Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP028483 Escherichia coli strain E41-1 chromosome, complete genome 3 crisprs c2c9_V-U4,csa3,cas3,DEDDh,RT,DinG 0 4 9 0
CP028485 Escherichia coli strain E41-1 plasmid p2, complete sequence 0 crisprs NA 0 0 0 0
CP028484 Escherichia coli strain E41-1 plasmid p1, complete sequence 0 crisprs RT 0 0 2 0
CP028486 Escherichia coli strain E41-1 plasmid p3, complete sequence 0 crisprs RT 0 0 0 0

Results visualization

1. CP028483
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028483_1 2345019-2345142 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028483_3 3223300-3223382 Orphan I-F
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028483_4 4111572-4111704 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP028483_4 4.1|4111589|42|CP028483|PILER-CR 4111589-4111630 42 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141085-141126 1 0.976
CP028483_1 1.1|2345062|38|CP028483|CRISPRCasFinder 2345062-2345099 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP028483_2 2.1|3023340|40|CP028483|CRISPRCasFinder 3023340-3023379 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 2 0.95
CP028483_4 4.2|4111648|40|CP028483|PILER-CR 4111648-4111687 40 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 141028-141067 2 0.95

1. spacer 4.1|4111589|42|CP028483|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.976

tgtcacacgcagataaatccaactttcaatattgttaagctc	CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc	Protospacer
***************************************.**

2. spacer 1.1|2345062|38|CP028483|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

3. spacer 2.1|3023340|40|CP028483|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 2, identity: 0.95

gcgctgcgggtcatttttgaaattacctccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
***************.***********.************

4. spacer 4.2|4111648|40|CP028483|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 2, identity: 0.95

catggcgtagcaaaaagaaattttcaatattgttttatgg	CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg	Protospacer
********** *********************.*******

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1773962 : 1783407 10 Enterobacteria_phage(85.71%) NA NA
DBSCAN-SWA_2 1877583 : 1883886 6 Enterobacteria_phage(66.67%) NA NA
DBSCAN-SWA_3 1906982 : 1940011 40 Stx2-converting_phage(21.43%) transposase NA
DBSCAN-SWA_4 2066474 : 2148984 98 Pectobacterium_phage(23.81%) tail,terminase,integrase,portal,capsid,tRNA,plate,head,holin attL 2066289:2066348|attR 2108901:2109025
DBSCAN-SWA_5 2646640 : 2717475 85 Enterobacteria_phage(26.67%) transposase,terminase,portal,capsid,protease,holin,head,lysis,tail NA
DBSCAN-SWA_6 2856855 : 2902564 60 Enterobacteria_phage(56.0%) terminase,integrase,portal,capsid,tRNA,holin,head,tail attL 2875639:2875653|attR 2904233:2904247
DBSCAN-SWA_7 3099672 : 3226221 146 Enterobacteria_phage(42.42%) transposase,plate,terminase,integrase,portal,capsid,protease,holin,tRNA,head,tail attL 3169600:3169619|attR 3208257:3208276
DBSCAN-SWA_8 3983044 : 4026180 43 Salmonella_phage(25.0%) transposase,bacteriocin,tRNA NA
DBSCAN-SWA_9 4282061 : 4328943 49 Stx2-converting_phage(23.08%) transposase,holin NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP028484
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 889 : 29122 36 Escherichia_phage(44.44%) protease,transposase NA
DBSCAN-SWA_2 57685 : 108635 51 Escherichia_phage(33.33%) integrase,transposase attL 83763:83779|attR 101545:101561
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage