Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029072 Mycobacterium abscessus strain G220 chromosome, complete genome 1 crisprs DEDDh,cas3,csa3,DinG,cas4,WYL 0 1 6 0

Results visualization

1. CP029072
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029072_2 4800154-4800269 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029072_1 1.1|1490503|26|CP029072|CRISPRCasFinder 1490503-1490528 26 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 418376-418401 5 0.808
CP029072_1 1.1|1490503|26|CP029072|CRISPRCasFinder 1490503-1490528 26 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 678153-678178 5 0.808
CP029072_1 1.1|1490503|26|CP029072|CRISPRCasFinder 1490503-1490528 26 NZ_CP029333 Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence 54049-54074 6 0.769
CP029072_1 1.1|1490503|26|CP029072|CRISPRCasFinder 1490503-1490528 26 NC_022654 Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence 143457-143482 6 0.769

1. spacer 1.1|1490503|26|CP029072|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 5, identity: 0.808

aaccccggccagggtggttggggcca	CRISPR spacer
gaccccggccagggtggtcgcggcgg	Protospacer
.*****************.* *** .

2. spacer 1.1|1490503|26|CP029072|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 5, identity: 0.808

aaccccggccagggtggttggggcca	CRISPR spacer
gaccccggccagggtggtcgcggcgg	Protospacer
.*****************.* *** .

3. spacer 1.1|1490503|26|CP029072|CRISPRCasFinder matches to NZ_CP029333 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence) position: , mismatch: 6, identity: 0.769

aaccccggccagggtggttggggcca	CRISPR spacer
ttgcccggcgagggtggttggggcac	Protospacer
   ****** **************  

4. spacer 1.1|1490503|26|CP029072|CRISPRCasFinder matches to NC_022654 (Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence) position: , mismatch: 6, identity: 0.769

aaccccggccagggtggttggggcca	CRISPR spacer
ttgcccggcgagggtggttggggcac	Protospacer
   ****** **************  

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 498422 : 506794 8 Mycobacterium_phage(33.33%) NA NA
DBSCAN-SWA_2 994285 : 1039876 39 Staphylococcus_phage(33.33%) holin,capsid,integrase,protease attL 992653:992669|attR 1026962:1026978
DBSCAN-SWA_3 1684387 : 1691128 10 Mycobacterium_phage(85.71%) NA NA
DBSCAN-SWA_4 1700711 : 1741239 54 Mycobacterium_phage(75.76%) protease,portal,capsid,tail,head,transposase,terminase NA
DBSCAN-SWA_5 3288882 : 3297443 7 Streptococcus_phage(16.67%) NA NA
DBSCAN-SWA_6 4598891 : 4608390 9 Burkholderia_phage(25.0%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage