Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP021162 Enterobacter hormaechei strain 234 chromosome, complete genome 1 crisprs DEDDh,csa3,WYL,DinG,cas3 0 2 6 0
CP021163 Enterobacter hormaechei strain 234 plasmid p234, complete sequence 0 crisprs RT 0 0 1 0

Results visualization

1. CP021162
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP021162_2 2043355-2043478 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP021162_2 2.1|2043398|38|CP021162|CRISPRCasFinder 2043398-2043435 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP021162_1 1.1|1169337|49|CP021162|CRISPRCasFinder 1169337-1169385 49 MN013086 Klebsiella phage vB_Kpn_Chronis, complete genome 33521-33569 3 0.939

1. spacer 2.1|2043398|38|CP021162|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947

cagacgcaagatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
********..****************************

2. spacer 1.1|1169337|49|CP021162|CRISPRCasFinder matches to MN013086 (Klebsiella phage vB_Kpn_Chronis, complete genome) position: , mismatch: 3, identity: 0.939

gccggtgtccagcccaaacgcagtcgtaccaatgcctgcggaggtggaa	CRISPR spacer
gccgatgtccagccaaaacgcagtcgtaccaatgcctgcggaggtggat	Protospacer
****.********* ********************************* 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1155279 : 1197780 66 Enterobacteria_phage(26.42%) terminase,tail,integrase,head,lysis,coat attL 1155220:1155278|attR 1202891:1202949
DBSCAN-SWA_2 1819703 : 1884683 78 Enterobacterial_phage(32.08%) capsid,terminase,tail,integrase,head,portal,tRNA attL 1813386:1813403|attR 1892452:1892469
DBSCAN-SWA_3 2452872 : 2488293 42 Cronobacter_phage(22.22%) terminase,tail NA
DBSCAN-SWA_4 2492368 : 2506090 14 Escherichia_phage(46.15%) integrase,tRNA attL 2501289:2501304|attR 2515656:2515671
DBSCAN-SWA_5 2990903 : 2997181 6 Enterobacteria_phage(50.0%) NA NA
DBSCAN-SWA_6 3435508 : 3514652 86 Salmonella_phage(70.59%) capsid,tail,integrase,head,portal,tRNA,plate attL 3480450:3480499|attR 3514861:3514910
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP021163
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 2236 : 47738 52 Escherichia_phage(30.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage