Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029776 Deinococcus actinosclerus strain SJTR plasmid unnamed2, complete sequence 1 crisprs Cas14u_CAS-V,WYL,DinG 0 2 1 0
CP029778 Deinococcus actinosclerus strain SJTR plasmid unnamed4, complete sequence 0 crisprs NA 0 0 0 0
CP029774 Deinococcus actinosclerus strain SJTR chromosome, complete genome 1 crisprs csa3,WYL,cas3,DEDDh 0 0 0 0
CP029775 Deinococcus actinosclerus strain SJTR plasmid unnamed1, complete sequence 0 crisprs Cas14u_CAS-V 0 0 0 0
CP029777 Deinococcus actinosclerus strain SJTR plasmid unnamed3, complete sequence 0 crisprs csa3 0 0 0 0

Results visualization

1. CP029776
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029776_1 28172-28304 Unclear NA
2 spacers
Cas14u_CAS-V

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029776_1 1.1|28194|34|CP029776|PILER-CR 28194-28227 34 NZ_CP029776 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed2, complete sequence 28194-28227 0 1.0
CP029776_1 1.2|28250|33|CP029776|PILER-CR 28250-28282 33 NZ_CP029776 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed2, complete sequence 28250-28282 0 1.0
CP029776_1 1.1|28194|34|CP029776|PILER-CR 28194-28227 34 NZ_CP029776 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed2, complete sequence 28428-28461 8 0.765
CP029776_1 1.1|28194|34|CP029776|PILER-CR 28194-28227 34 NZ_CP029776 Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed2, complete sequence 28282-28315 9 0.735

1. spacer 1.1|28194|34|CP029776|PILER-CR matches to NZ_CP029776 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

tgaatcccacaggtatgtctcaggcgaaggagct	CRISPR spacer
tgaatcccacaggtatgtctcaggcgaaggagct	Protospacer
**********************************

2. spacer 1.2|28250|33|CP029776|PILER-CR matches to NZ_CP029776 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed2, complete sequence) position: , mismatch: 0, identity: 1.0

cggtgaaacagaaccccacaggtgtgtctcaat	CRISPR spacer
cggtgaaacagaaccccacaggtgtgtctcaat	Protospacer
*********************************

3. spacer 1.1|28194|34|CP029776|PILER-CR matches to NZ_CP029776 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.765

tgaatcccacaggtatgtctcaggcgaaggagct	CRISPR spacer
ccaatcccacaggtgtgtctcaggcgcaaccgcc	Protospacer
. ************.*********** *.  **.

4. spacer 1.1|28194|34|CP029776|PILER-CR matches to NZ_CP029776 (Deinococcus actinosclerus strain Deinococcus actinosclerus SJTR plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735

tgaatcccacaggtatgtctcaggcgaaggagct----	CRISPR spacer
tgaatcccgcaggtgtgtctcagg----ggcgtcttga	Protospacer
********.*****.*********    ** *..    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10312 : 163731 113 Bacillus_phage(20.0%) integrase,transposase attL 92383:92442|attR 163731:164885
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP029774
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029774_2 3299901-3300015 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage