Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029656 Staphylococcus aureus strain AR_0468 plasmid unnamed1, complete sequence 0 crisprs csa3 0 0 0 0
CP029657 Staphylococcus aureus strain AR_0468 chromosome, complete genome 10 crisprs cas3,DEDDh,DinG,csa3,RT,WYL 10 3 10 0

Results visualization

1. CP029657
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029657_1 425149-425250 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029657_2 778649-778731 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029657_3 819596-819674 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029657_4 825051-825320 Unclear NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029657_5 832365-832444 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029657_6 868278-868359 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029657_7 1702915-1702999 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029657_8 1737390-1737470 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029657_9 2137141-2137222 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029657_10 2266397-2266477 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP029657_4 4.1|825087|22|CP029657|CRT 825087-825108 22 CP029657.1 187037-187058 0 1.0
CP029657_4 4.1|825087|22|CP029657|CRT 825087-825108 22 CP029657.1 310113-310134 0 1.0
CP029657_4 4.1|825087|22|CP029657|CRT 825087-825108 22 CP029657.1 653182-653203 0 1.0
CP029657_4 4.1|825087|22|CP029657|CRT 825087-825108 22 CP029657.1 777690-777711 0 1.0
CP029657_4 4.1|825087|22|CP029657|CRT 825087-825108 22 CP029657.1 868351-868372 0 1.0
CP029657_4 4.1|825087|22|CP029657|CRT 825087-825108 22 CP029657.1 1387219-1387240 0 1.0
CP029657_4 4.1|825087|22|CP029657|CRT 825087-825108 22 CP029657.1 1475772-1475793 0 1.0
CP029657_4 4.1|825087|22|CP029657|CRT 825087-825108 22 CP029657.1 1702991-1703012 0 1.0
CP029657_4 4.1|825087|22|CP029657|CRT 825087-825108 22 CP029657.1 1717525-1717546 0 1.0
CP029657_4 4.1|825087|22|CP029657|CRT 825087-825108 22 CP029657.1 2036258-2036279 0 1.0
CP029657_4 4.3|825204|22|CP029657|CRT 825204-825225 22 CP029657.1 187037-187058 0 1.0
CP029657_4 4.3|825204|22|CP029657|CRT 825204-825225 22 CP029657.1 310113-310134 0 1.0
CP029657_4 4.3|825204|22|CP029657|CRT 825204-825225 22 CP029657.1 653182-653203 0 1.0
CP029657_4 4.3|825204|22|CP029657|CRT 825204-825225 22 CP029657.1 777690-777711 0 1.0
CP029657_4 4.3|825204|22|CP029657|CRT 825204-825225 22 CP029657.1 868351-868372 0 1.0
CP029657_4 4.3|825204|22|CP029657|CRT 825204-825225 22 CP029657.1 1387219-1387240 0 1.0
CP029657_4 4.3|825204|22|CP029657|CRT 825204-825225 22 CP029657.1 1475772-1475793 0 1.0
CP029657_4 4.3|825204|22|CP029657|CRT 825204-825225 22 CP029657.1 1702991-1703012 0 1.0
CP029657_4 4.3|825204|22|CP029657|CRT 825204-825225 22 CP029657.1 1717525-1717546 0 1.0
CP029657_4 4.3|825204|22|CP029657|CRT 825204-825225 22 CP029657.1 2036258-2036279 0 1.0
CP029657_5 5.1|832389|32|CP029657|CRISPRCasFinder 832389-832420 32 CP029657.1 88402-88433 0 1.0
CP029657_5 5.1|832389|32|CP029657|CRISPRCasFinder 832389-832420 32 CP029657.1 868608-868639 0 1.0
CP029657_5 5.1|832389|32|CP029657|CRISPRCasFinder 832389-832420 32 CP029657.1 1717584-1717615 0 1.0
CP029657_5 5.1|832389|32|CP029657|CRISPRCasFinder 832389-832420 32 CP029657.1 2161217-2161248 0 1.0
CP029657_5 5.1|832389|32|CP029657|CRISPRCasFinder 832389-832420 32 CP029657.1 2596095-2596126 0 1.0
CP029657_9 9.1|2137165|34|CP029657|CRISPRCasFinder 2137165-2137198 34 CP029657.1 819595-819628 0 1.0
CP029657_9 9.1|2137165|34|CP029657|CRISPRCasFinder 2137165-2137198 34 CP029657.1 1175596-1175629 0 1.0
CP029657_4 4.1|825087|22|CP029657|CRT 825087-825108 22 CP029657.1 982671-982692 1 0.955
CP029657_4 4.1|825087|22|CP029657|CRT 825087-825108 22 CP029657.1 1737252-1737273 1 0.955
CP029657_4 4.2|825145|23|CP029657|CRT 825145-825167 23 CP029657.1 778640-778662 1 0.957
CP029657_4 4.2|825145|23|CP029657|CRT 825145-825167 23 CP029657.1 778918-778940 1 0.957
CP029657_4 4.2|825145|23|CP029657|CRT 825145-825167 23 CP029657.1 1387335-1387357 1 0.957
CP029657_4 4.2|825145|23|CP029657|CRT 825145-825167 23 CP029657.1 2036316-2036338 1 0.957
CP029657_4 4.2|825145|23|CP029657|CRT 825145-825167 23 CP029657.1 2420477-2420499 1 0.957
CP029657_4 4.3|825204|22|CP029657|CRT 825204-825225 22 CP029657.1 982671-982692 1 0.955
CP029657_4 4.3|825204|22|CP029657|CRT 825204-825225 22 CP029657.1 1737252-1737273 1 0.955
CP029657_4 4.4|825262|23|CP029657|CRT 825262-825284 23 CP029657.1 778640-778662 1 0.957
CP029657_4 4.4|825262|23|CP029657|CRT 825262-825284 23 CP029657.1 778918-778940 1 0.957
CP029657_4 4.4|825262|23|CP029657|CRT 825262-825284 23 CP029657.1 1387335-1387357 1 0.957
CP029657_4 4.4|825262|23|CP029657|CRT 825262-825284 23 CP029657.1 2036316-2036338 1 0.957
CP029657_4 4.4|825262|23|CP029657|CRT 825262-825284 23 CP029657.1 2420477-2420499 1 0.957
CP029657_5 5.1|832389|32|CP029657|CRISPRCasFinder 832389-832420 32 CP029657.1 1387393-1387424 1 0.969
CP029657_6 6.1|868302|34|CP029657|CRISPRCasFinder 868302-868335 34 CP029657.1 1387315-1387348 1 0.971
CP029657_7 7.1|1702941|33|CP029657|CRISPRCasFinder 1702941-1702973 33 CP029657.1 1387316-1387348 1 0.97
CP029657_9 9.1|2137165|34|CP029657|CRISPRCasFinder 2137165-2137198 34 CP029657.1 1829569-1829602 1 0.971
CP029657_12 12.1|2431273|31|CP029657|CRISPRCasFinder 2431273-2431303 31 CP029657.1 832339-832369 1 0.968
CP029657_4 4.2|825145|23|CP029657|CRT 825145-825167 23 CP029657.1 1475655-1475677 2 0.913
CP029657_4 4.2|825145|23|CP029657|CRT 825145-825167 23 CP029657.1 2137222-2137244 2 0.913
CP029657_4 4.4|825262|23|CP029657|CRT 825262-825284 23 CP029657.1 1475655-1475677 2 0.913
CP029657_4 4.4|825262|23|CP029657|CRT 825262-825284 23 CP029657.1 2137222-2137244 2 0.913
CP029657_8 8.1|1737413|35|CP029657|CRISPRCasFinder 1737413-1737447 35 CP029657.1 868335-868369 2 0.943
CP029657_8 8.1|1737413|35|CP029657|CRISPRCasFinder 1737413-1737447 35 CP029657.1 1737236-1737270 2 0.943
CP029657_9 9.1|2137165|34|CP029657|CRISPRCasFinder 2137165-2137198 34 CP029657.1 1391689-1391722 2 0.941
CP029657_9 9.1|2137165|34|CP029657|CRISPRCasFinder 2137165-2137198 34 CP029657.1 2870063-2870096 2 0.941
CP029657_12 12.1|2431273|31|CP029657|CRISPRCasFinder 2431273-2431303 31 CP029657.1 88408-88438 2 0.935
CP029657_12 12.1|2431273|31|CP029657|CRISPRCasFinder 2431273-2431303 31 CP029657.1 386411-386441 2 0.935
CP029657_12 12.1|2431273|31|CP029657|CRISPRCasFinder 2431273-2431303 31 CP029657.1 653237-653267 2 0.935
CP029657_12 12.1|2431273|31|CP029657|CRISPRCasFinder 2431273-2431303 31 CP029657.1 868614-868644 2 0.935
CP029657_12 12.1|2431273|31|CP029657|CRISPRCasFinder 2431273-2431303 31 CP029657.1 1078669-1078699 2 0.935
CP029657_12 12.1|2431273|31|CP029657|CRISPRCasFinder 2431273-2431303 31 CP029657.1 1181197-1181227 2 0.935
CP029657_12 12.1|2431273|31|CP029657|CRISPRCasFinder 2431273-2431303 31 CP029657.1 1387274-1387304 2 0.935
CP029657_12 12.1|2431273|31|CP029657|CRISPRCasFinder 2431273-2431303 31 CP029657.1 1475708-1475738 2 0.935
CP029657_12 12.1|2431273|31|CP029657|CRISPRCasFinder 2431273-2431303 31 CP029657.1 1475824-1475854 2 0.935
CP029657_12 12.1|2431273|31|CP029657|CRISPRCasFinder 2431273-2431303 31 CP029657.1 1717579-1717609 2 0.935
CP029657_12 12.1|2431273|31|CP029657|CRISPRCasFinder 2431273-2431303 31 CP029657.1 2034910-2034940 2 0.935
CP029657_12 12.1|2431273|31|CP029657|CRISPRCasFinder 2431273-2431303 31 CP029657.1 2596101-2596131 2 0.935

1. spacer 4.1|825087|22|CP029657|CRT matches to position: 187037-187058, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

2. spacer 4.1|825087|22|CP029657|CRT matches to position: 310113-310134, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

3. spacer 4.1|825087|22|CP029657|CRT matches to position: 653182-653203, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

4. spacer 4.1|825087|22|CP029657|CRT matches to position: 777690-777711, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

5. spacer 4.1|825087|22|CP029657|CRT matches to position: 868351-868372, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

6. spacer 4.1|825087|22|CP029657|CRT matches to position: 1387219-1387240, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

7. spacer 4.1|825087|22|CP029657|CRT matches to position: 1475772-1475793, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

8. spacer 4.1|825087|22|CP029657|CRT matches to position: 1702991-1703012, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

9. spacer 4.1|825087|22|CP029657|CRT matches to position: 1717525-1717546, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

10. spacer 4.1|825087|22|CP029657|CRT matches to position: 2036258-2036279, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

11. spacer 4.3|825204|22|CP029657|CRT matches to position: 187037-187058, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

12. spacer 4.3|825204|22|CP029657|CRT matches to position: 310113-310134, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

13. spacer 4.3|825204|22|CP029657|CRT matches to position: 653182-653203, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

14. spacer 4.3|825204|22|CP029657|CRT matches to position: 777690-777711, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

15. spacer 4.3|825204|22|CP029657|CRT matches to position: 868351-868372, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

16. spacer 4.3|825204|22|CP029657|CRT matches to position: 1387219-1387240, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

17. spacer 4.3|825204|22|CP029657|CRT matches to position: 1475772-1475793, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

18. spacer 4.3|825204|22|CP029657|CRT matches to position: 1702991-1703012, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

19. spacer 4.3|825204|22|CP029657|CRT matches to position: 1717525-1717546, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

20. spacer 4.3|825204|22|CP029657|CRT matches to position: 2036258-2036279, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

21. spacer 5.1|832389|32|CP029657|CRISPRCasFinder matches to position: 88402-88433, mismatch: 0, identity: 1.0

aacttgcacattattgtaagctgactttccgc	CRISPR spacer
aacttgcacattattgtaagctgactttccgc	Protospacer
********************************

22. spacer 5.1|832389|32|CP029657|CRISPRCasFinder matches to position: 868608-868639, mismatch: 0, identity: 1.0

aacttgcacattattgtaagctgactttccgc	CRISPR spacer
aacttgcacattattgtaagctgactttccgc	Protospacer
********************************

23. spacer 5.1|832389|32|CP029657|CRISPRCasFinder matches to position: 1717584-1717615, mismatch: 0, identity: 1.0

aacttgcacattattgtaagctgactttccgc	CRISPR spacer
aacttgcacattattgtaagctgactttccgc	Protospacer
********************************

24. spacer 5.1|832389|32|CP029657|CRISPRCasFinder matches to position: 2161217-2161248, mismatch: 0, identity: 1.0

aacttgcacattattgtaagctgactttccgc	CRISPR spacer
aacttgcacattattgtaagctgactttccgc	Protospacer
********************************

25. spacer 5.1|832389|32|CP029657|CRISPRCasFinder matches to position: 2596095-2596126, mismatch: 0, identity: 1.0

aacttgcacattattgtaagctgactttccgc	CRISPR spacer
aacttgcacattattgtaagctgactttccgc	Protospacer
********************************

26. spacer 9.1|2137165|34|CP029657|CRISPRCasFinder matches to position: 819595-819628, mismatch: 0, identity: 1.0

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctctgtgttgg	Protospacer
**********************************

27. spacer 9.1|2137165|34|CP029657|CRISPRCasFinder matches to position: 1175596-1175629, mismatch: 0, identity: 1.0

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctctgtgttgg	Protospacer
**********************************

28. spacer 4.1|825087|22|CP029657|CRT matches to position: 982671-982692, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttagaaa	Protospacer
***************** ****

29. spacer 4.1|825087|22|CP029657|CRT matches to position: 1737252-1737273, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

30. spacer 4.2|825145|23|CP029657|CRT matches to position: 778640-778662, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

31. spacer 4.2|825145|23|CP029657|CRT matches to position: 778918-778940, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

32. spacer 4.2|825145|23|CP029657|CRT matches to position: 1387335-1387357, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

33. spacer 4.2|825145|23|CP029657|CRT matches to position: 2036316-2036338, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

34. spacer 4.2|825145|23|CP029657|CRT matches to position: 2420477-2420499, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

35. spacer 4.3|825204|22|CP029657|CRT matches to position: 982671-982692, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttagaaa	Protospacer
***************** ****

36. spacer 4.3|825204|22|CP029657|CRT matches to position: 1737252-1737273, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

37. spacer 4.4|825262|23|CP029657|CRT matches to position: 778640-778662, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

38. spacer 4.4|825262|23|CP029657|CRT matches to position: 778918-778940, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

39. spacer 4.4|825262|23|CP029657|CRT matches to position: 1387335-1387357, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

40. spacer 4.4|825262|23|CP029657|CRT matches to position: 2036316-2036338, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

41. spacer 4.4|825262|23|CP029657|CRT matches to position: 2420477-2420499, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

42. spacer 5.1|832389|32|CP029657|CRISPRCasFinder matches to position: 1387393-1387424, mismatch: 1, identity: 0.969

aacttgcacattattgtaagctgactttccgc	CRISPR spacer
aacttgcacattattgtaaactgactttccgc	Protospacer
*******************.************

43. spacer 6.1|868302|34|CP029657|CRISPRCasFinder matches to position: 1387315-1387348, mismatch: 1, identity: 0.971

attgagaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
****.*****************************

44. spacer 7.1|1702941|33|CP029657|CRISPRCasFinder matches to position: 1387316-1387348, mismatch: 1, identity: 0.97

attgggaatccaatttctctgtgttggggccca	CRISPR spacer
attgggaatccaatttctctttgttggggccca	Protospacer
******************** ************

45. spacer 9.1|2137165|34|CP029657|CRISPRCasFinder matches to position: 1829569-1829602, mismatch: 1, identity: 0.971

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctttgtgttgg	Protospacer
*************************.********

46. spacer 12.1|2431273|31|CP029657|CRISPRCasFinder matches to position: 832339-832369, mismatch: 1, identity: 0.968

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgtcagct	Protospacer
***********************.*******

47. spacer 4.2|825145|23|CP029657|CRT matches to position: 1475655-1475677, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatacaat	Protospacer
**************.*** ****

48. spacer 4.2|825145|23|CP029657|CRT matches to position: 2137222-2137244, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgttgaaattgggaatccaat	Protospacer
***** ********.********

49. spacer 4.4|825262|23|CP029657|CRT matches to position: 1475655-1475677, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatacaat	Protospacer
**************.*** ****

50. spacer 4.4|825262|23|CP029657|CRT matches to position: 2137222-2137244, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgttgaaattgggaatccaat	Protospacer
***** ********.********

51. spacer 8.1|1737413|35|CP029657|CRISPRCasFinder matches to position: 868335-868369, mismatch: 2, identity: 0.943

tccccaacttccattgcctgtagaatttctttacg	CRISPR spacer
tccccaacttgcattgcctgtagaatttcttttcg	Protospacer
********** ********************* **

52. spacer 8.1|1737413|35|CP029657|CRISPRCasFinder matches to position: 1737236-1737270, mismatch: 2, identity: 0.943

tccccaacttccattgcctgtagaatttctttacg	CRISPR spacer
tccccaactggcattgcctgtagaatttctttacg	Protospacer
*********  ************************

53. spacer 9.1|2137165|34|CP029657|CRISPRCasFinder matches to position: 1391689-1391722, mismatch: 2, identity: 0.941

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtggaatttcttatcgaaattctctgtgttgg	Protospacer
****.********* *******************

54. spacer 9.1|2137165|34|CP029657|CRISPRCasFinder matches to position: 2870063-2870096, mismatch: 2, identity: 0.941

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctttttgttgg	Protospacer
*************************.* ******

55. spacer 12.1|2431273|31|CP029657|CRISPRCasFinder matches to position: 88408-88438, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

56. spacer 12.1|2431273|31|CP029657|CRISPRCasFinder matches to position: 386411-386441, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

57. spacer 12.1|2431273|31|CP029657|CRISPRCasFinder matches to position: 653237-653267, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

58. spacer 12.1|2431273|31|CP029657|CRISPRCasFinder matches to position: 868614-868644, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

59. spacer 12.1|2431273|31|CP029657|CRISPRCasFinder matches to position: 1078669-1078699, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

60. spacer 12.1|2431273|31|CP029657|CRISPRCasFinder matches to position: 1181197-1181227, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

61. spacer 12.1|2431273|31|CP029657|CRISPRCasFinder matches to position: 1387274-1387304, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

62. spacer 12.1|2431273|31|CP029657|CRISPRCasFinder matches to position: 1475708-1475738, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

63. spacer 12.1|2431273|31|CP029657|CRISPRCasFinder matches to position: 1475824-1475854, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

64. spacer 12.1|2431273|31|CP029657|CRISPRCasFinder matches to position: 1717579-1717609, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

65. spacer 12.1|2431273|31|CP029657|CRISPRCasFinder matches to position: 2034910-2034940, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

66. spacer 12.1|2431273|31|CP029657|CRISPRCasFinder matches to position: 2596101-2596131, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029657_4 4.2|825145|23|CP029657|CRT 825145-825167 23 AP014226 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS *** 28490-28512 3 0.87
CP029657_4 4.2|825145|23|CP029657|CRT 825145-825167 23 AP014225 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS *** 24653-24675 3 0.87
CP029657_4 4.4|825262|23|CP029657|CRT 825262-825284 23 AP014226 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS *** 28490-28512 3 0.87
CP029657_4 4.4|825262|23|CP029657|CRT 825262-825284 23 AP014225 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS *** 24653-24675 3 0.87
CP029657_11 11.1|2278746|34|CP029657|CRISPRCasFinder 2278746-2278779 34 JN882286 Cronobacter phage vB_CsaP_GAP52, complete genome 23034-23067 8 0.765
CP029657_11 11.1|2278746|34|CP029657|CRISPRCasFinder 2278746-2278779 34 CP030544 Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence 7567-7600 8 0.765

1. spacer 4.2|825145|23|CP029657|CRT matches to AP014226 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

2. spacer 4.2|825145|23|CP029657|CRT matches to AP014225 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

3. spacer 4.4|825262|23|CP029657|CRT matches to AP014226 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

4. spacer 4.4|825262|23|CP029657|CRT matches to AP014225 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

5. spacer 11.1|2278746|34|CP029657|CRISPRCasFinder matches to JN882286 (Cronobacter phage vB_CsaP_GAP52, complete genome) position: , mismatch: 8, identity: 0.765

ttgcatatctttagctttattgtttgcaactggg	CRISPR spacer
ttgcatatctttagctttatagcttttatatgct	Protospacer
******************** *.** .*  **  

6. spacer 11.1|2278746|34|CP029657|CRISPRCasFinder matches to CP030544 (Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.765

ttgcatatctttagctttattgtttgcaactggg	CRISPR spacer
ttgaataactttagctttattgttataaacagta	Protospacer
*** *** ****************   *** * .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12282 : 69054 53 Bacillus_phage(28.57%) integrase,transposase,tRNA attL 10522:10538|attR 73053:73069
DBSCAN-SWA_2 756768 : 764589 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_3 776560 : 791201 12 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_4 876689 : 933611 79 Staphylococcus_phage(76.47%) portal,head,capsid,transposase,holin,terminase,tail,integrase attL 874777:874793|attR 909431:909447
DBSCAN-SWA_5 1080242 : 1088652 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 1530103 : 1617627 104 Staphylococcus_phage(78.21%) portal,head,capsid,holin,integrase,terminase,tail,tRNA attL 1569127:1569144|attR 1616144:1616161
DBSCAN-SWA_7 1752528 : 1761571 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_8 1877415 : 2000366 116 Staphylococcus_phage(86.67%) protease,transposase,integrase,tRNA attL 1905507:1905566|attR 2000381:2001893
DBSCAN-SWA_9 2089317 : 2135261 66 Staphylococcus_phage(95.45%) portal,head,capsid,protease,holin,tail,integrase attL 2108748:2108765|attR 2133245:2133262
DBSCAN-SWA_10 2322990 : 2368272 64 Staphylococcus_phage(92.19%) portal,head,capsid,holin,terminase,tail,integrase attL 2328581:2328596|attR 2370039:2370054
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage