Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP021069 Burkholderia cenocepacia strain PC184 Mulks chromosome 3, complete sequence 0 crisprs DEDDh,csa3,RT,cas3,WYL,c2c9_V-U4,DinG,Cas14u_CAS-V 0 0 2 0
CP021067 Burkholderia cenocepacia strain PC184 Mulks chromosome 1, complete sequence 1 crisprs csa3,cas3,Cas14u_CAS-V,DinG,c2c9_V-U4,cas14j 0 1 0 0
CP021068 Burkholderia cenocepacia strain PC184 Mulks chromosome 2, complete sequence 0 crisprs RT 0 0 1 0

Results visualization

1. CP021069
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 866220 : 879319 11 Bodo_saltans_virus(12.5%) NA NA
DBSCAN-SWA_2 3122829 : 3196415 77 Burkholderia_phage(87.5%) holin,portal,head,tail,protease,capsid,terminase,tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP021067
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP021067_1 1777125-1777201 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP021067_1 1.1|1777148|31|CP021067|CRISPRCasFinder 1777148-1777178 31 NZ_HG938354 Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence 979939-979969 8 0.742
CP021067_1 1.1|1777148|31|CP021067|CRISPRCasFinder 1777148-1777178 31 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 1076872-1076902 8 0.742
CP021067_1 1.1|1777148|31|CP021067|CRISPRCasFinder 1777148-1777178 31 LC425522 Uncultured phage DNA, contig: NODE620 1015-1045 10 0.677

1. spacer 1.1|1777148|31|CP021067|CRISPRCasFinder matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 8, identity: 0.742

aaacagctcggttgcgtcgctttcgacctcg	CRISPR spacer
agtcgtgccggtttcgccgctttcgacctcg	Protospacer
*. *.  .***** **.**************

2. spacer 1.1|1777148|31|CP021067|CRISPRCasFinder matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 8, identity: 0.742

aaacagctcggttgcgtcgctttcgacctcg	CRISPR spacer
agtcgtgccggtttcgccgctttcgacctcg	Protospacer
*. *.  .***** **.**************

3. spacer 1.1|1777148|31|CP021067|CRISPRCasFinder matches to LC425522 (Uncultured phage DNA, contig: NODE620) position: , mismatch: 10, identity: 0.677

aaacagctcggttgcgtcgctttcgacctcg	CRISPR spacer
gttggtctcgattgcgtcgcttttgacctga	Protospacer
.   . ****.************.***** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP021068
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 578311 : 584676 7 Enterobacteria_phage(28.57%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage