Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029673 Staphylococcus aureus strain AR_0220 chromosome, complete genome 7 crisprs cas3,DEDDh,DinG,csa3,RT,WYL 8 3 8 0
CP029672 Staphylococcus aureus strain AR_0220 plasmid unnamed1, complete sequence 0 crisprs csa3 0 0 0 0

Results visualization

1. CP029673
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029673_1 426856-426957 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029673_2 823154-823232 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029673_3 828608-828877 Unclear NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029673_4 871794-871875 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029673_5 1664495-1664579 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029673_6 2228121-2228201 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029673_8 2348484-2348564 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP029673_2 2.1|823178|31|CP029673|CRISPRCasFinder 823178-823208 31 CP029673.1 311784-311814 0 1.0
CP029673_3 3.1|828644|22|CP029673|CRT 828644-828665 22 CP029673.1 188575-188596 0 1.0
CP029673_3 3.1|828644|22|CP029673|CRT 828644-828665 22 CP029673.1 188633-188654 0 1.0
CP029673_3 3.1|828644|22|CP029673|CRT 828644-828665 22 CP029673.1 311709-311730 0 1.0
CP029673_3 3.1|828644|22|CP029673|CRT 828644-828665 22 CP029673.1 311819-311840 0 1.0
CP029673_3 3.1|828644|22|CP029673|CRT 828644-828665 22 CP029673.1 655280-655301 0 1.0
CP029673_3 3.1|828644|22|CP029673|CRT 828644-828665 22 CP029673.1 781304-781325 0 1.0
CP029673_3 3.1|828644|22|CP029673|CRT 828644-828665 22 CP029673.1 871867-871888 0 1.0
CP029673_3 3.1|828644|22|CP029673|CRT 828644-828665 22 CP029673.1 1393039-1393060 0 1.0
CP029673_3 3.1|828644|22|CP029673|CRT 828644-828665 22 CP029673.1 1664571-1664592 0 1.0
CP029673_3 3.1|828644|22|CP029673|CRT 828644-828665 22 CP029673.1 1679105-1679126 0 1.0
CP029673_3 3.1|828644|22|CP029673|CRT 828644-828665 22 CP029673.1 1996405-1996426 0 1.0
CP029673_3 3.3|828761|22|CP029673|CRT 828761-828782 22 CP029673.1 188575-188596 0 1.0
CP029673_3 3.3|828761|22|CP029673|CRT 828761-828782 22 CP029673.1 188633-188654 0 1.0
CP029673_3 3.3|828761|22|CP029673|CRT 828761-828782 22 CP029673.1 311709-311730 0 1.0
CP029673_3 3.3|828761|22|CP029673|CRT 828761-828782 22 CP029673.1 311819-311840 0 1.0
CP029673_3 3.3|828761|22|CP029673|CRT 828761-828782 22 CP029673.1 655280-655301 0 1.0
CP029673_3 3.3|828761|22|CP029673|CRT 828761-828782 22 CP029673.1 781304-781325 0 1.0
CP029673_3 3.3|828761|22|CP029673|CRT 828761-828782 22 CP029673.1 871867-871888 0 1.0
CP029673_3 3.3|828761|22|CP029673|CRT 828761-828782 22 CP029673.1 1393039-1393060 0 1.0
CP029673_3 3.3|828761|22|CP029673|CRT 828761-828782 22 CP029673.1 1664571-1664592 0 1.0
CP029673_3 3.3|828761|22|CP029673|CRT 828761-828782 22 CP029673.1 1679105-1679126 0 1.0
CP029673_3 3.3|828761|22|CP029673|CRT 828761-828782 22 CP029673.1 1996405-1996426 0 1.0
CP029673_2 2.1|823178|31|CP029673|CRISPRCasFinder 823178-823208 31 CP029673.1 311729-311759 1 0.968
CP029673_2 2.1|823178|31|CP029673|CRISPRCasFinder 823178-823208 31 CP029673.1 1698977-1699007 1 0.968
CP029673_3 3.1|828644|22|CP029673|CRT 828644-828665 22 CP029673.1 942096-942117 1 0.955
CP029673_3 3.1|828644|22|CP029673|CRT 828644-828665 22 CP029673.1 1698832-1698853 1 0.955
CP029673_3 3.1|828644|22|CP029673|CRT 828644-828665 22 CP029673.1 1699065-1699086 1 0.955
CP029673_3 3.2|828702|23|CP029673|CRT 828702-828724 23 CP029673.1 782476-782498 1 0.957
CP029673_3 3.2|828702|23|CP029673|CRT 828702-828724 23 CP029673.1 1393155-1393177 1 0.957
CP029673_3 3.2|828702|23|CP029673|CRT 828702-828724 23 CP029673.1 1996463-1996485 1 0.957
CP029673_3 3.2|828702|23|CP029673|CRT 828702-828724 23 CP029673.1 2337655-2337677 1 0.957
CP029673_3 3.3|828761|22|CP029673|CRT 828761-828782 22 CP029673.1 942096-942117 1 0.955
CP029673_3 3.3|828761|22|CP029673|CRT 828761-828782 22 CP029673.1 1698832-1698853 1 0.955
CP029673_3 3.3|828761|22|CP029673|CRT 828761-828782 22 CP029673.1 1699065-1699086 1 0.955
CP029673_3 3.4|828819|23|CP029673|CRT 828819-828841 23 CP029673.1 782476-782498 1 0.957
CP029673_3 3.4|828819|23|CP029673|CRT 828819-828841 23 CP029673.1 1393155-1393177 1 0.957
CP029673_3 3.4|828819|23|CP029673|CRT 828819-828841 23 CP029673.1 1996463-1996485 1 0.957
CP029673_3 3.4|828819|23|CP029673|CRT 828819-828841 23 CP029673.1 2337655-2337677 1 0.957
CP029673_4 4.1|871818|34|CP029673|CRISPRCasFinder 871818-871851 34 CP029673.1 1393135-1393168 1 0.971
CP029673_5 5.1|1664521|33|CP029673|CRISPRCasFinder 1664521-1664553 33 CP029673.1 1393136-1393168 1 0.97
CP029673_8 8.1|2348509|31|CP029673|CRISPRCasFinder 2348509-2348539 31 CP029673.1 835896-835926 1 0.968
CP029673_8 8.1|2348509|31|CP029673|CRISPRCasFinder 2348509-2348539 31 CP029673.1 835952-835982 1 0.968
CP029673_3 3.2|828702|23|CP029673|CRT 828702-828724 23 CP029673.1 1482991-1483013 2 0.913
CP029673_3 3.2|828702|23|CP029673|CRT 828702-828724 23 CP029673.1 2098952-2098974 2 0.913
CP029673_3 3.4|828819|23|CP029673|CRT 828819-828841 23 CP029673.1 1482991-1483013 2 0.913
CP029673_3 3.4|828819|23|CP029673|CRT 828819-828841 23 CP029673.1 2098952-2098974 2 0.913
CP029673_8 8.1|2348509|31|CP029673|CRISPRCasFinder 2348509-2348539 31 CP029673.1 88408-88438 2 0.935
CP029673_8 8.1|2348509|31|CP029673|CRISPRCasFinder 2348509-2348539 31 CP029673.1 388117-388147 2 0.935
CP029673_8 8.1|2348509|31|CP029673|CRISPRCasFinder 2348509-2348539 31 CP029673.1 655335-655365 2 0.935
CP029673_8 8.1|2348509|31|CP029673|CRISPRCasFinder 2348509-2348539 31 CP029673.1 836008-836038 2 0.935
CP029673_8 8.1|2348509|31|CP029673|CRISPRCasFinder 2348509-2348539 31 CP029673.1 872130-872160 2 0.935
CP029673_8 8.1|2348509|31|CP029673|CRISPRCasFinder 2348509-2348539 31 CP029673.1 1038094-1038124 2 0.935
CP029673_8 8.1|2348509|31|CP029673|CRISPRCasFinder 2348509-2348539 31 CP029673.1 1185477-1185507 2 0.935
CP029673_8 8.1|2348509|31|CP029673|CRISPRCasFinder 2348509-2348539 31 CP029673.1 1393094-1393124 2 0.935
CP029673_8 8.1|2348509|31|CP029673|CRISPRCasFinder 2348509-2348539 31 CP029673.1 1483044-1483074 2 0.935
CP029673_8 8.1|2348509|31|CP029673|CRISPRCasFinder 2348509-2348539 31 CP029673.1 1679159-1679189 2 0.935
CP029673_8 8.1|2348509|31|CP029673|CRISPRCasFinder 2348509-2348539 31 CP029673.1 1995057-1995087 2 0.935
CP029673_8 8.1|2348509|31|CP029673|CRISPRCasFinder 2348509-2348539 31 CP029673.1 2337708-2337738 2 0.935
CP029673_8 8.1|2348509|31|CP029673|CRISPRCasFinder 2348509-2348539 31 CP029673.1 2513058-2513088 2 0.935

1. spacer 2.1|823178|31|CP029673|CRISPRCasFinder matches to position: 311784-311814, mismatch: 0, identity: 1.0

ctgtgttggggccccgccaacttgcattgcc	CRISPR spacer
ctgtgttggggccccgccaacttgcattgcc	Protospacer
*******************************

2. spacer 3.1|828644|22|CP029673|CRT matches to position: 188575-188596, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

3. spacer 3.1|828644|22|CP029673|CRT matches to position: 188633-188654, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

4. spacer 3.1|828644|22|CP029673|CRT matches to position: 311709-311730, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

5. spacer 3.1|828644|22|CP029673|CRT matches to position: 311819-311840, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

6. spacer 3.1|828644|22|CP029673|CRT matches to position: 655280-655301, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

7. spacer 3.1|828644|22|CP029673|CRT matches to position: 781304-781325, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

8. spacer 3.1|828644|22|CP029673|CRT matches to position: 871867-871888, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

9. spacer 3.1|828644|22|CP029673|CRT matches to position: 1393039-1393060, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

10. spacer 3.1|828644|22|CP029673|CRT matches to position: 1664571-1664592, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

11. spacer 3.1|828644|22|CP029673|CRT matches to position: 1679105-1679126, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

12. spacer 3.1|828644|22|CP029673|CRT matches to position: 1996405-1996426, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

13. spacer 3.3|828761|22|CP029673|CRT matches to position: 188575-188596, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

14. spacer 3.3|828761|22|CP029673|CRT matches to position: 188633-188654, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

15. spacer 3.3|828761|22|CP029673|CRT matches to position: 311709-311730, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

16. spacer 3.3|828761|22|CP029673|CRT matches to position: 311819-311840, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

17. spacer 3.3|828761|22|CP029673|CRT matches to position: 655280-655301, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

18. spacer 3.3|828761|22|CP029673|CRT matches to position: 781304-781325, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

19. spacer 3.3|828761|22|CP029673|CRT matches to position: 871867-871888, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

20. spacer 3.3|828761|22|CP029673|CRT matches to position: 1393039-1393060, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

21. spacer 3.3|828761|22|CP029673|CRT matches to position: 1664571-1664592, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

22. spacer 3.3|828761|22|CP029673|CRT matches to position: 1679105-1679126, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

23. spacer 3.3|828761|22|CP029673|CRT matches to position: 1996405-1996426, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

24. spacer 2.1|823178|31|CP029673|CRISPRCasFinder matches to position: 311729-311759, mismatch: 1, identity: 0.968

ctgtgttggggccccgccaacttgcattgcc	CRISPR spacer
ctgtgttggggccccgccaacttgcattacc	Protospacer
****************************.**

25. spacer 2.1|823178|31|CP029673|CRISPRCasFinder matches to position: 1698977-1699007, mismatch: 1, identity: 0.968

ctgtgttggggccccgccaacttgcattgcc	CRISPR spacer
ctgtgttggggccccgccaacttccattgcc	Protospacer
*********************** *******

26. spacer 3.1|828644|22|CP029673|CRT matches to position: 942096-942117, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttagaaa	Protospacer
***************** ****

27. spacer 3.1|828644|22|CP029673|CRT matches to position: 1698832-1698853, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

28. spacer 3.1|828644|22|CP029673|CRT matches to position: 1699065-1699086, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

29. spacer 3.2|828702|23|CP029673|CRT matches to position: 782476-782498, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

30. spacer 3.2|828702|23|CP029673|CRT matches to position: 1393155-1393177, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

31. spacer 3.2|828702|23|CP029673|CRT matches to position: 1996463-1996485, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

32. spacer 3.2|828702|23|CP029673|CRT matches to position: 2337655-2337677, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

33. spacer 3.3|828761|22|CP029673|CRT matches to position: 942096-942117, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttagaaa	Protospacer
***************** ****

34. spacer 3.3|828761|22|CP029673|CRT matches to position: 1698832-1698853, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

35. spacer 3.3|828761|22|CP029673|CRT matches to position: 1699065-1699086, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

36. spacer 3.4|828819|23|CP029673|CRT matches to position: 782476-782498, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

37. spacer 3.4|828819|23|CP029673|CRT matches to position: 1393155-1393177, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

38. spacer 3.4|828819|23|CP029673|CRT matches to position: 1996463-1996485, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

39. spacer 3.4|828819|23|CP029673|CRT matches to position: 2337655-2337677, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

40. spacer 4.1|871818|34|CP029673|CRISPRCasFinder matches to position: 1393135-1393168, mismatch: 1, identity: 0.971

attgagaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
****.*****************************

41. spacer 5.1|1664521|33|CP029673|CRISPRCasFinder matches to position: 1393136-1393168, mismatch: 1, identity: 0.97

attgggaatccaatttctctgtgttggggccca	CRISPR spacer
attgggaatccaatttctctttgttggggccca	Protospacer
******************** ************

42. spacer 8.1|2348509|31|CP029673|CRISPRCasFinder matches to position: 835896-835926, mismatch: 1, identity: 0.968

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgtcagct	Protospacer
***********************.*******

43. spacer 8.1|2348509|31|CP029673|CRISPRCasFinder matches to position: 835952-835982, mismatch: 1, identity: 0.968

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgtcagct	Protospacer
***********************.*******

44. spacer 3.2|828702|23|CP029673|CRT matches to position: 1482991-1483013, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatacaat	Protospacer
**************.*** ****

45. spacer 3.2|828702|23|CP029673|CRT matches to position: 2098952-2098974, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgttgaaattgggaatccaat	Protospacer
***** ********.********

46. spacer 3.4|828819|23|CP029673|CRT matches to position: 1482991-1483013, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatacaat	Protospacer
**************.*** ****

47. spacer 3.4|828819|23|CP029673|CRT matches to position: 2098952-2098974, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgttgaaattgggaatccaat	Protospacer
***** ********.********

48. spacer 8.1|2348509|31|CP029673|CRISPRCasFinder matches to position: 88408-88438, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

49. spacer 8.1|2348509|31|CP029673|CRISPRCasFinder matches to position: 388117-388147, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

50. spacer 8.1|2348509|31|CP029673|CRISPRCasFinder matches to position: 655335-655365, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

51. spacer 8.1|2348509|31|CP029673|CRISPRCasFinder matches to position: 836008-836038, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

52. spacer 8.1|2348509|31|CP029673|CRISPRCasFinder matches to position: 872130-872160, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

53. spacer 8.1|2348509|31|CP029673|CRISPRCasFinder matches to position: 1038094-1038124, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

54. spacer 8.1|2348509|31|CP029673|CRISPRCasFinder matches to position: 1185477-1185507, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

55. spacer 8.1|2348509|31|CP029673|CRISPRCasFinder matches to position: 1393094-1393124, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

56. spacer 8.1|2348509|31|CP029673|CRISPRCasFinder matches to position: 1483044-1483074, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

57. spacer 8.1|2348509|31|CP029673|CRISPRCasFinder matches to position: 1679159-1679189, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

58. spacer 8.1|2348509|31|CP029673|CRISPRCasFinder matches to position: 1995057-1995087, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

59. spacer 8.1|2348509|31|CP029673|CRISPRCasFinder matches to position: 2337708-2337738, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

60. spacer 8.1|2348509|31|CP029673|CRISPRCasFinder matches to position: 2513058-2513088, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029673_3 3.2|828702|23|CP029673|CRT 828702-828724 23 AP014226 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS *** 28490-28512 3 0.87
CP029673_3 3.2|828702|23|CP029673|CRT 828702-828724 23 AP014225 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS *** 24653-24675 3 0.87
CP029673_3 3.4|828819|23|CP029673|CRT 828819-828841 23 AP014226 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS *** 28490-28512 3 0.87
CP029673_3 3.4|828819|23|CP029673|CRT 828819-828841 23 AP014225 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS *** 24653-24675 3 0.87
CP029673_7 7.1|2240468|34|CP029673|CRISPRCasFinder 2240468-2240501 34 JN882286 Cronobacter phage vB_CsaP_GAP52, complete genome 23034-23067 8 0.765
CP029673_7 7.1|2240468|34|CP029673|CRISPRCasFinder 2240468-2240501 34 CP030544 Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence 7567-7600 8 0.765

1. spacer 3.2|828702|23|CP029673|CRT matches to AP014226 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

2. spacer 3.2|828702|23|CP029673|CRT matches to AP014225 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

3. spacer 3.4|828819|23|CP029673|CRT matches to AP014226 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

4. spacer 3.4|828819|23|CP029673|CRT matches to AP014225 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

5. spacer 7.1|2240468|34|CP029673|CRISPRCasFinder matches to JN882286 (Cronobacter phage vB_CsaP_GAP52, complete genome) position: , mismatch: 8, identity: 0.765

ttgcatatctttagctttattgtttgcaactggg	CRISPR spacer
ttgcatatctttagctttatagcttttatatgct	Protospacer
******************** *.** .*  **  

6. spacer 7.1|2240468|34|CP029673|CRISPRCasFinder matches to CP030544 (Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.765

ttgcatatctttagctttattgtttgcaactggg	CRISPR spacer
ttgaataactttagctttattgttataaacagta	Protospacer
*** *** ****************   *** * .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 760382 : 768203 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_2 780174 : 794759 12 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_3 1039667 : 1048077 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_4 1101403 : 1147293 67 Staphylococcus_phage(73.44%) holin,portal,tail,capsid,terminase,head NA
DBSCAN-SWA_5 1241093 : 1296202 51 Prochlorococcus_phage(16.67%) tRNA,protease,transposase NA
DBSCAN-SWA_6 1714164 : 1723207 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_7 1843946 : 1960514 111 Staphylococcus_phage(86.67%) integrase,tRNA,protease,transposase attL 1861623:1861639|attR 1910960:1910976
DBSCAN-SWA_8 2049464 : 2097049 68 Staphylococcus_phage(98.48%) holin,portal,tail,capsid,integrase,head,protease attL 2070215:2070232|attR 2095033:2095050
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage