Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029083 Staphylococcus aureus strain AR464 plasmid unnamed1, complete sequence 0 crisprs csa3 0 0 0 0
CP029084 Staphylococcus aureus strain AR464 chromosome, complete genome 5 crisprs WYL,cas3,DEDDh,DinG 3 0 9 0

Results visualization

1. CP029084
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029084_1 180547-180685 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029084_2 371702-371795 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029084_3 1408509-1408610 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029084_4 1507307-1507390 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029084_5 1513780-1513859 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP029084_4 4.1|1507332|34|CP029084|CRISPRCasFinder 1507332-1507365 34 CP029084.1 1800396-1800429 0 1.0
CP029084_5 5.1|1513804|32|CP029084|CRISPRCasFinder 1513804-1513835 32 CP029084.1 253774-253805 0 1.0
CP029084_5 5.1|1513804|32|CP029084|CRISPRCasFinder 1513804-1513835 32 CP029084.1 253830-253861 0 1.0
CP029084_5 5.1|1513804|32|CP029084|CRISPRCasFinder 1513804-1513835 32 CP029084.1 412345-412376 0 1.0
CP029084_5 5.1|1513804|32|CP029084|CRISPRCasFinder 1513804-1513835 32 CP029084.1 949634-949665 0 1.0
CP029084_5 5.1|1513804|32|CP029084|CRISPRCasFinder 1513804-1513835 32 CP029084.1 1660965-1660996 1 0.969
CP029084_1 1.1|180598|37|CP029084|CRISPRCasFinder 180598-180634 37 CP029084.1 180509-180545 2 0.946
CP029084_5 5.1|1513804|32|CP029084|CRISPRCasFinder 1513804-1513835 32 CP029084.1 2622960-2622991 2 0.938

1. spacer 4.1|1507332|34|CP029084|CRISPRCasFinder matches to position: 1800396-1800429, mismatch: 0, identity: 1.0

ttgttggggcccacaccccaacttgcacattatc	CRISPR spacer
ttgttggggcccacaccccaacttgcacattatc	Protospacer
**********************************

2. spacer 5.1|1513804|32|CP029084|CRISPRCasFinder matches to position: 253774-253805, mismatch: 0, identity: 1.0

aacttgcacattattgtaagctgactttccgc	CRISPR spacer
aacttgcacattattgtaagctgactttccgc	Protospacer
********************************

3. spacer 5.1|1513804|32|CP029084|CRISPRCasFinder matches to position: 253830-253861, mismatch: 0, identity: 1.0

aacttgcacattattgtaagctgactttccgc	CRISPR spacer
aacttgcacattattgtaagctgactttccgc	Protospacer
********************************

4. spacer 5.1|1513804|32|CP029084|CRISPRCasFinder matches to position: 412345-412376, mismatch: 0, identity: 1.0

aacttgcacattattgtaagctgactttccgc	CRISPR spacer
aacttgcacattattgtaagctgactttccgc	Protospacer
********************************

5. spacer 5.1|1513804|32|CP029084|CRISPRCasFinder matches to position: 949634-949665, mismatch: 0, identity: 1.0

aacttgcacattattgtaagctgactttccgc	CRISPR spacer
aacttgcacattattgtaagctgactttccgc	Protospacer
********************************

6. spacer 5.1|1513804|32|CP029084|CRISPRCasFinder matches to position: 1660965-1660996, mismatch: 1, identity: 0.969

aacttgcacattattgtaagctgactttccgc	CRISPR spacer
aacttgcacattattgtaagctgacttttcgc	Protospacer
****************************.***

7. spacer 1.1|180598|37|CP029084|CRISPRCasFinder matches to position: 180509-180545, mismatch: 2, identity: 0.946

agctcacaaaacccttgatatcattggtttcccatga	CRISPR spacer
agctcacaaaacccttgatatcactggtttctcatga	Protospacer
***********************.*******.*****

8. spacer 5.1|1513804|32|CP029084|CRISPRCasFinder matches to position: 2622960-2622991, mismatch: 2, identity: 0.938

aacttgcacattattgtaagctgactttccgc	CRISPR spacer
aacttgcacgttattgaaagctgactttccgc	Protospacer
*********.****** ***************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1439578 : 1447397 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_2 1459373 : 1473649 12 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_3 1526094 : 1545369 28 Staphylococcus_phage(68.18%) coat,integrase,terminase attL 1528756:1528771|attR 1543557:1543572
DBSCAN-SWA_4 1580129 : 1623057 62 Staphylococcus_phage(64.52%) portal,tail,terminase,capsid,head,integrase,holin attL 1572128:1572143|attR 1629945:1629960
DBSCAN-SWA_5 1775735 : 1784208 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 2039442 : 2054894 23 Staphylococcus_phage(52.63%) head,portal,integrase,terminase attL 2033265:2033282|attR 2057730:2057747
DBSCAN-SWA_7 2328163 : 2336475 7 Staphylococcus_phage(16.67%) NA NA
DBSCAN-SWA_8 2538218 : 2588394 47 Staphylococcus_phage(86.49%) tRNA,transposase,protease NA
DBSCAN-SWA_9 2718374 : 2764163 67 Staphylococcus_phage(98.51%) portal,tail,protease,capsid,head,integrase,holin attL 2737798:2737815|attR 2762144:2762161
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage