagibacter phage HTVC022P, complete genome) position: , mismatch: 8, identity: 0.733 

ttttatgattttgtattccacatagcagca	CRISPR spacer
ctatatggttttgcattccacatagctttt	Protospacer
.* ****.*****.************  .

28. spacer 3.18|1372866|30|AP018446|CRT matches to AP014234 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C93-MedDCM-OCT-S32-C16, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.733 

ttttatgattttgtattccacatagcagca	CRISPR spacer
ctatatggttttgcattccacatagcttgt	Protospacer
.* ****.*****.************

29. spacer 3.18|1372866|30|AP018446|CRT matches to KC465901 (Pelagibacter phage HTVC019P, complete genome) position: , mismatch: 8, identity: 0.733 

ttttatgattttgtattccacatagcagca	CRISPR spacer
ctatatggttttgcattccacatagctttt	Protospacer
.* ****.*****.************  .

30. spacer 3.18|1372866|30|AP018446|CRT matches to MH598804 (Pelagibacter phage HTVC105P, complete genome) position: , mismatch: 8, identity: 0.733 

ttttatgattttgtattccacatagcagca	CRISPR spacer
ctatatggttttgcattccacatagcttgt	Protospacer
.* ****.*****.************

31. spacer 3.18|1372866|30|AP018446|CRT matches to AP014235 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C93-MedDCM-OCT-S38-C9, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.733 

ttttatgattttgtattccacatagcagca	CRISPR spacer
ctatatggttttgcattccacatagcttgt	Protospacer
.* ****.*****.************

32. spacer 3.18|1372866|30|AP018446|CRT matches to MH579717 (Pelagibacter phage HTVC021P, complete genome) position: , mismatch: 8, identity: 0.733 

ttttatgattttgtattccacatagcagca	CRISPR spacer
ctatatggttttgcattccacatagcttgt	Protospacer
.* ****.*****.************

33. spacer 3.18|1372866|30|AP018446|CRT matches to KJ749827 (Escherichia phage ECBP5, complete genome) position: , mismatch: 8, identity: 0.733 

ttttatgattttgtattccacatagcagca	CRISPR spacer
tgccatgaggttgtattccacatagcaaag	Protospacer
* ..****  *****************. .

34. spacer 3.27|1372867|30|AP018446|PILER-CR matches to MT375530 (Pelagibacter phage Ran EXVC014P, complete genome) position: , mismatch: 8, identity: 0.733 

ttttatgattttgtattccacatagcagca	CRISPR spacer
ctatatggttttgcattccacatagctttt	Protospacer
.* ****.*****.************  .

35. spacer 3.27|1372867|30|AP018446|PILER-CR matches to MT375528 (Pelagibacter phage Jormungand E, complete genome) position: , mismatch: 8, identity: 0.733 

ttttatgattttgtattccacatagcagca	CRISPR spacer
ctatatggttttgcattccacatagctttt	Protospacer
.* ****.*****.************  .

36. spacer 3.27|1372867|30|AP018446|PILER-CR matches to MH598803 (Pelagibacter phage HTVC121P, complete genome) position: , mismatch: 8, identity: 0.733 

ttttatgattttgtattccacatagcagca	CRISPR spacer
ctatatggttttgcattccacatagcttgt	Protospacer
.* ****.*****.************

37. spacer 3.27|1372867|30|AP018446|PILER-CR matches to MH598798 (Pelagibacter phage HTVC022P, complete genome) position: , mismatch: 8, identity: 0.733 

ttttatgattttgtattccacatagcagca	CRISPR spacer
ctatatggttttgcattccacatagctttt	Protospacer
.* ****.*****.************  .

38. spacer 3.27|1372867|30|AP018446|PILER-CR matches to AP014234 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C93-MedDCM-OCT-S32-C16, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.733 

ttttatgattttgtattccacatagcagca	CRISPR spacer
ctatatggttttgcattccacatagcttgt	Protospacer
.* ****.*****.************

39. spacer 3.27|1372867|30|AP018446|PILER-CR matches to KC465901 (Pelagibacter phage HTVC019P, complete genome) position: , mismatch: 8, identity: 0.733 

ttttatgattttgtattccacatagcagca	CRISPR spacer
ctatatggttttgcattccacatagctttt	Protospacer
.* ****.*****.************  .

40. spacer 3.27|1372867|30|AP018446|PILER-CR matches to MH598804 (Pelagibacter phage HTVC105P, complete genome) position: , mismatch: 8, identity: 0.733 

ttttatgattttgtattccacatagcagca	CRISPR spacer
ctatatggttttgcattccacatagcttgt	Protospacer
.* ****.*****.************

41. spacer 3.27|1372867|30|AP018446|PILER-CR matches to AP014235 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C93-MedDCM-OCT-S38-C9, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.733 

ttttatgattttgtattccacatagcagca	CRISPR spacer
ctatatggttttgcattccacatagcttgt	Protospacer
.* ****.*****.************

42. spacer 3.27|1372867|30|AP018446|PILER-CR matches to MH579717 (Pelagibacter phage HTVC021P, complete genome) position: , mismatch: 8, identity: 0.733 

ttttatgattttgtattccacatagcagca	CRISPR spacer
ctatatggttttgcattccacatagcttgt	Protospacer
.* ****.*****.************

43. spacer 3.27|1372867|30|AP018446|PILER-CR matches to KJ749827 (Escherichia phage ECBP5, complete genome) position: , mismatch: 8, identity: 0.733 

ttttatgattttgtattccacatagcagca	CRISPR spacer
tgccatgaggttgtattccacatagcaaag	Protospacer
* ..****  *****************. .

44. spacer 1.1|155150|32|AP018446|PILER-CR matches to NC_014628 (Paenibacillus polymyxa SC2 plasmid pSC2, complete sequence) position: , mismatch: 10, identity: 0.688 

gccattgattgattctttggctcaaattcccc	CRISPR spacer
aacattgattgatgctttgcctcaagtggatg	Protospacer
. *********** ***** *****.*   .

45. spacer 1.1|155150|32|AP018446|PILER-CR matches to HG531805 (Clostridium phage CDMH1 complete genome) position: , mismatch: 10, identity: 0.688 

gccattgattgattctttggctcaaattcccc	CRISPR spacer
ttttgcgattgattcttaggttcaaattcttc	Protospacer
 ..  .*********** **.********..*

46. spacer 2.1|565659|32|AP018446|PILER-CR matches to NC_014628 (Paenibacillus polymyxa SC2 plasmid pSC2, complete sequence) position: , mismatch: 10, identity: 0.688 

gccattgattgattctttggctcaaattcccc	CRISPR spacer
aacattgattgatgctttgcctcaagtggatg	Protospacer
. *********** ***** *****.*   .

47. spacer 2.1|565659|32|AP018446|PILER-CR matches to HG531805 (Clostridium phage CDMH1 complete genome) position: , mismatch: 10, identity: 0.688 

gccattgattgattctttggctcaaattcccc	CRISPR spacer
ttttgcgattgattcttaggttcaaattcttc	Protospacer
 ..  .*********** **.********..*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage