Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP028157 Salmonella enterica subsp. enterica serovar Enteritidis strain RM4283 chromosome, complete genome 2 crisprs WYL,DinG,DEDDh,cas3,csa3,cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,PD-DExK 0 10 8 0
CP028155 Salmonella enterica subsp. enterica serovar Enteritidis strain RM4283 plasmid pRM4283-2, complete sequence 0 crisprs NA 0 0 0 0
CP028156 Salmonella enterica subsp. enterica serovar Enteritidis strain RM4283 plasmid pRM4283-1, complete sequence 0 crisprs cas14j 0 0 1 0

Results visualization

1. CP028157
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028157_1 2944818-2945395 TypeI-E I-E
9 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028157_2 2961547-2962063 TypeI-E I-E
8 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP028157_2 2.3|2961698|32|CP028157|CRISPRCasFinder,CRT 2961698-2961729 32 MN694003 Marine virus AFVG_250M677, complete genome 17629-17660 8 0.75
CP028157_2 2.6|2961881|32|CP028157|CRISPRCasFinder,CRT 2961881-2961912 32 MG592432 Vibrio phage 1.050.O._10N.286.48.A6, partial genome 21687-21718 8 0.75
CP028157_2 2.6|2961881|32|CP028157|CRISPRCasFinder,CRT 2961881-2961912 32 MG592431 Vibrio phage 1.049.O._10N.286.54.B5, partial genome 21426-21457 8 0.75
CP028157_2 2.10|2961698|34|CP028157|PILER-CR 2961698-2961731 34 MN694003 Marine virus AFVG_250M677, complete genome 17627-17660 8 0.765
CP028157_1 1.1|2944847|32|CP028157|CRISPRCasFinder,CRT 2944847-2944878 32 NZ_MG266000 Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence 5501-5532 9 0.719
CP028157_1 1.3|2944969|32|CP028157|CRISPRCasFinder,CRT 2944969-2945000 32 MK449011 Streptococcus phage Javan92, complete genome 36157-36188 9 0.719
CP028157_1 1.3|2944969|32|CP028157|CRISPRCasFinder,CRT 2944969-2945000 32 MK448835 Streptococcus phage Javan93, complete genome 36157-36188 9 0.719
CP028157_1 1.3|2944969|32|CP028157|CRISPRCasFinder,CRT 2944969-2945000 32 MK448836 Streptococcus phage Javan95, complete genome 37400-37431 9 0.719
CP028157_1 1.3|2944969|32|CP028157|CRISPRCasFinder,CRT 2944969-2945000 32 MK448825 Streptococcus phage Javan639, complete genome 37400-37431 9 0.719
CP028157_1 1.7|2945213|32|CP028157|CRISPRCasFinder,CRT 2945213-2945244 32 KY006853 Erythrobacter phage vB_EliS_R6L, complete genome 41418-41449 9 0.719
CP028157_1 1.10|2944849|32|CP028157|PILER-CR 2944849-2944880 32 NZ_MG266000 Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence 5501-5532 9 0.719
CP028157_1 1.12|2944971|32|CP028157|PILER-CR 2944971-2945002 32 MK449011 Streptococcus phage Javan92, complete genome 36157-36188 9 0.719
CP028157_1 1.12|2944971|32|CP028157|PILER-CR 2944971-2945002 32 MK448835 Streptococcus phage Javan93, complete genome 36157-36188 9 0.719
CP028157_1 1.12|2944971|32|CP028157|PILER-CR 2944971-2945002 32 MK448836 Streptococcus phage Javan95, complete genome 37400-37431 9 0.719
CP028157_1 1.12|2944971|32|CP028157|PILER-CR 2944971-2945002 32 MK448825 Streptococcus phage Javan639, complete genome 37400-37431 9 0.719
CP028157_1 1.16|2945215|32|CP028157|PILER-CR 2945215-2945246 32 KY006853 Erythrobacter phage vB_EliS_R6L, complete genome 41418-41449 9 0.719
CP028157_2 2.6|2961881|32|CP028157|CRISPRCasFinder,CRT 2961881-2961912 32 NC_047790 Pseudoalteromonas phage C5a, complete genome 34441-34472 9 0.719
CP028157_2 2.8|2962003|32|CP028157|CRISPRCasFinder,CRT 2962003-2962034 32 CP006879 Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602b, complete sequence 405613-405644 9 0.719
CP028157_2 2.8|2962003|32|CP028157|CRISPRCasFinder,CRT 2962003-2962034 32 NZ_CP049244 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence 699963-699994 10 0.688

1. spacer 2.3|2961698|32|CP028157|CRISPRCasFinder,CRT matches to MN694003 (Marine virus AFVG_250M677, complete genome) position: , mismatch: 8, identity: 0.75

cgattctacggcaacaggccaggctgcgaccg	CRISPR spacer
ggcgagcacggcaacagcccaggctgcgatcg	Protospacer
 *    .********** ***********.**

2. spacer 2.6|2961881|32|CP028157|CRISPRCasFinder,CRT matches to MG592432 (Vibrio phage 1.050.O._10N.286.48.A6, partial genome) position: , mismatch: 8, identity: 0.75

tgattattgacgacaacagcacagaccggcag	CRISPR spacer
ttataattgactacaacagcacagagcagatt	Protospacer
* ** ****** ************* *.*   

3. spacer 2.6|2961881|32|CP028157|CRISPRCasFinder,CRT matches to MG592431 (Vibrio phage 1.049.O._10N.286.54.B5, partial genome) position: , mismatch: 8, identity: 0.75

tgattattgacgacaacagcacagaccggcag	CRISPR spacer
ttataattgactacaacagcacagagcagatt	Protospacer
* ** ****** ************* *.*   

4. spacer 2.10|2961698|34|CP028157|PILER-CR matches to MN694003 (Marine virus AFVG_250M677, complete genome) position: , mismatch: 8, identity: 0.765

cgattctacggcaacaggccaggctgcgaccgcg	CRISPR spacer
ggcgagcacggcaacagcccaggctgcgatcgcg	Protospacer
 *    .********** ***********.****

5. spacer 1.1|2944847|32|CP028157|CRISPRCasFinder,CRT matches to NZ_MG266000 (Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence) position: , mismatch: 9, identity: 0.719

tatttataagcgtgtcatctatgcaacccaac	CRISPR spacer
aatttataatcatgtcatctatgccataattc	Protospacer
 ******** *.************ *.    *

6. spacer 1.3|2944969|32|CP028157|CRISPRCasFinder,CRT matches to MK449011 (Streptococcus phage Javan92, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

7. spacer 1.3|2944969|32|CP028157|CRISPRCasFinder,CRT matches to MK448835 (Streptococcus phage Javan93, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

8. spacer 1.3|2944969|32|CP028157|CRISPRCasFinder,CRT matches to MK448836 (Streptococcus phage Javan95, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

9. spacer 1.3|2944969|32|CP028157|CRISPRCasFinder,CRT matches to MK448825 (Streptococcus phage Javan639, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

10. spacer 1.7|2945213|32|CP028157|CRISPRCasFinder,CRT matches to KY006853 (Erythrobacter phage vB_EliS_R6L, complete genome) position: , mismatch: 9, identity: 0.719

gagaatgctcatgcgcgtgagcgccatatatt	CRISPR spacer
cgaaatgatcatgcgcgtcagcgccattgcgt	Protospacer
 ..**** ********** ********    *

11. spacer 1.10|2944849|32|CP028157|PILER-CR matches to NZ_MG266000 (Clostridioides difficile strain 7032985 plasmid pCD-ISS1, complete sequence) position: , mismatch: 9, identity: 0.719

tatttataagcgtgtcatctatgcaacccaac	CRISPR spacer
aatttataatcatgtcatctatgccataattc	Protospacer
 ******** *.************ *.    *

12. spacer 1.12|2944971|32|CP028157|PILER-CR matches to MK449011 (Streptococcus phage Javan92, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

13. spacer 1.12|2944971|32|CP028157|PILER-CR matches to MK448835 (Streptococcus phage Javan93, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

14. spacer 1.12|2944971|32|CP028157|PILER-CR matches to MK448836 (Streptococcus phage Javan95, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

15. spacer 1.12|2944971|32|CP028157|PILER-CR matches to MK448825 (Streptococcus phage Javan639, complete genome) position: , mismatch: 9, identity: 0.719

ggccgctggtcaaattcccaatctgagcaatc	CRISPR spacer
tacatcttgacaaattcccaatctgagcgact	Protospacer
 .*  ** * ******************.*..

16. spacer 1.16|2945215|32|CP028157|PILER-CR matches to KY006853 (Erythrobacter phage vB_EliS_R6L, complete genome) position: , mismatch: 9, identity: 0.719

gagaatgctcatgcgcgtgagcgccatatatt	CRISPR spacer
cgaaatgatcatgcgcgtcagcgccattgcgt	Protospacer
 ..**** ********** ********    *

17. spacer 2.6|2961881|32|CP028157|CRISPRCasFinder,CRT matches to NC_047790 (Pseudoalteromonas phage C5a, complete genome) position: , mismatch: 9, identity: 0.719

tgattattgacgacaacagcacagaccggcag	CRISPR spacer
agcttattgacgaaaacggcacagacaccaaa	Protospacer
 * ********** ***.********    *.

18. spacer 2.8|2962003|32|CP028157|CRISPRCasFinder,CRT matches to CP006879 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602b, complete sequence) position: , mismatch: 9, identity: 0.719

gaatctggaggccaacagcgcggcgaaatcct	CRISPR spacer
gaatctggagggcgacagcgcggtcgaccctg	Protospacer
*********** *.*********. .* .*. 

19. spacer 2.8|2962003|32|CP028157|CRISPRCasFinder,CRT matches to NZ_CP049244 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688

gaatctggaggccaacagcgcggcgaaatcct	CRISPR spacer
gtggtcataggccatcagcgcggcgatatccc	Protospacer
* . ... ****** *********** ****.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 931792 : 939105 8 Dickeya_phage(16.67%) integrase,protease attL 920530:920544|attR 939323:939337
DBSCAN-SWA_2 1010423 : 1021648 11 Salmonella_phage(40.0%) tail NA
DBSCAN-SWA_3 1187776 : 1243509 60 Salmonella_phage(17.39%) integrase,lysis,tRNA,protease,holin,tail attL 1233917:1233934|attR 1244630:1244647
DBSCAN-SWA_4 1462634 : 1473421 15 Escherichia_phage(72.73%) tRNA NA
DBSCAN-SWA_5 1913016 : 1923002 12 Salmonella_phage(50.0%) integrase,capsid attL 1908767:1908780|attR 1921673:1921686
DBSCAN-SWA_6 2033169 : 2044139 13 Salmonella_phage(54.55%) lysis,integrase,terminase attL 2037222:2037235|attR 2046233:2046246
DBSCAN-SWA_7 2158869 : 2169376 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_8 2236573 : 2245744 10 Enterobacteria_phage(66.67%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP028156
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 18115 : 44421 29 Escherichia_phage(27.27%) transposase,integrase attL 16950:16964|attR 50429:50443
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage