Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 1 crisprs csa3,PD-DExK 0 3 1 0
CP021354 Rhodococcus sp. S2-17 chromosome, complete genome 0 crisprs RT,csa3,cas3,WYL,c2c9_V-U4,DinG,DEDDh,cas4,Cas14u_CAS-V 0 0 1 0
CP021357 Rhodococcus sp. S2-17 plasmid pRB11, complete sequence 0 crisprs NA 0 0 0 0
CP021356 Rhodococcus sp. S2-17 plasmid pRB29, complete sequence 0 crisprs csa3,PD-DExK,csf3gr5,csf2gr7,csf4gr11,csf1gr8,c2c9_V-U4 0 0 1 0

Results visualization

1. CP021355
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP021355_1 527726-527935 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP021355_1 1.1|527749|38|CP021355|CRISPRCasFinder 527749-527786 38 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 527749-527786 0 1.0
CP021355_1 1.2|527810|42|CP021355|CRISPRCasFinder 527810-527851 42 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 527810-527851 0 1.0
CP021355_1 1.3|527875|38|CP021355|CRISPRCasFinder 527875-527912 38 NZ_CP021355 Rhodococcus sp. S2-17 plasmid pRB98, complete sequence 527875-527912 0 1.0

1. spacer 1.1|527749|38|CP021355|CRISPRCasFinder matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 0, identity: 1.0

tcctgcacgatgacgtcaccgtgcttgtactcgggatc	CRISPR spacer
tcctgcacgatgacgtcaccgtgcttgtactcgggatc	Protospacer
**************************************

2. spacer 1.2|527810|42|CP021355|CRISPRCasFinder matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 0, identity: 1.0

ggttcgatatctttcccgaccttgagagtgccgggatcacac	CRISPR spacer
ggttcgatatctttcccgaccttgagagtgccgggatcacac	Protospacer
******************************************

3. spacer 1.3|527875|38|CP021355|CRISPRCasFinder matches to NZ_CP021355 (Rhodococcus sp. S2-17 plasmid pRB98, complete sequence) position: , mismatch: 0, identity: 1.0

ttgatgtcgccggcgtcggcgtagctgttcatgggatc	CRISPR spacer
ttgatgtcgccggcgtcggcgtagctgttcatgggatc	Protospacer
**************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 185289 : 241357 32 Staphylococcus_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP021354
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3966096 : 3972608 7 Paenibacillus_phage(16.67%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP021356
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 166049 : 208188 31 Mycobacterium_phage(20.0%) integrase,transposase attL 159554:159570|attR 192294:192310
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage