Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029041 Salmonella enterica strain CFSAN051295 chromosome, complete genome 5 crisprs PD-DExK,WYL,csa3,cas3,DEDDh,DinG,RT 1 18 8 0

Results visualization

1. CP029041
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029041_3 614669-614826 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029041_4 955413-956420 Orphan I-E
16 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029041_5 965154-966893 Orphan I-E
28 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029041_6 1454935-1455010 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029041_8 4414131-4414277 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP029041_3 3.1|614719|58|CP029041|CRISPRCasFinder 614719-614776 58 CP029041.1 614946-615003 2 0.966

1. spacer 3.1|614719|58|CP029041|CRISPRCasFinder matches to position: 614946-615003, mismatch: 2, identity: 0.966 

gcaggatgaatgactgtccacgacgctatatccaaaagaaagcggcttatcggtcagt	CRISPR spacer
gcaggatgaatgactgtccacgacactatacccaaaagaaagcggcttatcggtcagt	Protospacer
************************.*****.***************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029041_4 4.4|955625|33|CP029041|PILER-CR,CRISPRCasFinder,CRT 955625-955657 33 MT774487 Salmonella phage MG40, complete genome 22969-23001 0 1.0
CP029041_4 4.4|955625|33|CP029041|PILER-CR,CRISPRCasFinder,CRT 955625-955657 33 MH370364 Salmonella phage S107, complete genome 32314-32346 1 0.97
CP029041_4 4.4|955625|33|CP029041|PILER-CR,CRISPRCasFinder,CRT 955625-955657 33 MH370382 Salmonella phage S135, complete genome 32314-32346 1 0.97
CP029041_4 4.4|955625|33|CP029041|PILER-CR,CRISPRCasFinder,CRT 955625-955657 33 MH370383 Salmonella phage S137, complete genome 32314-32346 1 0.97
CP029041_5 5.12|965855|32|CP029041|PILER-CR,CRISPRCasFinder,CRT 965855-965886 32 NZ_CP008900 Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-d4a, complete sequence 56750-56781 1 0.969
CP029041_4 4.4|955625|33|CP029041|PILER-CR,CRISPRCasFinder,CRT 955625-955657 33 MG969415 UNVERIFIED: Salmonella phage GE_vB_TR, complete genome 18915-18947 2 0.939
CP029041_5 5.12|965855|32|CP029041|PILER-CR,CRISPRCasFinder,CRT 965855-965886 32 NZ_KY978631 Klebsiella pneumoniae strain 447 plasmid p447-IMP, complete sequence 48648-48679 2 0.938
CP029041_5 5.12|965855|32|CP029041|PILER-CR,CRISPRCasFinder,CRT 965855-965886 32 CP045557 Citrobacter sp. S39 plasmid pS39-2, complete sequence 130568-130599 2 0.938
CP029041_5 5.12|965855|32|CP029041|PILER-CR,CRISPRCasFinder,CRT 965855-965886 32 NZ_CP022136 Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 plasmid unnamed1, complete sequence 31095-31126 3 0.906
CP029041_5 5.12|965855|32|CP029041|PILER-CR,CRISPRCasFinder,CRT 965855-965886 32 NZ_CP029996 Salmonella enterica subsp. salamae strain SA20053897 plasmid pSA20053897.1, complete sequence 61659-61690 3 0.906
CP029041_5 5.12|965855|32|CP029041|PILER-CR,CRISPRCasFinder,CRT 965855-965886 32 NZ_CP022036 Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed1, complete sequence 14331-14362 3 0.906
CP029041_5 5.12|965855|32|CP029041|PILER-CR,CRISPRCasFinder,CRT 965855-965886 32 NC_019335 Salmonella sp. 14 plasmid p14-95A, complete sequence 76776-76807 3 0.906
CP029041_5 5.12|965855|32|CP029041|PILER-CR,CRISPRCasFinder,CRT 965855-965886 32 NC_019336 Salmonella sp. 40 plasmid p40-95A, complete sequence 61523-61554 3 0.906
CP029041_7 7.1|1494235|31|CP029041|CRISPRCasFinder 1494235-1494265 31 KY271396 Klebsiella phage 2 LV-2017, complete genome 33331-33361 6 0.806
CP029041_7 7.1|1494235|31|CP029041|CRISPRCasFinder 1494235-1494265 31 MN098327 Klebsiella phage Mulock, complete genome 34231-34261 6 0.806
CP029041_7 7.1|1494235|31|CP029041|CRISPRCasFinder 1494235-1494265 31 KY271395 Klebsiella phage 2b LV-2017, complete genome 11682-11712 6 0.806
CP029041_7 7.1|1494235|31|CP029041|CRISPRCasFinder 1494235-1494265 31 MK448230 Klebsiella phage ST16-OXA48phi5.2, complete genome 13189-13219 6 0.806
CP029041_4 4.4|955625|33|CP029041|PILER-CR,CRISPRCasFinder,CRT 955625-955657 33 JQ182733 Enterobacterial phage mEp213, complete genome 26443-26475 7 0.788
CP029041_4 4.4|955625|33|CP029041|PILER-CR,CRISPRCasFinder,CRT 955625-955657 33 NC_019706 Enterobacteria phage mEp043 c-1, complete genome 26443-26475 7 0.788
CP029041_5 5.25|966649|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966649-966680 32 NZ_CP004876 Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB299, complete sequence 110177-110208 7 0.781
CP029041_5 5.25|966649|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966649-966680 32 NC_017203 Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT281, complete sequence 145494-145525 7 0.781
CP029041_5 5.25|966649|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966649-966680 32 NC_020384 Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-285, complete sequence 149719-149750 7 0.781
CP029041_5 5.25|966649|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966649-966680 32 NZ_CP011350 Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence 737246-737277 7 0.781
CP029041_5 5.25|966649|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966649-966680 32 NZ_CP015152 Bacillus thuringiensis strain Bc601 plasmid pBTBC2, complete sequence 145797-145828 7 0.781
CP029041_5 5.25|966649|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966649-966680 32 NZ_CP013056 Bacillus thuringiensis strain YWC2-8 plasmid pYWC2-8-1, complete sequence 56785-56816 7 0.781
CP029041_5 5.25|966649|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966649-966680 32 NZ_CP004861 Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB293, complete sequence 108481-108512 7 0.781
CP029041_5 5.25|966649|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966649-966680 32 NZ_AP014866 Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK2, complete sequence 36899-36930 7 0.781
CP029041_5 5.25|966649|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966649-966680 32 NZ_CP010091 Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB267, complete sequence 102754-102785 7 0.781
CP029041_7 7.1|1494235|31|CP029041|CRISPRCasFinder 1494235-1494265 31 NC_008771 Verminephrobacter eiseniae EF01-2 plasmid pVEIS01, complete sequence 26884-26914 7 0.774
CP029041_7 7.1|1494235|31|CP029041|CRISPRCasFinder 1494235-1494265 31 NZ_CP047230 Moraxella osloensis strain YV1 plasmid p4, complete sequence 5720-5750 7 0.774
CP029041_7 7.1|1494235|31|CP029041|CRISPRCasFinder 1494235-1494265 31 NZ_CP011866 Enterobacter asburiae strain ATCC 35953 plasmid unnamed 3, complete sequence 4507-4537 7 0.774
CP029041_7 7.1|1494235|31|CP029041|CRISPRCasFinder 1494235-1494265 31 NZ_CP011866 Enterobacter asburiae strain ATCC 35953 plasmid unnamed 3, complete sequence 9665-9695 7 0.774
CP029041_7 7.1|1494235|31|CP029041|CRISPRCasFinder 1494235-1494265 31 NZ_CP011866 Enterobacter asburiae strain ATCC 35953 plasmid unnamed 3, complete sequence 14816-14846 7 0.774
CP029041_7 7.1|1494235|31|CP029041|CRISPRCasFinder 1494235-1494265 31 NC_019298 Rahnella sp. WMR121 plasmid pHW121, complete sequence 1909-1939 7 0.774
CP029041_7 7.1|1494235|31|CP029041|CRISPRCasFinder 1494235-1494265 31 NZ_KX364409 Aeromonas salmonicida subsp. salmonicida strain M16474-11 plasmid pAsa8, complete sequence 44287-44317 7 0.774
CP029041_7 7.1|1494235|31|CP029041|CRISPRCasFinder 1494235-1494265 31 NC_012209 Yersinia enterocolitica plasmid pYe4449-2, complete sequence 14303-14333 7 0.774
CP029041_4 4.4|955625|33|CP029041|PILER-CR,CRISPRCasFinder,CRT 955625-955657 33 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 146596-146628 8 0.758
CP029041_5 5.23|966527|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966527-966558 32 MK764442 Flavobacterium phage FPSV-S1, complete genome 13559-13590 8 0.75
CP029041_5 5.23|966527|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966527-966558 32 MK764448 Flavobacterium phage FPSV-S27, complete genome 11629-11660 8 0.75
CP029041_5 5.23|966527|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966527-966558 32 MH992122 UNVERIFIED: Escherichia phage OLB35, complete genome 88700-88731 8 0.75
CP029041_5 5.25|966649|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966649-966680 32 NZ_CP014853 Bacillus thuringiensis strain HD12 plasmid pHD120345, complete sequence 320018-320049 8 0.75
CP029041_5 5.25|966649|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966649-966680 32 CP046513 Bacillus cereus strain JHU plasmid p2, complete sequence 246623-246654 8 0.75
CP029041_4 4.2|955503|32|CP029041|PILER-CR,CRISPRCasFinder,CRT 955503-955534 32 JQ067089 Pseudomonas phage PaMx28, partial genome 8007-8038 9 0.719
CP029041_4 4.3|955564|32|CP029041|PILER-CR,CRISPRCasFinder,CRT 955564-955595 32 NZ_CP041249 Raoultella electrica strain DSM 102253 plasmid unnamed2, complete sequence 52808-52839 9 0.719
CP029041_4 4.10|955993|32|CP029041|PILER-CR,CRISPRCasFinder,CRT 955993-956024 32 MT234670 Pseudanabaena phage PA-SR01, complete genome 117329-117360 9 0.719
CP029041_4 4.11|956054|32|CP029041|PILER-CR,CRISPRCasFinder,CRT 956054-956085 32 NZ_CP021369 Acidovorax carolinensis strain P4 plasmid pACP4.3, complete sequence 3549-3580 9 0.719
CP029041_4 4.11|956054|32|CP029041|PILER-CR,CRISPRCasFinder,CRT 956054-956085 32 NZ_CP021369 Acidovorax carolinensis strain P4 plasmid pACP4.3, complete sequence 110006-110037 9 0.719
CP029041_5 5.5|965427|32|CP029041|PILER-CR,CRISPRCasFinder,CRT 965427-965458 32 NZ_CP045296 Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence 821604-821635 9 0.719
CP029041_5 5.5|965427|32|CP029041|PILER-CR,CRISPRCasFinder,CRT 965427-965458 32 NC_011273 Mycobacterium phage Myrna, complete genome 12501-12532 9 0.719
CP029041_5 5.18|966222|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966222-966253 32 MF140428 Mycobacterium phage Slimphazie, complete genome 51491-51522 9 0.719
CP029041_5 5.18|966222|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966222-966253 32 MN234231 Mycobacterium phage Rapunzel97, complete genome 51491-51522 9 0.719
CP029041_5 5.18|966222|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966222-966253 32 NC_023747 Mycobacterium phage BarrelRoll, complete genome 51476-51507 9 0.719
CP029041_5 5.18|966222|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966222-966253 32 MH513977 Mycobacterium phage Mynx, complete genome 51819-51850 9 0.719
CP029041_5 5.20|966344|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966344-966375 32 MN693685 Marine virus AFVG_250M1024, complete genome 1215-1246 9 0.719
CP029041_5 5.20|966344|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966344-966375 32 MN693729 Marine virus AFVG_250M1023, complete genome 35847-35878 9 0.719
CP029041_5 5.21|966405|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966405-966436 32 MN693367 Marine virus AFVG_25M492, complete genome 22092-22123 9 0.719
CP029041_5 5.22|966466|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966466-966497 32 NZ_LR214986 Mycoplasma cynos strain NCTC10142 plasmid 13 260799-260830 9 0.719
CP029041_5 5.24|966588|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966588-966619 32 NZ_CP049731 Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence 84065-84096 9 0.719
CP029041_5 5.24|966588|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966588-966619 32 NZ_CP053206 Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence 82149-82180 9 0.719
CP029041_5 5.5|965427|32|CP029041|PILER-CR,CRISPRCasFinder,CRT 965427-965458 32 NC_010699 Erwinia tasmaniensis Et1/99 plasmid pET45, complete sequence 31113-31144 10 0.688
CP029041_5 5.12|965855|32|CP029041|PILER-CR,CRISPRCasFinder,CRT 965855-965886 32 NZ_CP016890 Pantoea agglomerans strain C410P1 plasmid unnamed1, complete sequence 343111-343142 10 0.688
CP029041_5 5.20|966344|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966344-966375 32 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 396894-396925 10 0.688
CP029041_5 5.20|966344|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966344-966375 32 NZ_CP047220 Sphingobium yanoikuyae strain YC-JY1 plasmid unnamed3, complete sequence 24674-24705 10 0.688
CP029041_5 5.24|966588|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966588-966619 32 NZ_CP050081 Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence 83660-83691 10 0.688
CP029041_5 5.24|966588|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966588-966619 32 NZ_CP050098 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence 90366-90397 10 0.688
CP029041_5 5.24|966588|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966588-966619 32 NZ_CP053440 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence 91005-91036 10 0.688
CP029041_5 5.24|966588|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966588-966619 32 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 875600-875631 10 0.688
CP029041_5 5.24|966588|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966588-966619 32 NZ_CP048281 Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence 111854-111885 10 0.688
CP029041_5 5.24|966588|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966588-966619 32 NZ_CP054022 Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence 291369-291400 10 0.688
CP029041_5 5.24|966588|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966588-966619 32 NZ_CP054032 Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence 34828-34859 10 0.688
CP029041_5 5.24|966588|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966588-966619 32 NZ_CP022565 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence 595777-595808 10 0.688
CP029041_5 5.28|966833|32|CP029041|CRISPRCasFinder,CRT 966833-966864 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1151729-1151760 10 0.688
CP029041_5 5.28|966833|32|CP029041|CRISPRCasFinder,CRT 966833-966864 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 661429-661460 10 0.688
CP029041_5 5.6|965488|32|CP029041|PILER-CR,CRISPRCasFinder,CRT 965488-965519 32 NZ_CP032324 Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence 238200-238231 11 0.656
CP029041_5 5.6|965488|32|CP029041|PILER-CR,CRISPRCasFinder,CRT 965488-965519 32 NZ_CP022366 Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence 77505-77536 11 0.656
CP029041_5 5.6|965488|32|CP029041|PILER-CR,CRISPRCasFinder,CRT 965488-965519 32 NZ_CP007797 Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence 389749-389780 11 0.656
CP029041_5 5.6|965488|32|CP029041|PILER-CR,CRISPRCasFinder,CRT 965488-965519 32 NZ_CP032343 Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence 156234-156265 11 0.656
CP029041_5 5.6|965488|32|CP029041|PILER-CR,CRISPRCasFinder,CRT 965488-965519 32 NZ_CP012917 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence 572348-572379 11 0.656
CP029041_5 5.16|966100|32|CP029041|CRISPRCasFinder,CRT,PILER-CR 966100-966131 32 NZ_CP049817 Monaibacterium sp. ALG8 plasmid unnamed6, complete sequence 60899-60930 11 0.656

1. spacer 4.4|955625|33|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to MT774487 (Salmonella phage MG40, complete genome) position: , mismatch: 0, identity: 1.0 

tcacaaatgcgaggagtcagcccaatgagcaac	CRISPR spacer
tcacaaatgcgaggagtcagcccaatgagcaac	Protospacer
*********************************

2. spacer 4.4|955625|33|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 1, identity: 0.97 

tcacaaatgcgaggagtcagcccaatgagcaac	CRISPR spacer
tcacaaatgcgaggagtcagaccaatgagcaac	Protospacer
******************** ************

3. spacer 4.4|955625|33|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 1, identity: 0.97 

tcacaaatgcgaggagtcagcccaatgagcaac	CRISPR spacer
tcacaaatgcgaggagtcagaccaatgagcaac	Protospacer
******************** ************

4. spacer 4.4|955625|33|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 1, identity: 0.97 

tcacaaatgcgaggagtcagcccaatgagcaac	CRISPR spacer
tcacaaatgcgaggagtcagaccaatgagcaac	Protospacer
******************** ************

5. spacer 5.12|965855|32|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP008900 (Enterobacter hormaechei subsp. hoffmannii ECNIH3 plasmid pENT-d4a, complete sequence) position: , mismatch: 1, identity: 0.969 

gctacggtaaacgtgaatgtgcgtattgacgc	CRISPR spacer
gctacagtaaacgtgaatgtgcgtattgacgc	Protospacer
*****.**************************

6. spacer 4.4|955625|33|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to MG969415 (UNVERIFIED: Salmonella phage GE_vB_TR, complete genome) position: , mismatch: 2, identity: 0.939 

tcacaaatgcgaggagtcagcccaatgagcaac	CRISPR spacer
tcacaaatgcgaggggccagcccaatgagcaac	Protospacer
**************.*.****************

7. spacer 5.12|965855|32|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY978631 (Klebsiella pneumoniae strain 447 plasmid p447-IMP, complete sequence) position: , mismatch: 2, identity: 0.938 

gctacggtaaacgtgaatgtgcgtattgacgc	CRISPR spacer
gctaccgtaaacgtgaatgtgcgtattgaagc	Protospacer
***** *********************** **

8. spacer 5.12|965855|32|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to CP045557 (Citrobacter sp. S39 plasmid pS39-2, complete sequence) position: , mismatch: 2, identity: 0.938 

gctacggtaaacgtgaatgtgcgtattgacgc	CRISPR spacer
gctaccgtaaacgtgaacgtgcgtattgacgc	Protospacer
***** ***********.**************

9. spacer 5.12|965855|32|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022136 (Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906 

gctacggtaaacgtgaatgtgcgtattgacgc	CRISPR spacer
gctacagtaaatgtgaatgtgcgtattgacac	Protospacer
*****.*****.******************.*

10. spacer 5.12|965855|32|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029996 (Salmonella enterica subsp. salamae strain SA20053897 plasmid pSA20053897.1, complete sequence) position: , mismatch: 3, identity: 0.906 

gctacggtaaacgtgaatgtgcgtattgacgc	CRISPR spacer
gctacagtaaatgtgaatgtgcgtattgacac	Protospacer
*****.*****.******************.*

11. spacer 5.12|965855|32|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022036 (Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 plasmid punamed1, complete sequence) position: , mismatch: 3, identity: 0.906 

gctacggtaaacgtgaatgtgcgtattgacgc	CRISPR spacer
gctacagtaaatgtgaatgtgcgtattgacac	Protospacer
*****.*****.******************.*

12. spacer 5.12|965855|32|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to NC_019335 (Salmonella sp. 14 plasmid p14-95A, complete sequence) position: , mismatch: 3, identity: 0.906 

gctacggtaaacgtgaatgtgcgtattgacgc	CRISPR spacer
gctacagtaaatgtgaatgtgcgtattgacac	Protospacer
*****.*****.******************.*

13. spacer 5.12|965855|32|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to NC_019336 (Salmonella sp. 40 plasmid p40-95A, complete sequence) position: , mismatch: 3, identity: 0.906 

gctacggtaaacgtgaatgtgcgtattgacgc	CRISPR spacer
gctacagtaaatgtgaatgtgcgtattgacac	Protospacer
*****.*****.******************.*

14. spacer 7.1|1494235|31|CP029041|CRISPRCasFinder matches to KY271396 (Klebsiella phage 2 LV-2017, complete genome) position: , mismatch: 6, identity: 0.806 

acaaacccagcaatggcgcggctttgaagca	CRISPR spacer
gcgagcccagcaatggcgcgggtttgaaggt	Protospacer
.*.*.**************** *******

15. spacer 7.1|1494235|31|CP029041|CRISPRCasFinder matches to MN098327 (Klebsiella phage Mulock, complete genome) position: , mismatch: 6, identity: 0.806 

acaaacccagcaatggcgcggctttgaagca	CRISPR spacer
gcgagcccagcaatggcgcgggtttgaaggt	Protospacer
.*.*.**************** *******

16. spacer 7.1|1494235|31|CP029041|CRISPRCasFinder matches to KY271395 (Klebsiella phage 2b LV-2017, complete genome) position: , mismatch: 6, identity: 0.806 

acaaacccagcaatggcgcggctttgaagca	CRISPR spacer
gcgagcccagcaatggcgcgggtttgaaggt	Protospacer
.*.*.**************** *******

17. spacer 7.1|1494235|31|CP029041|CRISPRCasFinder matches to MK448230 (Klebsiella phage ST16-OXA48phi5.2, complete genome) position: , mismatch: 6, identity: 0.806 

acaaacccagcaatggcgcggctttgaagca	CRISPR spacer
acgagtccagcaatggcgcgggtttgaaggt	Protospacer
**.*..*************** *******

18. spacer 4.4|955625|33|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to JQ182733 (Enterobacterial phage mEp213, complete genome) position: , mismatch: 7, identity: 0.788 

tcacaaatgcgaggagtcagcccaatgagcaac	CRISPR spacer
gcagattcgcaaggaggcagcccaatgagcaac	Protospacer
 ** *  .**.***** ****************

19. spacer 4.4|955625|33|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to NC_019706 (Enterobacteria phage mEp043 c-1, complete genome) position: , mismatch: 7, identity: 0.788 

tcacaaatgcgaggagtcagcccaatgagcaac	CRISPR spacer
gcagattcgcaaggaggcagcccaatgagcaac	Protospacer
 ** *  .**.***** ****************

20. spacer 5.25|966649|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP004876 (Bacillus thuringiensis serovar kurstaki str. HD-1 plasmid pBMB299, complete sequence) position: , mismatch: 7, identity: 0.781 

taaaacgatattcccggataaaaacggaaagc	CRISPR spacer
tgaaaaactattcccgactaaaaacggaaagt	Protospacer
*.*** . ********. *************.

21. spacer 5.25|966649|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NC_017203 (Bacillus thuringiensis serovar chinensis CT-43 plasmid pCT281, complete sequence) position: , mismatch: 7, identity: 0.781 

taaaacgatattcccggataaaaacggaaagc	CRISPR spacer
tgaaaaactattcccgactaaaaacggaaagt	Protospacer
*.*** . ********. *************.

22. spacer 5.25|966649|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NC_020384 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-285, complete sequence) position: , mismatch: 7, identity: 0.781 

taaaacgatattcccggataaaaacggaaagc	CRISPR spacer
tgaaaaactattcccgactaaaaacggaaagt	Protospacer
*.*** . ********. *************.

23. spacer 5.25|966649|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011350 (Bacillus thuringiensis strain YC-10 plasmid pYC1, complete sequence) position: , mismatch: 7, identity: 0.781 

taaaacgatattcccggataaaaacggaaagc	CRISPR spacer
tgaaaaactattcccgactaaaaacggaaagt	Protospacer
*.*** . ********. *************.

24. spacer 5.25|966649|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015152 (Bacillus thuringiensis strain Bc601 plasmid pBTBC2, complete sequence) position: , mismatch: 7, identity: 0.781 

taaaacgatattcccggataaaaacggaaagc	CRISPR spacer
tgaaaaactattcccgactaaaaacggaaagt	Protospacer
*.*** . ********. *************.

25. spacer 5.25|966649|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013056 (Bacillus thuringiensis strain YWC2-8 plasmid pYWC2-8-1, complete sequence) position: , mismatch: 7, identity: 0.781 

taaaacgatattcccggataaaaacggaaagc	CRISPR spacer
tgaaaaactattcccgactaaaaacggaaagt	Protospacer
*.*** . ********. *************.

26. spacer 5.25|966649|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP004861 (Bacillus thuringiensis serovar kurstaki str. YBT-1520 plasmid pBMB293, complete sequence) position: , mismatch: 7, identity: 0.781 

taaaacgatattcccggataaaaacggaaagc	CRISPR spacer
tgaaaaactattcccgactaaaaacggaaagt	Protospacer
*.*** . ********. *************.

27. spacer 5.25|966649|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014866 (Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK2, complete sequence) position: , mismatch: 7, identity: 0.781 

taaaacgatattcccggataaaaacggaaagc	CRISPR spacer
tgaaaaactattcccgactaaaaacggaaagt	Protospacer
*.*** . ********. *************.

28. spacer 5.25|966649|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010091 (Bacillus thuringiensis serovar galleriae strain 4G5 plasmid pBMB267, complete sequence) position: , mismatch: 7, identity: 0.781 

taaaacgatattcccggataaaaacggaaagc	CRISPR spacer
tgaaaaactattcccgactaaaaacggaaagt	Protospacer
*.*** . ********. *************.

29. spacer 7.1|1494235|31|CP029041|CRISPRCasFinder matches to NC_008771 (Verminephrobacter eiseniae EF01-2 plasmid pVEIS01, complete sequence) position: , mismatch: 7, identity: 0.774 

acaaacccagcaatggcgcggctttgaagca	CRISPR spacer
tgaaacccagcattggcgcggcttttcggcc	Protospacer
  ********** ************  .**

30. spacer 7.1|1494235|31|CP029041|CRISPRCasFinder matches to NZ_CP047230 (Moraxella osloensis strain YV1 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.774 

acaaacccagcaatggcgcggctttgaagca	CRISPR spacer
cctagcccagtaatggcgcggctttgaactg	Protospacer
 * *.*****.***************** ..

31. spacer 7.1|1494235|31|CP029041|CRISPRCasFinder matches to NZ_CP011866 (Enterobacter asburiae strain ATCC 35953 plasmid unnamed 3, complete sequence) position: , mismatch: 7, identity: 0.774 

acaaacccagcaatggcgcggctttgaagca	CRISPR spacer
agaaatccagcaatggcgcggcttgtagccc	Protospacer
* ***.******************  *. *

32. spacer 7.1|1494235|31|CP029041|CRISPRCasFinder matches to NZ_CP011866 (Enterobacter asburiae strain ATCC 35953 plasmid unnamed 3, complete sequence) position: , mismatch: 7, identity: 0.774 

acaaacccagcaatggcgcggctttgaagca	CRISPR spacer
agaaatccagcaatggcgcggcttgtagccc	Protospacer
* ***.******************  *. *

33. spacer 7.1|1494235|31|CP029041|CRISPRCasFinder matches to NZ_CP011866 (Enterobacter asburiae strain ATCC 35953 plasmid unnamed 3, complete sequence) position: , mismatch: 7, identity: 0.774 

acaaacccagcaatggcgcggctttgaagca	CRISPR spacer
agaaatccagcaatggcgcggcttgtagccc	Protospacer
* ***.******************  *. *

34. spacer 7.1|1494235|31|CP029041|CRISPRCasFinder matches to NC_019298 (Rahnella sp. WMR121 plasmid pHW121, complete sequence) position: , mismatch: 7, identity: 0.774 

acaaacccagcaatggcgcggctttgaagca	CRISPR spacer
agaaatccagcaatggcgcggcttgtagccc	Protospacer
* ***.******************  *. *

35. spacer 7.1|1494235|31|CP029041|CRISPRCasFinder matches to NZ_KX364409 (Aeromonas salmonicida subsp. salmonicida strain M16474-11 plasmid pAsa8, complete sequence) position: , mismatch: 7, identity: 0.774 

acaaacccagcaatggcgcggctttgaagca----	CRISPR spacer
gaaaacccagcaacggcgcggctt----gcatcgc	Protospacer
. ***********.**********    ***

36. spacer 7.1|1494235|31|CP029041|CRISPRCasFinder matches to NC_012209 (Yersinia enterocolitica plasmid pYe4449-2, complete sequence) position: , mismatch: 7, identity: 0.774 

acaaacccagcaatggcgcggctttgaagca-	CRISPR spacer
acaaaaccagtaatggcgcggc-ttacggcgt	Protospacer
***** ****.*********** **. .**.

37. spacer 4.4|955625|33|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 8, identity: 0.758 

tcacaaatgcgaggagtcagcccaatgagcaac	CRISPR spacer
cgagacatgcgaggaggcagcgcaatgagcgat	Protospacer
. * * ********** **** ********.*.

38. spacer 5.23|966527|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to MK764442 (Flavobacterium phage FPSV-S1, complete genome) position: , mismatch: 8, identity: 0.75 

gatgacccgtatacgttcaaaatcaaaatcta---	CRISPR spacer
tgagagccgaatacgttcaaaatcaaa---taaat	Protospacer
 . ** *** *****************   **

39. spacer 5.23|966527|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to MK764448 (Flavobacterium phage FPSV-S27, complete genome) position: , mismatch: 8, identity: 0.75 

gatgacccgtatacgttcaaaatcaaaatcta---	CRISPR spacer
tgagagccgaatacgttcaaaatcaaa---taaat	Protospacer
 . ** *** *****************   **

40. spacer 5.23|966527|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to MH992122 (UNVERIFIED: Escherichia phage OLB35, complete genome) position: , mismatch: 8, identity: 0.75 

gatgacccgtatacgttcaaaatcaa-aatcta	CRISPR spacer
ccggacccttatacgttcaaaataaatgatat-	Protospacer
   ***** ************** ** .** *

41. spacer 5.25|966649|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014853 (Bacillus thuringiensis strain HD12 plasmid pHD120345, complete sequence) position: , mismatch: 8, identity: 0.75 

taaaacgatattcccggataaaaacggaaagc	CRISPR spacer
cgaaaaactattcccgactaaaaacggaaagt	Protospacer
..*** . ********. *************.

42. spacer 5.25|966649|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to CP046513 (Bacillus cereus strain JHU plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75 

taaaacgatattcccggataaaaacggaaagc	CRISPR spacer
cgaaaaactattcccgactaaaaacggaaagt	Protospacer
..*** . ********. *************.

43. spacer 4.2|955503|32|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to JQ067089 (Pseudomonas phage PaMx28, partial genome) position: , mismatch: 9, identity: 0.719 

agagcagcttgctcactaccggggcagaaggg	CRISPR spacer
agagcagcttgcttacttccgggaaaagaacc	Protospacer
*************.*** *****. *..*.

44. spacer 4.3|955564|32|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041249 (Raoultella electrica strain DSM 102253 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

tatttggacaatcaggtcgaggttcagtatga	CRISPR spacer
ctgttgggcaatcaggtcgacgttcagtcgat	Protospacer
.  ****.************ *******  .

45. spacer 4.10|955993|32|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to MT234670 (Pseudanabaena phage PA-SR01, complete genome) position: , mismatch: 9, identity: 0.719 

agagattgattaaatgaacagtaacaaactaa	CRISPR spacer
gttgcaagcttagatgaacagtaccaaactaa	Protospacer
.  *   * ***.********** ********

46. spacer 4.11|956054|32|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021369 (Acidovorax carolinensis strain P4 plasmid pACP4.3, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgcgtcagcgtggattaactcaacagcgctc	CRISPR spacer
caacgtcagcatggatgaactcaacaacatcc	Protospacer
  .*******.***** *********.*...*

47. spacer 4.11|956054|32|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021369 (Acidovorax carolinensis strain P4 plasmid pACP4.3, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgcgtcagcgtggattaactcaacagcgctc	CRISPR spacer
caacgtcagcatggatgaactcaacaacatcc	Protospacer
  .*******.***** *********.*...*

48. spacer 5.5|965427|32|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045296 (Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

tactggatatcaacctgcctgagttaaagacc	CRISPR spacer
ttctggatatcatgctgcctgagttggatgga	Protospacer
* **********  ***********..* .

49. spacer 5.5|965427|32|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to NC_011273 (Mycobacterium phage Myrna, complete genome) position: , mismatch: 9, identity: 0.719 

tactggatatcaacctgcctgagttaaagacc	CRISPR spacer
tcctggagatcatcctgcctgagttcatcggt	Protospacer
* ***** **** ************ *  . .

50. spacer 5.18|966222|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to MF140428 (Mycobacterium phage Slimphazie, complete genome) position: , mismatch: 9, identity: 0.719 

cacagagttaaacgccgctgcagcgctgttta	CRISPR spacer
ccgcaagttcaacgccgctgccgcgctgaaca	Protospacer
*   .**** *********** ******  .*

51. spacer 5.18|966222|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to MN234231 (Mycobacterium phage Rapunzel97, complete genome) position: , mismatch: 9, identity: 0.719 

cacagagttaaacgccgctgcagcgctgttta	CRISPR spacer
ccgcaagttcaacgccgctgccgcgctgaaca	Protospacer
*   .**** *********** ******  .*

52. spacer 5.18|966222|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NC_023747 (Mycobacterium phage BarrelRoll, complete genome) position: , mismatch: 9, identity: 0.719 

cacagagttaaacgccgctgcagcgctgttta	CRISPR spacer
ccgcaagttcaacgccgctgccgcgctgaaca	Protospacer
*   .**** *********** ******  .*

53. spacer 5.18|966222|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to MH513977 (Mycobacterium phage Mynx, complete genome) position: , mismatch: 9, identity: 0.719 

cacagagttaaacgccgctgcagcgctgttta	CRISPR spacer
ccgcaagttcaacgccgctgccgcgctgaaca	Protospacer
*   .**** *********** ******  .*

54. spacer 5.20|966344|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to MN693685 (Marine virus AFVG_250M1024, complete genome) position: , mismatch: 9, identity: 0.719 

ttccatattcaggatcatatccgcacgataac	CRISPR spacer
ttccatattcaggaacctatccgaccatccag	Protospacer
************** * ******  *. . *

55. spacer 5.20|966344|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to MN693729 (Marine virus AFVG_250M1023, complete genome) position: , mismatch: 9, identity: 0.719 

ttccatattcaggatcatatccgcacgataac	CRISPR spacer
ttccatattcaggaacctatccgaccatccag	Protospacer
************** * ******  *. . *

56. spacer 5.21|966405|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to MN693367 (Marine virus AFVG_25M492, complete genome) position: , mismatch: 9, identity: 0.719 

cctgacgccaacggaaacgtgaaagtctcaac	CRISPR spacer
cgtgacgccaacggaaacgtcgaaggcgtttt	Protospacer
* ****************** .*** * .  .

57. spacer 5.22|966466|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR214986 (Mycoplasma cynos strain NCTC10142 plasmid 13) position: , mismatch: 9, identity: 0.719 

tgttcccccaaggttcaaaaattcaatatgag	CRISPR spacer
atttttagcaatgttcataaattcaatatgat	Protospacer
  **..  *** ***** *************

58. spacer 5.24|966588|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 9, identity: 0.719 

caatagggaaaatggcatatgagggcgcgcaa	CRISPR spacer
taataggcaaaatggcataggaggaggaacgt	Protospacer
.****** *********** ****. * .*.

59. spacer 5.24|966588|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 9, identity: 0.719 

caatagggaaaatggcatatgagggcgcgcaa	CRISPR spacer
taataggcaaaatggcataggaggaggaacgt	Protospacer
.****** *********** ****. * .*.

60. spacer 5.5|965427|32|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to NC_010699 (Erwinia tasmaniensis Et1/99 plasmid pET45, complete sequence) position: , mismatch: 10, identity: 0.688 

tactggatatcaacctgcctgagttaaagacc	CRISPR spacer
caccggatatcagcctgcctgagtccgccccg	Protospacer
.**.********.***********. .   *

61. spacer 5.12|965855|32|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016890 (Pantoea agglomerans strain C410P1 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

gctacggtaaacgtgaatgtgcgtattgacgc	CRISPR spacer
cagccggttaaagtgaatgtgcgtattattgt	Protospacer
    **** ** ***************. .*.

62. spacer 5.20|966344|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 10, identity: 0.688 

ttccatattcaggatcatatccgcacgataac	CRISPR spacer
cctttcattctggatcgtatccgcacgatatg	Protospacer
.... .**** *****.*************

63. spacer 5.20|966344|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP047220 (Sphingobium yanoikuyae strain YC-JY1 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688 

ttccatattcaggatcatatccgcacgataac	CRISPR spacer
ccactcattccggttcatatccgcacgatttg	Protospacer
.. * .**** ** ***************

64. spacer 5.24|966588|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 10, identity: 0.688 

caatagggaaaatggcatatgagggcgcgcaa	CRISPR spacer
taataggcaaaatggcataggaggaggaatgt	Protospacer
.****** *********** ****. * ...

65. spacer 5.24|966588|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 10, identity: 0.688 

caatagggaaaatggcatatgagggcgcgcaa	CRISPR spacer
taataggcaaaatggcataggaggaggaatgt	Protospacer
.****** *********** ****. * ...

66. spacer 5.24|966588|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 10, identity: 0.688 

caatagggaaaatggcatatgagggcgcgcaa	CRISPR spacer
taataggcaaaatggcataggaggaggaatgt	Protospacer
.****** *********** ****. * ...

67. spacer 5.24|966588|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

caatagggaaaatggcatatgagggcgcgcaa	CRISPR spacer
taataggcaaaatggcataggaggaggaatgt	Protospacer
.****** *********** ****. * ...

68. spacer 5.24|966588|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 10, identity: 0.688 

caatagggaaaatggcatatgagggcgcgcaa	CRISPR spacer
taataggcaaaatggcataggaggaggaatgt	Protospacer
.****** *********** ****. * ...

69. spacer 5.24|966588|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 10, identity: 0.688 

caatagggaaaatggcatatgagggcgcgcaa	CRISPR spacer
taataggcaaaatggcataggaggaggaatgt	Protospacer
.****** *********** ****. * ...

70. spacer 5.24|966588|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 10, identity: 0.688 

caatagggaaaatggcatatgagggcgcgcaa	CRISPR spacer
taataggcaaaatggcataggaggaggaatgt	Protospacer
.****** *********** ****. * ...

71. spacer 5.24|966588|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 10, identity: 0.688 

caatagggaaaatggcatatgagggcgcgcaa	CRISPR spacer
taataggcaaaatggcataggaggaggaatgt	Protospacer
.****** *********** ****. * ...

72. spacer 5.28|966833|32|CP029041|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.688 

aggggcgttccgcagtcgacaagggctgaaaa	CRISPR spacer
ccgggcggtccgcagtcgacgagggtgaggga	Protospacer
  ***** ************.****. ....*

73. spacer 5.28|966833|32|CP029041|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.688 

aggggcgttccgcagtcgacaagggctgaaaa	CRISPR spacer
ccgggcggtccgcagtcgacgagggtgaggga	Protospacer
  ***** ************.****. ....*

74. spacer 5.6|965488|32|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 11, identity: 0.656 

ccttgtgtgcaatgcaacaaaggcgaactggc	CRISPR spacer
gattgggtgcaatgcaataaaggcgtgtaaag	Protospacer
  *** ***********.******* .. ..

75. spacer 5.6|965488|32|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 11, identity: 0.656 

ccttgtgtgcaatgcaacaaaggcgaactggc	CRISPR spacer
gattgggtgcaatgcaataaaggcgtgtaaag	Protospacer
  *** ***********.******* .. ..

76. spacer 5.6|965488|32|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 11, identity: 0.656 

ccttgtgtgcaatgcaacaaaggcgaactggc	CRISPR spacer
gattgggtgcaatgcaataaaggcgtgtaaag	Protospacer
  *** ***********.******* .. ..

77. spacer 5.6|965488|32|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032343 (Azospirillum brasilense strain MTCC4038 plasmid p4, complete sequence) position: , mismatch: 11, identity: 0.656 

ccttgtgtgcaatgcaacaaaggcgaactggc	CRISPR spacer
gattgggtgcaatgcaataaaggcgtgtaaag	Protospacer
  *** ***********.******* .. ..

78. spacer 5.6|965488|32|CP029041|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012917 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p3, complete sequence) position: , mismatch: 11, identity: 0.656 

ccttgtgtgcaatgcaacaaaggcgaactggc	CRISPR spacer
gattgggtgcaatgcaataaaggcgtgtaaag	Protospacer
  *** ***********.******* .. ..

79. spacer 5.16|966100|32|CP029041|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049817 (Monaibacterium sp. ALG8 plasmid unnamed6, complete sequence) position: , mismatch: 11, identity: 0.656 

cagtctgcggggtttcctgcgtgtaatgaagt	CRISPR spacer
tcacctgcgggttttcctgcgcgtaatcggtg	Protospacer
. ..******* *********.***** ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 654734 : 669057 15 uncultured_Caudovirales_phage(90.0%) portal,capsid,protease,tail,head,terminase NA
DBSCAN-SWA_2 1197624 : 1295739 114 Salmonella_phage(51.52%) portal,capsid,protease,tail,head,holin,terminase,tRNA NA
DBSCAN-SWA_3 1481549 : 1530951 79 Salmonella_phage(62.32%) tail,lysis,head NA
DBSCAN-SWA_4 1770467 : 1779638 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_5 1855479 : 1864340 8 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_6 1955283 : 1962536 8 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_7 2747280 : 2794694 60 Salmonella_phage(32.56%) portal,capsid,integrase,tail,head,holin,terminase,tRNA attL 2741806:2741865|attR 2790659:2790812
DBSCAN-SWA_8 3395730 : 3401248 7 Salmonella_phage(85.71%) integrase attL 3393681:3393698|attR 3406593:3406610

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage