Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029676 Staphylococcus aureus strain AR_0216 plasmid unnamed1, complete sequence 0 crisprs NA 0 0 0 0
CP029678 Staphylococcus aureus strain AR_0216 chromosome, complete genome 9 crisprs cas3,DEDDh,DinG,csa3,WYL 8 4 12 0
CP029677 Staphylococcus aureus strain AR_0216 plasmid unnamed2, complete sequence 0 crisprs csa3,WYL 0 0 1 0

Results visualization

1. CP029678
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029678_1 432086-432186 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029678_2 676423-676515 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029678_3 852233-852318 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029678_4 895562-895643 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029678_5 1002131-1002413 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029678_6 1135803-1135890 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029678_7 2077819-2077897 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029678_8 2312770-2312920 Orphan NA
2 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029678_9 2436688-2436881 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP029678_4 4.1|895586|34|CP029678|CRISPRCasFinder 895586-895619 34 CP029678.1 1428310-1428343 0 1.0
CP029678_4 4.1|895586|34|CP029678|CRISPRCasFinder 895586-895619 34 CP029678.1 1517501-1517534 0 1.0
CP029678_9 9.2|2436767|36|CP029678|CRT 2436767-2436802 36 CP029678.1 1220078-1220113 0 1.0
CP029678_3 3.1|852263|26|CP029678|CRISPRCasFinder 852263-852288 26 CP029678.1 815200-815225 1 0.962
CP029678_3 3.1|852263|26|CP029678|CRISPRCasFinder 852263-852288 26 CP029678.1 2877996-2878021 1 0.962
CP029678_3 3.1|852263|26|CP029678|CRISPRCasFinder 852263-852288 26 CP029678.1 2878052-2878077 1 0.962
CP029678_5 5.1|1002161|26|CP029678|CRT 1002161-1002186 26 CP029678.1 1002105-1002130 1 0.962
CP029678_5 5.3|1002275|26|CP029678|CRT 1002275-1002300 26 CP029678.1 852319-852344 1 0.962
CP029678_7 7.1|2077842|33|CP029678|CRISPRCasFinder 2077842-2077874 33 CP029678.1 852299-852331 1 0.97
CP029678_7 7.1|2077842|33|CP029678|CRISPRCasFinder 2077842-2077874 33 CP029678.1 1220134-1220166 1 0.97
CP029678_7 7.1|2077842|33|CP029678|CRISPRCasFinder 2077842-2077874 33 CP029678.1 1428265-1428297 1 0.97
CP029678_7 7.1|2077842|33|CP029678|CRISPRCasFinder 2077842-2077874 33 CP029678.1 1742773-1742805 1 0.97
CP029678_7 7.1|2077842|33|CP029678|CRISPRCasFinder 2077842-2077874 33 CP029678.1 2712646-2712678 1 0.97
CP029678_9 9.2|2436767|36|CP029678|CRT 2436767-2436802 36 CP029678.1 1921220-1921255 1 0.972
CP029678_3 3.1|852263|26|CP029678|CRISPRCasFinder 852263-852288 26 CP029678.1 815256-815281 2 0.923
CP029678_3 3.1|852263|26|CP029678|CRISPRCasFinder 852263-852288 26 CP029678.1 1002105-1002130 2 0.923
CP029678_5 5.1|1002161|26|CP029678|CRT 1002161-1002186 26 CP029678.1 815200-815225 2 0.923
CP029678_5 5.1|1002161|26|CP029678|CRT 1002161-1002186 26 CP029678.1 2877996-2878021 2 0.923
CP029678_5 5.1|1002161|26|CP029678|CRT 1002161-1002186 26 CP029678.1 2878052-2878077 2 0.923
CP029678_5 5.3|1002275|26|CP029678|CRT 1002275-1002300 26 CP029678.1 393419-393444 2 0.923
CP029678_7 7.1|2077842|33|CP029678|CRISPRCasFinder 2077842-2077874 33 CP029678.1 1517547-1517579 2 0.939
CP029678_9 9.1|2436711|33|CP029678|CRT 2436711-2436743 33 CP029678.1 852299-852331 2 0.939
CP029678_9 9.1|2436711|33|CP029678|CRT 2436711-2436743 33 CP029678.1 1220134-1220166 2 0.939
CP029678_9 9.1|2436711|33|CP029678|CRT 2436711-2436743 33 CP029678.1 1428265-1428297 2 0.939
CP029678_9 9.1|2436711|33|CP029678|CRT 2436711-2436743 33 CP029678.1 1517547-1517579 2 0.939
CP029678_9 9.1|2436711|33|CP029678|CRT 2436711-2436743 33 CP029678.1 2712646-2712678 2 0.939
CP029678_9 9.2|2436767|36|CP029678|CRT 2436767-2436802 36 CP029678.1 1742712-1742747 2 0.944
CP029678_9 9.2|2436767|36|CP029678|CRT 2436767-2436802 36 CP029678.1 2088645-2088680 2 0.944
CP029678_9 9.3|2436826|33|CP029678|CRT 2436826-2436858 33 CP029678.1 852299-852331 2 0.939
CP029678_9 9.3|2436826|33|CP029678|CRT 2436826-2436858 33 CP029678.1 1220134-1220166 2 0.939
CP029678_9 9.3|2436826|33|CP029678|CRT 2436826-2436858 33 CP029678.1 1428265-1428297 2 0.939
CP029678_9 9.3|2436826|33|CP029678|CRT 2436826-2436858 33 CP029678.1 2712646-2712678 2 0.939

1. spacer 4.1|895586|34|CP029678|CRISPRCasFinder matches to position: 1428310-1428343, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

2. spacer 4.1|895586|34|CP029678|CRISPRCasFinder matches to position: 1517501-1517534, mismatch: 0, identity: 1.0

attgggaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
**********************************

3. spacer 9.2|2436767|36|CP029678|CRT matches to position: 1220078-1220113, mismatch: 0, identity: 1.0

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttctttttgaaattctcta	Protospacer
************************************

4. spacer 3.1|852263|26|CP029678|CRISPRCasFinder matches to position: 815200-815225, mismatch: 1, identity: 0.962

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgcctgcttctgtgttggggccccg	Protospacer
***** ********************

5. spacer 3.1|852263|26|CP029678|CRISPRCasFinder matches to position: 2877996-2878021, mismatch: 1, identity: 0.962

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctatgttggggccccg	Protospacer
************.*************

6. spacer 3.1|852263|26|CP029678|CRISPRCasFinder matches to position: 2878052-2878077, mismatch: 1, identity: 0.962

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctttgttggggccccg	Protospacer
************ *************

7. spacer 5.1|1002161|26|CP029678|CRT matches to position: 1002105-1002130, mismatch: 1, identity: 0.962

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacacagaggctggtgg	Protospacer
***********************.**

8. spacer 5.3|1002275|26|CP029678|CRT matches to position: 852319-852344, mismatch: 1, identity: 0.962

cggggccccaacacagaagctggcga	CRISPR spacer
cggggccccaacacagaagctgacga	Protospacer
**********************.***

9. spacer 7.1|2077842|33|CP029678|CRISPRCasFinder matches to position: 852299-852331, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

10. spacer 7.1|2077842|33|CP029678|CRISPRCasFinder matches to position: 1220134-1220166, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

11. spacer 7.1|2077842|33|CP029678|CRISPRCasFinder matches to position: 1428265-1428297, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

12. spacer 7.1|2077842|33|CP029678|CRISPRCasFinder matches to position: 1742773-1742805, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattatagtaagctgacttttcgtcagcttctg	Protospacer
****** **************************

13. spacer 7.1|2077842|33|CP029678|CRISPRCasFinder matches to position: 2712646-2712678, mismatch: 1, identity: 0.97

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
******.**************************

14. spacer 9.2|2436767|36|CP029678|CRT matches to position: 1921220-1921255, mismatch: 1, identity: 0.972

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcttttcgaaattctcta	Protospacer
************************.***********

15. spacer 3.1|852263|26|CP029678|CRISPRCasFinder matches to position: 815256-815281, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgcctgcttctatgttggggccccg	Protospacer
***** ******.*************

16. spacer 3.1|852263|26|CP029678|CRISPRCasFinder matches to position: 1002105-1002130, mismatch: 2, identity: 0.923

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccaccagcctctgtgttggggccccg	Protospacer
**.*****.*****************

17. spacer 5.1|1002161|26|CP029678|CRT matches to position: 815200-815225, mismatch: 2, identity: 0.923

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacacagaagcaggcgg	Protospacer
*****************.** *****

18. spacer 5.1|1002161|26|CP029678|CRT matches to position: 2877996-2878021, mismatch: 2, identity: 0.923

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacatagaagctggcgg	Protospacer
*************.***.********

19. spacer 5.1|1002161|26|CP029678|CRT matches to position: 2878052-2878077, mismatch: 2, identity: 0.923

cggggccccaacacagaggctggcgg	CRISPR spacer
cggggccccaacaaagaagctggcgg	Protospacer
************* ***.********

20. spacer 5.3|1002275|26|CP029678|CRT matches to position: 393419-393444, mismatch: 2, identity: 0.923

cggggccccaacacagaagctggcga	CRISPR spacer
cggggccccaacaaagaagctgacga	Protospacer
************* ********.***

21. spacer 7.1|2077842|33|CP029678|CRISPRCasFinder matches to position: 1517547-1517579, mismatch: 2, identity: 0.939

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcatcttctg	Protospacer
******.******************* ******

22. spacer 9.1|2436711|33|CP029678|CRT matches to position: 852299-852331, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

23. spacer 9.1|2436711|33|CP029678|CRT matches to position: 1220134-1220166, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

24. spacer 9.1|2436711|33|CP029678|CRT matches to position: 1428265-1428297, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

25. spacer 9.1|2436711|33|CP029678|CRT matches to position: 1517547-1517579, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcatcttctg	Protospacer
********** ***************.******

26. spacer 9.1|2436711|33|CP029678|CRT matches to position: 2712646-2712678, mismatch: 2, identity: 0.939

cattattgtatgctgacttttcgtcaccttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********** *************** ******

27. spacer 9.2|2436767|36|CP029678|CRT matches to position: 1742712-1742747, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgcctgtagaatttcttttcgaaattctcta	Protospacer
*******.****************.***********

28. spacer 9.2|2436767|36|CP029678|CRT matches to position: 2088645-2088680, mismatch: 2, identity: 0.944

tgcattgtctgtagaatttctttttgaaattctcta	CRISPR spacer
tgcattgtctgtagaatttcctttcgaaattctcta	Protospacer
********************.***.***********

29. spacer 9.3|2436826|33|CP029678|CRT matches to position: 852299-852331, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

30. spacer 9.3|2436826|33|CP029678|CRT matches to position: 1220134-1220166, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

31. spacer 9.3|2436826|33|CP029678|CRT matches to position: 1428265-1428297, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

32. spacer 9.3|2436826|33|CP029678|CRT matches to position: 2712646-2712678, mismatch: 2, identity: 0.939

cattattgtaagctgactttctgtcagcttctg	CRISPR spacer
cattattgtaagctgacttttcgtcagcttctg	Protospacer
********************..***********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029678_5 5.4|1002331|53|CP029678|CRT 1002331-1002383 53 MG543995 Staphylococcus phage UPMK_1, partial genome 76246-76298 4 0.925
CP029678_3 3.1|852263|26|CP029678|CRISPRCasFinder 852263-852288 26 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 333735-333760 5 0.808
CP029678_3 3.1|852263|26|CP029678|CRISPRCasFinder 852263-852288 26 NZ_CP034332 Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence 3359-3384 5 0.808
CP029678_3 3.1|852263|26|CP029678|CRISPRCasFinder 852263-852288 26 NZ_CP022605 Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence 715511-715536 5 0.808
CP029678_5 5.3|1002275|26|CP029678|CRT 1002275-1002300 26 NZ_CP022541 Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence 333735-333760 5 0.808
CP029678_7 7.1|2077842|33|CP029678|CRISPRCasFinder 2077842-2077874 33 NC_021536 Synechococcus phage S-IOM18 genomic sequence 159745-159777 10 0.697

1. spacer 5.4|1002331|53|CP029678|CRT matches to MG543995 (Staphylococcus phage UPMK_1, partial genome) position: , mismatch: 4, identity: 0.925

ggtgggacgacgaaataaattttgcgaaaatatcatttctgtcccactcccaa	CRISPR spacer
ggtgggacgacgaaataaattttgagaaactatcatttctgtcccactccctt	Protospacer
************************ **** *********************  

2. spacer 3.1|852263|26|CP029678|CRISPRCasFinder matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
acgccagcttctgtgttgaggcctta	Protospacer
 *****************.****...

3. spacer 3.1|852263|26|CP029678|CRISPRCasFinder matches to NZ_CP034332 (Tabrizicola piscis strain K13M18 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctgtgtctgggcctac	Protospacer
****************. *****.  

4. spacer 3.1|852263|26|CP029678|CRISPRCasFinder matches to NZ_CP022605 (Ochrobactrum quorumnocens strain A44 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.808

ccgccagcttctgtgttggggccccg	CRISPR spacer
ccgccagcttctgtgtttggccctga	Protospacer
***************** ** **. .

5. spacer 5.3|1002275|26|CP029678|CRT matches to NZ_CP022541 (Antarctobacter heliothermus strain SMS3 plasmid pSMS3-1, complete sequence) position: , mismatch: 5, identity: 0.808

cggggccccaacacagaagctggcga	CRISPR spacer
taaggcctcaacacagaagctggcgt	Protospacer
...****.***************** 

6. spacer 7.1|2077842|33|CP029678|CRISPRCasFinder matches to NC_021536 (Synechococcus phage S-IOM18 genomic sequence) position: , mismatch: 10, identity: 0.697

cattatcgtaagctgacttttcgtcagcttctg	CRISPR spacer
ttttatcgtaaggtgagttttcgtcaagcacct	Protospacer
. ********** *** *********. . *. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 35339 : 78798 49 Staphylococcus_phage(50.0%) integrase,transposase attL 35280:35296|attR 75565:75581
DBSCAN-SWA_2 783891 : 791711 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_3 803683 : 818414 12 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_4 897124 : 964377 95 Staphylococcus_phage(61.63%) tail,terminase,holin,capsid,head,portal,integrase attL 921092:921151|attR 964850:964939
DBSCAN-SWA_5 1121027 : 1129500 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 1386197 : 1392241 10 Staphylococcus_phage(66.67%) head NA
DBSCAN-SWA_7 1474448 : 1509497 33 Staphylococcus_prophage(16.67%) lysis,transposase,protease NA
DBSCAN-SWA_8 1571273 : 1658409 105 Staphylococcus_phage(83.12%) tail,terminase,holin,tRNA,capsid,head,portal,integrase,protease attL 1607636:1607656|attR 1653529:1653549
DBSCAN-SWA_9 1714342 : 1722647 7 Staphylococcus_phage(16.67%) NA NA
DBSCAN-SWA_10 1791784 : 1800827 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_11 1926283 : 2043363 106 Staphylococcus_phage(86.76%) bacteriocin,tRNA,transposase,protease NA
DBSCAN-SWA_12 2132742 : 2190981 76 Staphylococcus_phage(97.1%) tail,terminase,holin,capsid,head,portal,integrase,protease attL 2152167:2152184|attR 2177098:2177115
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP029677
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 17994 : 26421 10 Staphylococcus_phage(37.5%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage