Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029098 Klebsiella pneumoniae strain AR438 plasmid unnamed1 0 crisprs NA 0 0 0 0
CP029101 Klebsiella pneumoniae strain AR438 plasmid unnamed3, complete sequence 0 crisprs RT,c2c9_V-U4,csa3,cas3 0 0 3 0
CP029100 Klebsiella pneumoniae strain AR438 plasmid unnamed2 0 crisprs NA 0 0 1 0
CP029099 Klebsiella pneumoniae strain AR438 chromosome, complete genome 1 crisprs csa3,cas3,DEDDh,RT,DinG,WYL 0 1 12 0
CP029102 Klebsiella pneumoniae strain AR438 plasmid unnamed4, complete sequence 0 crisprs NA 0 0 2 0

Results visualization

1. CP029101
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 4963 : 45972 40 Macacine_betaherpesvirus(14.29%) integrase,transposase,holin attL 12005:12021|attR 43068:43084
DBSCAN-SWA_2 65568 : 108756 50 Escherichia_phage(36.84%) transposase,integrase attL 59986:60002|attR 100551:100567
DBSCAN-SWA_3 114175 : 169602 45 Stx2-converting_phage(23.81%) integrase,transposase,bacteriocin attL 105526:105542|attR 164544:164560
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP029100
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 7580 : 18567 11 Escherichia_phage(60.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP029099
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029099_2 4591289-4591383 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029099_1 1.1|4107348|36|CP029099|CRISPRCasFinder 4107348-4107383 36 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 8447-8482 0 1.0
CP029099_1 1.1|4107348|36|CP029099|CRISPRCasFinder 4107348-4107383 36 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 8447-8482 0 1.0
CP029099_1 1.1|4107348|36|CP029099|CRISPRCasFinder 4107348-4107383 36 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 11383-11418 0 1.0

1. spacer 1.1|4107348|36|CP029099|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

2. spacer 1.1|4107348|36|CP029099|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

3. spacer 1.1|4107348|36|CP029099|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 447243 : 481807 36 uncultured_Caudovirales_phage(61.11%) capsid,tRNA,transposase,integrase,head,protease,terminase,tail,portal attL 464851:464868|attR 482152:482169
DBSCAN-SWA_2 1239478 : 1285713 56 Salmonella_phage(86.84%) plate,capsid,lysis,tRNA,integrase,terminase,head,tail,portal attL 1237772:1237818|attR 1274339:1274385
DBSCAN-SWA_3 1390438 : 1435141 58 Salmonella_phage(42.22%) integrase,head,terminase,protease,tail attL 1393002:1393016|attR 1404183:1404197
DBSCAN-SWA_4 1763871 : 1770778 7 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_5 1807345 : 1814970 8 Enterobacteria_phage(28.57%) NA NA
DBSCAN-SWA_6 2781537 : 2792424 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_7 3015610 : 3157619 166 Klebsiella_phage(26.73%) capsid,lysis,transposase,terminase,protease,integrase,tail attL 3091373:3091388|attR 3154925:3154940
DBSCAN-SWA_8 3545638 : 3626854 93 Salmonella_phage(64.81%) plate,capsid,lysis,tRNA,protease,head,terminase,integrase,tail,portal attL 3589429:3589447|attR 3626929:3626947
DBSCAN-SWA_9 4070089 : 4118438 60 Cronobacter_phage(27.08%) lysis,coat,tRNA,terminase,integrase attL 4066376:4066422|attR 4115510:4115556
DBSCAN-SWA_10 4327992 : 4339646 15 Enterobacteria_phage(70.0%) integrase,capsid attL 4327844:4327857|attR 4332057:4332070
DBSCAN-SWA_11 4806035 : 4813717 12 Enterobacteria_phage(85.71%) capsid,integrase,transposase attL 4798958:4798972|attR 4810792:4810806
DBSCAN-SWA_12 5008856 : 5013943 8 Escherichia_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. CP029102
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 21104 : 33196 10 Escherichia_phage(25.0%) NA NA
DBSCAN-SWA_2 37771 : 109307 73 Escherichia_phage(29.03%) transposase,holin,integrase attL 51093:51152|attR 105935:106372
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage