Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029667 Staphylococcus aureus strain AR_0225 chromosome, complete genome 10 crisprs csa3,DEDDh,cas3,DinG 12 6 12 1
CP029666 Staphylococcus aureus strain AR_0225 plasmid unnamed1, complete sequence 0 crisprs WYL,csa3 0 0 1 0

Results visualization

1. CP029667
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029667_1 423466-423659 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029667_2 547399-547549 Orphan NA
2 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029667_3 782359-782437 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029667_4 1891712-1892020 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029667_5 1940768-1940849 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029667_6 1984036-1984121 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029667_7 1989439-1989519 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029667_8 2159794-2159886 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029667_9 2404086-2404187 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029667_10 2880104-2880277 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP029667_1 1.2|423545|36|CP029667|CRT 423545-423580 36 CP029667.1 1674012-1674047 0 1.0
CP029667_5 5.1|1940792|34|CP029667|CRISPRCasFinder 1940792-1940825 34 CP029667.1 1376576-1376609 0 1.0
CP029667_5 5.1|1940792|34|CP029667|CRISPRCasFinder 1940792-1940825 34 CP029667.1 1465768-1465801 0 1.0
CP029667_10 10.1|2880157|17|CP029667|PILER-CR 2880157-2880173 17 CP029667.1 2524583-2524599 0 1.0
CP029667_10 10.2|2880227|16|CP029667|PILER-CR 2880227-2880242 16 CP029667.1 147720-147735 0 1.0
CP029667_10 10.2|2880227|16|CP029667|PILER-CR 2880227-2880242 16 CP029667.1 771536-771551 0 1.0
CP029667_10 10.2|2880227|16|CP029667|PILER-CR 2880227-2880242 16 CP029667.1 771594-771609 0 1.0
CP029667_10 10.2|2880227|16|CP029667|PILER-CR 2880227-2880242 16 CP029667.1 1376548-1376563 0 1.0
CP029667_10 10.2|2880227|16|CP029667|PILER-CR 2880227-2880242 16 CP029667.1 1461417-1461432 0 1.0
CP029667_10 10.2|2880227|16|CP029667|PILER-CR 2880227-2880242 16 CP029667.1 1465814-1465829 0 1.0
CP029667_10 10.2|2880227|16|CP029667|PILER-CR 2880227-2880242 16 CP029667.1 1673959-1673974 0 1.0
CP029667_10 10.2|2880227|16|CP029667|PILER-CR 2880227-2880242 16 CP029667.1 1774587-1774602 0 1.0
CP029667_10 10.2|2880227|16|CP029667|PILER-CR 2880227-2880242 16 CP029667.1 1940495-1940510 0 1.0
CP029667_10 10.2|2880227|16|CP029667|PILER-CR 2880227-2880242 16 CP029667.1 2442808-2442823 0 1.0
CP029667_1 1.2|423545|36|CP029667|CRT 423545-423580 36 CP029667.1 981248-981283 1 0.972
CP029667_3 3.1|782382|33|CP029667|CRISPRCasFinder 782382-782414 33 CP029667.1 147703-147735 1 0.97
CP029667_3 3.1|782382|33|CP029667|CRISPRCasFinder 782382-782414 33 CP029667.1 1159701-1159733 1 0.97
CP029667_3 3.1|782382|33|CP029667|CRISPRCasFinder 782382-782414 33 CP029667.1 1465814-1465846 1 0.97
CP029667_3 3.1|782382|33|CP029667|CRISPRCasFinder 782382-782414 33 CP029667.1 1673959-1673991 1 0.97
CP029667_3 3.1|782382|33|CP029667|CRISPRCasFinder 782382-782414 33 CP029667.1 1984023-1984055 1 0.97
CP029667_4 4.2|1891825|26|CP029667|CRT 1891825-1891850 26 CP029667.1 1984010-1984035 1 0.962
CP029667_6 6.1|1984066|26|CP029667|CRISPRCasFinder 1984066-1984091 26 CP029667.1 2021074-2021099 1 0.962
CP029667_7 7.1|1989465|29|CP029667|CRISPRCasFinder 1989465-1989493 29 CP029667.1 981248-981276 1 0.966
CP029667_7 7.1|1989465|29|CP029667|CRISPRCasFinder 1989465-1989493 29 CP029667.1 2442636-2442664 1 0.966
CP029667_7 7.1|1989465|29|CP029667|CRISPRCasFinder 1989465-1989493 29 CP029667.1 2442691-2442719 1 0.966
CP029667_10 10.2|2880227|16|CP029667|PILER-CR 2880227-2880242 16 CP029667.1 334287-334302 1 0.938
CP029667_10 10.2|2880227|16|CP029667|PILER-CR 2880227-2880242 16 CP029667.1 981137-981152 1 0.938
CP029667_10 10.2|2880227|16|CP029667|PILER-CR 2880227-2880242 16 CP029667.1 1159718-1159733 1 0.938
CP029667_10 10.2|2880227|16|CP029667|PILER-CR 2880227-2880242 16 CP029667.1 1419761-1419776 1 0.938
CP029667_10 10.2|2880227|16|CP029667|PILER-CR 2880227-2880242 16 CP029667.1 1677927-1677942 1 0.938
CP029667_1 1.1|423489|33|CP029667|CRT 423489-423521 33 CP029667.1 147703-147735 2 0.939
CP029667_1 1.1|423489|33|CP029667|CRT 423489-423521 33 CP029667.1 1465814-1465846 2 0.939
CP029667_1 1.1|423489|33|CP029667|CRT 423489-423521 33 CP029667.1 1673959-1673991 2 0.939
CP029667_1 1.1|423489|33|CP029667|CRT 423489-423521 33 CP029667.1 1984023-1984055 2 0.939
CP029667_1 1.2|423545|36|CP029667|CRT 423545-423580 36 CP029667.1 771635-771670 2 0.944
CP029667_1 1.2|423545|36|CP029667|CRT 423545-423580 36 CP029667.1 1159759-1159794 2 0.944
CP029667_1 1.3|423604|33|CP029667|CRT 423604-423636 33 CP029667.1 147703-147735 2 0.939
CP029667_1 1.3|423604|33|CP029667|CRT 423604-423636 33 CP029667.1 1376531-1376563 2 0.939
CP029667_1 1.3|423604|33|CP029667|CRT 423604-423636 33 CP029667.1 1465814-1465846 2 0.939
CP029667_1 1.3|423604|33|CP029667|CRT 423604-423636 33 CP029667.1 1673959-1673991 2 0.939
CP029667_1 1.3|423604|33|CP029667|CRT 423604-423636 33 CP029667.1 1984023-1984055 2 0.939
CP029667_3 3.1|782382|33|CP029667|CRISPRCasFinder 782382-782414 33 CP029667.1 1376531-1376563 2 0.939
CP029667_4 4.2|1891825|26|CP029667|CRT 1891825-1891850 26 CP029667.1 2442828-2442853 2 0.923
CP029667_4 4.4|1891939|26|CP029667|CRT 1891939-1891964 26 CP029667.1 2021074-2021099 2 0.923
CP029667_4 4.5|1891965|33|CP029667|CRISPRCasFinder 1891965-1891997 33 CP029667.1 1940488-1940520 2 0.939
CP029667_6 6.1|1984066|26|CP029667|CRISPRCasFinder 1984066-1984091 26 CP029667.1 2021018-2021043 2 0.923
CP029667_7 7.1|1989465|29|CP029667|CRISPRCasFinder 1989465-1989493 29 CP029667.1 232121-232149 2 0.931
CP029667_7 7.1|1989465|29|CP029667|CRISPRCasFinder 1989465-1989493 29 CP029667.1 771642-771670 2 0.931
CP029667_7 7.1|1989465|29|CP029667|CRISPRCasFinder 1989465-1989493 29 CP029667.1 1159766-1159794 2 0.931
CP029667_7 7.1|1989465|29|CP029667|CRISPRCasFinder 1989465-1989493 29 CP029667.1 1674012-1674040 2 0.931
CP029667_7 7.1|1989465|29|CP029667|CRISPRCasFinder 1989465-1989493 29 CP029667.1 1872297-1872325 2 0.931
CP029667_7 7.1|1989465|29|CP029667|CRISPRCasFinder 1989465-1989493 29 CP029667.1 1940755-1940783 2 0.931

1. spacer 1.2|423545|36|CP029667|CRT matches to position: 1674012-1674047, mismatch: 0, identity: 1.0

tagagaatttcaaaaagaaattctacagacaatgca	CRISPR spacer
tagagaatttcaaaaagaaattctacagacaatgca	Protospacer
************************************

2. spacer 5.1|1940792|34|CP029667|CRISPRCasFinder matches to position: 1376576-1376609, mismatch: 0, identity: 1.0

atgggccccaacaaagagaaattggattcccaat	CRISPR spacer
atgggccccaacaaagagaaattggattcccaat	Protospacer
**********************************

3. spacer 5.1|1940792|34|CP029667|CRISPRCasFinder matches to position: 1465768-1465801, mismatch: 0, identity: 1.0

atgggccccaacaaagagaaattggattcccaat	CRISPR spacer
atgggccccaacaaagagaaattggattcccaat	Protospacer
**********************************

4. spacer 10.1|2880157|17|CP029667|PILER-CR matches to position: 2524583-2524599, mismatch: 0, identity: 1.0

aagaatttcgaaaagaa	CRISPR spacer
aagaatttcgaaaagaa	Protospacer
*****************

5. spacer 10.2|2880227|16|CP029667|PILER-CR matches to position: 147720-147735, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

6. spacer 10.2|2880227|16|CP029667|PILER-CR matches to position: 771536-771551, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

7. spacer 10.2|2880227|16|CP029667|PILER-CR matches to position: 771594-771609, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

8. spacer 10.2|2880227|16|CP029667|PILER-CR matches to position: 1376548-1376563, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

9. spacer 10.2|2880227|16|CP029667|PILER-CR matches to position: 1461417-1461432, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

10. spacer 10.2|2880227|16|CP029667|PILER-CR matches to position: 1465814-1465829, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

11. spacer 10.2|2880227|16|CP029667|PILER-CR matches to position: 1673959-1673974, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

12. spacer 10.2|2880227|16|CP029667|PILER-CR matches to position: 1774587-1774602, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

13. spacer 10.2|2880227|16|CP029667|PILER-CR matches to position: 1940495-1940510, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

14. spacer 10.2|2880227|16|CP029667|PILER-CR matches to position: 2442808-2442823, mismatch: 0, identity: 1.0

tcagcttacaataatg	CRISPR spacer
tcagcttacaataatg	Protospacer
****************

15. spacer 1.2|423545|36|CP029667|CRT matches to position: 981248-981283, mismatch: 1, identity: 0.972

tagagaatttcaaaaagaaattctacagacaatgca	CRISPR spacer
tagagaatttcgaaaagaaattctacagacaatgca	Protospacer
***********.************************

16. spacer 3.1|782382|33|CP029667|CRISPRCasFinder matches to position: 147703-147735, mismatch: 1, identity: 0.97

cagaagctgacgaaaagtcagcttacgataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
**************************.******

17. spacer 3.1|782382|33|CP029667|CRISPRCasFinder matches to position: 1159701-1159733, mismatch: 1, identity: 0.97

cagaagctgacgaaaagtcagcttacgataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttactataatg	Protospacer
************************** ******

18. spacer 3.1|782382|33|CP029667|CRISPRCasFinder matches to position: 1465814-1465846, mismatch: 1, identity: 0.97

cagaagctgacgaaaagtcagcttacgataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
**************************.******

19. spacer 3.1|782382|33|CP029667|CRISPRCasFinder matches to position: 1673959-1673991, mismatch: 1, identity: 0.97

cagaagctgacgaaaagtcagcttacgataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
**************************.******

20. spacer 3.1|782382|33|CP029667|CRISPRCasFinder matches to position: 1984023-1984055, mismatch: 1, identity: 0.97

cagaagctgacgaaaagtcagcttacgataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
**************************.******

21. spacer 4.2|1891825|26|CP029667|CRT matches to position: 1984010-1984035, mismatch: 1, identity: 0.962

tcgccagcttctgtgttggggccccg	CRISPR spacer
tcgtcagcttctgtgttggggccccg	Protospacer
***.**********************

22. spacer 6.1|1984066|26|CP029667|CRISPRCasFinder matches to position: 2021074-2021099, mismatch: 1, identity: 0.962

cggggccccaacacagaagctggcgg	CRISPR spacer
cggggccccaacacagaagcaggcgg	Protospacer
******************** *****

23. spacer 7.1|1989465|29|CP029667|CRISPRCasFinder matches to position: 981248-981276, mismatch: 1, identity: 0.966

tttcgaaaagaaattctacaaacaatgca	CRISPR spacer
tttcgaaaagaaattctacagacaatgca	Protospacer
********************.********

24. spacer 7.1|1989465|29|CP029667|CRISPRCasFinder matches to position: 2442636-2442664, mismatch: 1, identity: 0.966

tttcgaaaagaaattctacaaacaatgca	CRISPR spacer
tttcgaaaagaaattctacaagcaatgca	Protospacer
*********************.*******

25. spacer 7.1|1989465|29|CP029667|CRISPRCasFinder matches to position: 2442691-2442719, mismatch: 1, identity: 0.966

tttcgaaaagaaattctacaaacaatgca	CRISPR spacer
tttcgaaaagaaattctacaagcaatgca	Protospacer
*********************.*******

26. spacer 10.2|2880227|16|CP029667|PILER-CR matches to position: 334287-334302, mismatch: 1, identity: 0.938

tcagcttacaataatg	CRISPR spacer
tcagcttacaacaatg	Protospacer
***********.****

27. spacer 10.2|2880227|16|CP029667|PILER-CR matches to position: 981137-981152, mismatch: 1, identity: 0.938

tcagcttacaataatg	CRISPR spacer
tcagctttcaataatg	Protospacer
******* ********

28. spacer 10.2|2880227|16|CP029667|PILER-CR matches to position: 1159718-1159733, mismatch: 1, identity: 0.938

tcagcttacaataatg	CRISPR spacer
tcagcttactataatg	Protospacer
********* ******

29. spacer 10.2|2880227|16|CP029667|PILER-CR matches to position: 1419761-1419776, mismatch: 1, identity: 0.938

tcagcttacaataatg	CRISPR spacer
tcagcttacaacaatg	Protospacer
***********.****

30. spacer 10.2|2880227|16|CP029667|PILER-CR matches to position: 1677927-1677942, mismatch: 1, identity: 0.938

tcagcttacaataatg	CRISPR spacer
tcagcttacaaaaatg	Protospacer
*********** ****

31. spacer 1.1|423489|33|CP029667|CRT matches to position: 147703-147735, mismatch: 2, identity: 0.939

cagaagctgacagaaagtcagcttacaataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
***********..********************

32. spacer 1.1|423489|33|CP029667|CRT matches to position: 1465814-1465846, mismatch: 2, identity: 0.939

cagaagctgacagaaagtcagcttacaataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
***********..********************

33. spacer 1.1|423489|33|CP029667|CRT matches to position: 1673959-1673991, mismatch: 2, identity: 0.939

cagaagctgacagaaagtcagcttacaataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
***********..********************

34. spacer 1.1|423489|33|CP029667|CRT matches to position: 1984023-1984055, mismatch: 2, identity: 0.939

cagaagctgacagaaagtcagcttacaataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
***********..********************

35. spacer 1.2|423545|36|CP029667|CRT matches to position: 771635-771670, mismatch: 2, identity: 0.944

tagagaatttcaaaaagaaattctacagacaatgca	CRISPR spacer
tagagaatttcgaaaggaaattctacagacaatgca	Protospacer
***********.***.********************

36. spacer 1.2|423545|36|CP029667|CRT matches to position: 1159759-1159794, mismatch: 2, identity: 0.944

tagagaatttcaaaaagaaattctacagacaatgca	CRISPR spacer
tagagaatttcgaaaagaaattctacaggcaatgca	Protospacer
***********.****************.*******

37. spacer 1.3|423604|33|CP029667|CRT matches to position: 147703-147735, mismatch: 2, identity: 0.939

cagaaggtgacgaaaagtcagcatacaataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
****** *************** **********

38. spacer 1.3|423604|33|CP029667|CRT matches to position: 1376531-1376563, mismatch: 2, identity: 0.939

cagaaggtgacgaaaagtcagcatacaataatg	CRISPR spacer
cagaagatgacgaaaagtcagcttacaataatg	Protospacer
******.*************** **********

39. spacer 1.3|423604|33|CP029667|CRT matches to position: 1465814-1465846, mismatch: 2, identity: 0.939

cagaaggtgacgaaaagtcagcatacaataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
****** *************** **********

40. spacer 1.3|423604|33|CP029667|CRT matches to position: 1673959-1673991, mismatch: 2, identity: 0.939

cagaaggtgacgaaaagtcagcatacaataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
****** *************** **********

41. spacer 1.3|423604|33|CP029667|CRT matches to position: 1984023-1984055, mismatch: 2, identity: 0.939

cagaaggtgacgaaaagtcagcatacaataatg	CRISPR spacer
cagaagctgacgaaaagtcagcttacaataatg	Protospacer
****** *************** **********

42. spacer 3.1|782382|33|CP029667|CRISPRCasFinder matches to position: 1376531-1376563, mismatch: 2, identity: 0.939

cagaagctgacgaaaagtcagcttacgataatg	CRISPR spacer
cagaagatgacgaaaagtcagcttacaataatg	Protospacer
****** *******************.******

43. spacer 4.2|1891825|26|CP029667|CRT matches to position: 2442828-2442853, mismatch: 2, identity: 0.923

tcgccagcttctgtgttggggccccg	CRISPR spacer
tcgtcagcttctttgttggggccccg	Protospacer
***.******** *************

44. spacer 4.4|1891939|26|CP029667|CRT matches to position: 2021074-2021099, mismatch: 2, identity: 0.923

ccgccagcctctgtgttggggccccg	CRISPR spacer
ccgcctgcttctgtgttggggccccg	Protospacer
***** **.*****************

45. spacer 4.5|1891965|33|CP029667|CRISPRCasFinder matches to position: 1940488-1940520, mismatch: 2, identity: 0.939

ccaacttgcacactattgtaagctgactttcca	CRISPR spacer
ccaacttgcacattattgtaagctgacttacca	Protospacer
************.**************** ***

46. spacer 6.1|1984066|26|CP029667|CRISPRCasFinder matches to position: 2021018-2021043, mismatch: 2, identity: 0.923

cggggccccaacacagaagctggcgg	CRISPR spacer
cggggccccaacatagaagcaggcgg	Protospacer
*************.****** *****

47. spacer 7.1|1989465|29|CP029667|CRISPRCasFinder matches to position: 232121-232149, mismatch: 2, identity: 0.931

tttcgaaaagaaattctacaaacaatgca	CRISPR spacer
tttcgaaaagaaattctacaggcaatgca	Protospacer
********************..*******

48. spacer 7.1|1989465|29|CP029667|CRISPRCasFinder matches to position: 771642-771670, mismatch: 2, identity: 0.931

tttcgaaaagaaattctacaaacaatgca	CRISPR spacer
tttcgaaaggaaattctacagacaatgca	Protospacer
********.***********.********

49. spacer 7.1|1989465|29|CP029667|CRISPRCasFinder matches to position: 1159766-1159794, mismatch: 2, identity: 0.931

tttcgaaaagaaattctacaaacaatgca	CRISPR spacer
tttcgaaaagaaattctacaggcaatgca	Protospacer
********************..*******

50. spacer 7.1|1989465|29|CP029667|CRISPRCasFinder matches to position: 1674012-1674040, mismatch: 2, identity: 0.931

tttcgaaaagaaattctacaaacaatgca	CRISPR spacer
tttcaaaaagaaattctacagacaatgca	Protospacer
****.***************.********

51. spacer 7.1|1989465|29|CP029667|CRISPRCasFinder matches to position: 1872297-1872325, mismatch: 2, identity: 0.931

tttcgaaaagaaattctacaaacaatgca	CRISPR spacer
tttcgaaaagaaattctacaggcaatgca	Protospacer
********************..*******

52. spacer 7.1|1989465|29|CP029667|CRISPRCasFinder matches to position: 1940755-1940783, mismatch: 2, identity: 0.931

tttcgaaaagaaattctacaaacaatgca	CRISPR spacer
tttcgaaaagaaattctacaggcaatgca	Protospacer
********************..*******

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029667_4 4.1|1891742|53|CP029667|CRT 1891742-1891794 53 MG543995 Staphylococcus phage UPMK_1, partial genome 76246-76298 4 0.925
CP029667_4 4.2|1891825|26|CP029667|CRT 1891825-1891850 26 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 333735-333760 5 0.808
CP029667_6 6.1|1984066|26|CP029667|CRISPRCasFinder 1984066-1984091 26 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 333735-333760 5 0.808
CP029667_6 6.1|1984066|26|CP029667|CRISPRCasFinder 1984066-1984091 26 NZ_CP034332 Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence 3359-3384 5 0.808
CP029667_6 6.1|1984066|26|CP029667|CRISPRCasFinder 1984066-1984091 26 NZ_CP022605 Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence 715511-715536 5 0.808
CP029667_4 4.3|1891881|28|CP029667|CRT 1891881-1891908 28 NZ_AP022622 Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1 28222-28249 7 0.75
CP029667_4 4.3|1891881|28|CP029667|CRT 1891881-1891908 28 NC_021279 Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence 9720-9747 7 0.75
CP029667_7 7.1|1989465|29|CP029667|CRISPRCasFinder 1989465-1989493 29 MN693281 Marine virus AFVG_25M371, complete genome 6448-6476 7 0.759
CP029667_3 3.1|782382|33|CP029667|CRISPRCasFinder 782382-782414 33 NC_021536 Synechococcus phage S-IOM18 genomic sequence 159745-159777 10 0.697

1. spacer 4.1|1891742|53|CP029667|CRT matches to MG543995 (Staphylococcus phage UPMK_1, partial genome) position: , mismatch: 4, identity: 0.925

ttgggagtgggacagaaatgatattttcgcaaaatttatttcgtcgtcccacc	CRISPR spacer
aagggagtgggacagaaatgatagtttctcaaaatttatttcgtcgtcccacc	Protospacer
  ********************* **** ************************

2. spacer 4.2|1891825|26|CP029667|CRT matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 5, identity: 0.808

tcgccagcttctgtgttggggccccg	CRISPR spacer
acgccagcttctgtgttgaggcctta	Protospacer
 *****************.****...

3. spacer 6.1|1984066|26|CP029667|CRISPRCasFinder matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 5, identity: 0.808

cggggccccaacacagaagctggcgg	CRISPR spacer
taaggcctcaacacagaagctggcgt	Protospacer
...****.***************** 

4. spacer 6.1|1984066|26|CP029667|CRISPRCasFinder matches to NZ_CP034332 (Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.808

cggggccccaacacagaagctggcgg	CRISPR spacer
gtaggcccagacacagaagctggcgg	Protospacer
  .***** .****************

5. spacer 6.1|1984066|26|CP029667|CRISPRCasFinder matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

cggggccccaacacagaagctggcgg	CRISPR spacer
tcagggccaaacacagaagctggcgg	Protospacer
. .** ** *****************

6. spacer 4.3|1891881|28|CP029667|CRT matches to NZ_AP022622 (Mycobacteroides abscessus strain JCM 30620 plasmid pJCM30620_1) position: , mismatch: 7, identity: 0.75

gctaatttgtctgtgtcggggctccacc	CRISPR spacer
ctgaatttgccggtgtcggggctccaaa	Protospacer
 . ******.* **************  

7. spacer 4.3|1891881|28|CP029667|CRT matches to NC_021279 (Mycobacteroides abscessus subsp. bolletii 50594 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.75

gctaatttgtctgtgtcggggctccacc	CRISPR spacer
ctgaatttgccggtgtcggggctccaaa	Protospacer
 . ******.* **************  

8. spacer 7.1|1989465|29|CP029667|CRISPRCasFinder matches to MN693281 (Marine virus AFVG_25M371, complete genome) position: , mismatch: 7, identity: 0.759

tttcgaaaagaaattctacaaacaatgca	CRISPR spacer
cacttagaagaaatcctacaaacaatgca	Protospacer
. .. *.*******.**************

9. spacer 3.1|782382|33|CP029667|CRISPRCasFinder matches to NC_021536 (Synechococcus phage S-IOM18 genomic sequence) position: , mismatch: 10, identity: 0.697

cagaagctgacgaaaagtcagcttacgataatg	CRISPR spacer
aggtgcttgacgaaaactcaccttacgataaaa	Protospacer
 .* . .********* *** ********** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 669332 : 727572 76 Staphylococcus_phage(97.1%) protease,integrase,terminase,portal,capsid,holin,head,tail attL 683199:683216|attR 708131:708148
DBSCAN-SWA_2 789071 : 866827 90 Staphylococcus_phage(74.63%) protease,integrase,terminase,portal,transposase,capsid,holin,head,tail,tRNA attL 784227:784244|attR 811264:811281
DBSCAN-SWA_3 895378 : 976219 75 Staphylococcus_phage(89.23%) protease,transposase,bacteriocin,tRNA NA
DBSCAN-SWA_4 1101678 : 1110721 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_5 1179858 : 1188170 7 Caulobacter_phage(16.67%) NA NA
DBSCAN-SWA_6 1244004 : 1286899 61 Staphylococcus_phage(94.92%) integrase,terminase,portal,capsid,holin,tail attL 1248964:1248984|attR 1286565:1286585
DBSCAN-SWA_7 1316455 : 1408734 61 Staphylococcus_phage(20.0%) protease,lysis,transposase,head,tRNA NA
DBSCAN-SWA_8 1501869 : 1507913 10 Staphylococcus_phage(66.67%) head NA
DBSCAN-SWA_9 1764624 : 1773097 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_10 2017884 : 2032615 13 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_11 2044587 : 2052407 10 Pandoravirus(16.67%) NA NA
DBSCAN-SWA_12 2758319 : 2801833 49 Staphylococcus_phage(50.0%) integrase,transposase attL 2760763:2760822|attR 2801834:2801893
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
CP029667.1|AWR06787.1|1405951_1406260_+|hypothetical-protein 1405951_1406260_+ 102 aa aa NA NA NA 1316455-1408734 yes
2. CP029666
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7465 : 22558 18 Staphylococcus_phage(41.67%) transposase,integrase attL 16610:16665|attR 20619:20674
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage